Ciona_savignyi Locus ENSCSAVG00000000669
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000000669
Ciona_savignyi
ENSCSAVG00000000669
reftig_247
snoZ195, snoZ195
2791..2876, 4088..4173
10352
TTAATATAAGGTTAATCACTTTGGTTTAATATAAGGTTAATAACTTTGGTTTAACATAG
TCCGACAGATTAGTCTGTTAGGTTTGTGCGTCGTCTTTCAGCTGAAGTGTGGCAGATTAG
CTAGTCTGTTGTGTCCTTGTGAAAGACACTTAATGGACATTATCAGAACCTAGAGGAATA
ATGGGTTCTACTATTGAAGAAACGTGTAAATAATACTCAACATACTGCAATAGCTCAGGT
AACTTGACGGTGGGCGCGAGGTGATGACGTTTTAGATTTTTTCCTGGTTTTCCCAATCAA
TCCCCATTCAAACCTATCATATTAAAATTAAGAAGAATTCGTAAGGTCGTAGTCCAAATG
TATAAAATGAATGATGACACTTGCAGAAAGTTTTATCAGTGCACACATATCAAAATCTAT
TGATACAAAATCGTACTTTATTTCGTTGAGAGCAGTAATTAATAATTAAATAAATTAGTG
AACTGTCATTATTAAAAAGCTATTAGTTTAATTTACAAAATACATTTAATTTTAGGTAAT
TATTTTGGTTAATAACATCATATCGTGCCTTTAAGAAAATAGTTGGTCAACACTACTGTG
TATTTTTCTAGAACACACGTGTTTGAAGAAGGGTCGCACGTGTGAAGAACTATTACATTG
GTTATATTATGCGTACGTTTTCAAGCGGTCCAAGTAATTTTATGCTTATTTCAGGCATTT
TTCTTCGTTTAATAGAAGTATAGAATATTTTATATTTATCCCCGTGAATGGGAAAACGCA
AAGGCCAGTTGTGTCCTTGAGCAGTGAGCACGGTAGTAATCGAACGAACCAACTAACTTT
ACTATGGGTTATATCATATTCAGTACCATGCAATGAACTTTGGGAAATGCTACCGGTCAA
TAGTCAATCTGGACTGACGCCATTGCTATTTCATATTGTGAACTAACATTGCTTGTAAAT
AATTAAACTTTTATTTCCTAGAGCGCAATTGTGTTTTGCAATTCCTGTTAGAATCTTTTT
TCCATTATTTAAATCACTGTCCATCATGCATCGATTTGCTATGTTGACCCACAAATCCAT
TCTTCCCGCTACAAGAGCAATATGCAGGGGGTACGCGAAGGACCTCAAATTCGGTTCCAG
TGCAAGACAAGAAATGTTAGCAGGTCAGTTTCTCCGGTTTTATTTGAGAAAACTATAAGA
AGTTATTGAGTAGGAGGGAAACTGCTAAAATGGGCCGTTATGTGTGATATTAAATGGGGG
TTAAAGTTTTAAAAGCAAAGTTTTGGGGTTGAAATTATCGCTTCGTATAGGATTACATTA
AACTGTTTCGGACTTACTATTCATTAATTACACACAAAAACGGAAGCTTGCTGCTGTTTA
TCTTTTTTCTTTAATGTAGTGTTATTTCAAATATTTATGTATACTGTATACATATCACTA
TCATAATTAGTTTATTTATATTTTCTAGTGCAGTAATGTTCTGCACTTAAAGTGCTTTCT
TTAATAAATGTAGTGCAATAACTGTTCTTGCACCAATTATAATTTAATGTTTTATAAAGT
GTGTTTTGAAACGGTTTTTTAACCACTGGTGGAATTTCATTTTAGGGGGTTTTTCTTTTT
CCACTTAATCCCAAAGCCGGCTCCCCCCTCAGTACTGGGTCGCGCTTGCACACTTTACTC
AAGGCTTAAATAACACCAAATTTAATTAGTTAATTTTGATTTAAATTGTTTTTGTTGAAA
TTTATTTTTTTTAATGTAAGGTTTAACGGCCACGTCATTTTTTTCCATAACTTGCATTGT
GTCTAGTCACTGGCGTGTTTTAACTACTGTAGTTTTGCCGTTTCATCCTGTCTCCTTAAT
TTGTAACAAATGTTGTATTCTTCTTTATTGTAATGAAGGAGCAAAAAAATAAACTAAACT
AAACTAAACTAGAATCAGTTTCCTTAGTTTAAGCAATTTCCTTGTTTATCTTGTTATGGT
GTTGCACGATTTTGTATTTAACTTCCCATTCATTGAATGACTTTTTGTCATTGCGAAGGC
CAACTTTAAAATGGCATATGCACGCAAAGATTAATTCTACAAATATTCAGCTAGTTGGTA
ACATATTGGATTATTTGCCCGTATGGAAAGTACGTCAATTTTCGACGAGATCTCGAGTGT
GCACGCACCAAATATTTAAGTGTGCAGTGTGCAAACGTCCAAGAGTGCACACTTCAAGTG
TGCACACAATCTCATTTTCATTACTGTTTTACCAAAATCTTAAAAAAACATATTATTCTA
TCCTCAATTTTTCGTGTCCGTCAGCTAACGTATCTATCTACGCAACAAAAACGTTGCTGA
CAGTAAATTACCCGAGGTCCAGAGGTAGGTTTACAGGTTTGTTGGAAATTATACGATGTT
TATTGTTTATGTTTAAACATCGCTAGCTTGCGAGCGTGTGTGAAATTACCCAAGTGTGCA
AAGACGCGGGGGTAAAAAAAAAACTCGAGTGTGCAGCTGCCGTACTTTCCATACTGGATT
ATTTGCTAAAGTGTTATGGAATCAAAATAATTAATTCTACTGTGCCATTTGGAAATGAAC
TAAGCAGACATTGCTGAAACCCAGTAAATCAATGTTTGAACAAAAATATCTAAGTTTGAA
TACCATTTGGCACAATAGCTCCAGTAACCCATTGTGGGTTGAAATCTGTGTTGTATGTTC
ATAGGGACATCACTGTCTTGCTTACTTGATATTTCCCATGCAACTGACAAAGTCCTCACA
ATAACCTCTATTAGTGTTAGCCCTGATACTTTGTGTCGGTGATGATGATTCAACCACAAA
CCATCGAATCCTCTACGGAGGTCATGTGACCAACCATGCACTACCATCTGAGACACAATC
TATCAAACCATATTTAAAAAGAAAATAAGAAATTTTCCACTAAATAACAAAGAATAATTT
ATTAAACATCAGCTGTAAATATTCTACTAGAATAAACCAATTAATTTTCAAAAAAATTCT
TTTATAAATATTTTAAGGATTTTGATTTTTATTATAAGCCTAAATTACACACCATAAACC
CAAATAAATTTTATGAATTTAATTTATATTGTGGCAATTTGCCGTTCAGGTGTCAACCAA
TTAGCTGATGCGGTCGCCGTGACGATGGGACCAAAGGGTCGGAACGTGGTCCTTGAGCAG
TCGTGGGGTTCACCCAAGGTCACCAAGGATGGCGTCACTGTAGCGAAAGGAATTGAATTC
AAAGACAAAATCAAGAACATCGGCGCGAAGCTCGTGCAAGATGTGGCGAACAGCACGAAC
GAGGAGGCCGGCGACGGCACGACAACGGCGACCATCCTCGCGCGAGCCATCGCGAGGGAA
GGAAGCGATAAGATCAGTCGCGGCACCAACCCCATCGAAATGCGCCGCGGCATACAGAAG
GCCGTGCAGGTTGTCATCGAGGAATTGAAGAAAATGTCGAAACAAGTTACAACCCCGGAG
GAAATCGCGCAAGTCGCCACGATATCGGCCAACGGCGACGTGGAGGTGGGCCGCGGTTAG
AGAAGGTGTTCGATTGCCTTCCCCCACGAGCGATGGAGAAGGTGGGAAGGAATGGTGTGA
TCACCGTGAAAGATGGGAAGACATTGAACGATGAGTTGGAAGTGATTGAAGGGATGAAGT
TCGATCGCGGCTACATCTCCCCTTATTTTATAAACTCCGCAAAAGGACAAAAAGTGGAAT
TCCAAAACGCTTTCGTACTATTGTCAGAAAAGAAAATCAGCACAGTGCAAGTGAGTATTA
GGAGATTTGATACAAATTTAATAAATATTTTATTAGATTGAAAATCATGGGTGTTATCAC
AGAAGCAATCAGCAGATAACCATGCACTTACAATTGGTTTACTGAGCTATTAAATTGTGG
TGTATATGATAGAGACATTGCTTTAATTTTTCTAGCACCTATTTATTTACTGGTTTCAGT
GCAAGACAGTAGAGAAGTAATGTTAACAGGTCGATTTCTCAGGTTTTGCGAATAAAAAAC
TAGGAGTAGGGAGGTAAAGACTTACAAATTCCTCTCAATAACCTCTATTTGCGCTAACCC
TGATACTTTGTGTCGGTGATGATGATTCAACCACAAACCATCGAATCCTCTACGGAGGTC
ATGTGACCAACCATGCACTACCATCTGAGACACAATCTATTAAACCATATTTAAATTTCA
CACAATGTCTGCTTAGCCCACAACCAAATAGCTAGCGACTGTTATTACAATATTACATGG
TTTTTTATTATAAAGAAACTGGATTTTATTTAACCACCTCTCATTCCCAGTCTACACTCT
TCATTTTCAACTGAACTCAGTTTAACACTTGGATGAAAATGTCGCAGTATCATTATAACT
TTTCTTAAAATCCACATCTCCATTGTCAGTCGATTGTTCCCGCACTTGAGCTGGCGAACG
CTCAGCGGAAACCACTCGTGATCATCGCGGAAGACGTGGACGGAGAGGCTCTCAGCACGC
TCGTCATCAATCGACTGAAGGTCGGACTTCAAATTGCCGCTGTCAAAGCTCCAGGTATGA
GGGGTCTTTTATGGAAGAAAAATTGTATTAATTAACGTCATTAGGGTAATTATCTTAATA
AATAAATGAAAATATATGCCAGTATATTGTACTTAGTAGTGTAATGCATAGACCTATTAC
CTATACTTAGCTATACTGTATTACATGTCTAATACTTTGTAAGGTAATTGTATCCATGGT
CACCTGTTATGAAGTTGCAACCACAAGGAACCAATACTGATTGACATATTGATTACAAAA
AGACCAATTTCTGAGACCAAAAAATTCACAGAGGGGTTTATTACATGCGATTTTGAAAAC
AAAAGTTGGTCACTGTCCAACTTTTTATAAAGTAAAAATATTATGCACACAAATATTAAT
CTGCCATATTAAACGGGGCAGGTTAAAACTTATTTTATGAATGAATGAATATATGCCGGC
AAAAAGTACAAAGTATAAAGCATACATCTGAATTATATGTTTAATATTTCGCCAGGTTTT
GGTGACAACCGCAAGAATACAATGAAAGACATAGCGGTGGCTACCGGGGGACTTGTGTTT
GGGGAGGATGCGTTGGAATTGAAGATTGAAGATGTTCAAGCGCATGATCTTGGGCAGGTT
GGTTGGGGATTGTGTTTTAAACTTGTGACAGAGAATTGTTTCTTTCGTATGCAGCACACT
GCATTTGCTTCCACAAGCCCACCGATTGGCTTGGTGGGTTAGTGCTTTGCTTTTGAGCTA
AAAGGTTGCGGGTTTGGAAGGTTTGGAACTGTCTCTAGCTAGTCGGAGCAAGGCGCTTAA
CGTACATTGCCTGTGGGAATAATGGGTTCTACTAAATTAAAAACAAGTGTAAATCATGCA
AAACACACTGCGATAGCTCCGGTAACCCGACGGTGGACGTGATGTAGTTTGATTGCCCGT
GTTTTAAATGCCCCATGCGATTCCCATTCACTGGGATAAACATACTCTATCATCCGGCAA
TTGACTGCCCATGAACTATCTGGTAGCTTATGGCAACTTTTTCACAACATTTAAAGCAAA
CAATGGGAGTTTATAGTTCATAATCGACCACCTTGCTAGCTGTAACGTGATAATCTTCAT
TGTGATAACATAAGGATCTCCTCTTCCCCACGATCCCATCCTATCTTCTTCCCCACGACC
CACTGATCCCATCCTCCCCAGGTTGAAGAGATCACGATCACCAAGGATGATTGTCTCCTG
CTCCGAGGGAAGGGGAAGTCGGAAGATATTGAGAGGAGGATCGGACAGATCTATGAGCAG
ATTGAAGACACCAGCAGCGATTACGAGCGCGAGAAACTCAACGAACGATTAGCGAAGTTG
TCCAGTGGAGTAGCCGTGCTGAAGGTACGAATGAGTTGGTTGAATATCGGATGAATTAAA
CGAGTTTTCGGATTCAAAAAGTTTATAATAAGTTGTTCTAAGTATTGCATAATTTTTAAC
ACACTGCAATAGCTCCAGCAACTCGACTGTGGGCATGAGGTGTCTTACGATACCCATGGA
TAAAGCCTGGCTTCCCACCCATGAGGATATAAATGAACCAACCATCCACACACTGTAATA
GCTCCAGCAACTCGACTGTGAGCATGAGGTGTCTTACGATACCCGTGGATAAAGCCTGGC
TTCCCACTCACAAGGATATAAATGAACCAACCATCCACACACTGTAATAGCTCCAGCAAC
TCGACTGTGGGCATGCAATAGCTTCCAATGCTAAATATAAACCAGGTTCCATCAAATTAT
GATTTATAAGTATAAGTGTCGAAGTGAAAACAATTGTCGAACGACGAGGCATGTAATCGC
AGGTAGGTGGCAGTAGTGAGGTGGAGGTAAATGAGAAGAAGGATCGAGTGAACGACGCTC
TCAATGCGACACGAGCCGCTGTGGAAGAAGGGATTGTTCCTGGAGGCGGGGTTGCTCTTC
TTCGTTGCCATGACGCTGTCACTGCGCTCAAGGGCGCCACCAAGTAAGTGACATGTTTGC
AAACATAGATGTCCATTTATGCAGATGTCCATTTATGCTAAATTAAGATTCGAATTATGT
TTGGTTCTCGTCCAGTCGGGCTAAATAGAGATTCGAATCACATTCAAATTATGTTTGGTT
TAAAGTGTTTCATTTGGGCGAATTACAATTGCGTTTGAATCAAATTCAAATTTTTTTGGT
TCAAATTATTTTTGGTTGTTTTACATTTTTACAAATGATAAAATAAATCCAGCGGAGAAA
TTTCGTCGTATGAAAACGCCGATCAACGTTGAGCATTTTATAATGTTTCCATGTCCCACA
GAGACGAACAGGCAGGAGTTGACATCATAATGAAAGTCCTTCGCAACCCCTGCGCTCAAA
TAGCTGACAACGCTGGCATGGAGGGTCAGCTTGTTGCGGAGAAATTGTTGCAACATACAG
GTTGGTATGACGTCATAATATGTTTTGTCTGATGTATTTAAAATCAAACAGTCGGTCGTG
GGGAATTCCCTACAAACTGCTAGTTGGTCCACTCACCCCACCAGTCCTAGGCAGCTACCC
TGAAATTTATCAACTCATCACAACCGAACGTGTTTAATGTATATATTCGTGGTTGGTAAA
ACGCATAGGATATTCGTGTTTATCCTCGTGGGTGGGGAAACGCATGGTGCGTGCCGTACG
GTTAATCGTCATTACCTCGTGTTCGCCGTCAGATATAGAGATACCAAGTCAAACAAAATA
CTCTGTGAACTAAACATGTTACCATACTGCCTCTACCGATCTACCACCCCCCCCCCCCCC
CACCTACAACCCCCTGATCCCCCATTCCCACAGGCGACTATGGTTACGACGCAAGAGAAG
ACAAGTTCTGCAACATGTTGGAAGCTGGAATTCTCGATCCAACCAAGGTGGTCAAGCAAG
CTTTGTTGGACGCGTCTGGTGTCGCCTCGCTGCTCACAACCGCCGAGTGTGTCGTCACAG
AGGAACCGAAGGACGAACCCGCCATGCCGGCAGGTGGCGGTATGGGGGGCATGGGAGGAA
TGGGTGGTATGGGGGGTATGGGCGGTATGATGTAACAAGACCGTTTCATACGTCACAAAC
TGATACGTAGCAAAAGCCCGCTGTTATTCCATTACACTGGTTCGCTTCTTTGGAGCCGAA
ATCCGATTTTTTGGAGCCAAAATTGGAATTTCCAATGGATTCTGCCAAATTAAAATTTTT
GACCAAACTTCTCGAATAATGTCCTTCGCTTATTTCATTCTTTGCGACTTTATATAATTC
CTGCCATGATGGAGTGTTCCCTGATCGATGATGTCGTTTTAAATAAACCACAAAACCTTC
TCGCACTGTACAACATGTATTGATATAGTGGGCGGTTATAACTAGGCACTACAAGTACAT
TGCATTCTACACTACGATGCGAAACATGACGGGGGAGTTTCACGTCTACTTGTTCCAAAT
ATCGACTTGGTATGACGTCAACTGGTATTCTGCAACTGGTGTGTGGGTTTGTGACATCAC
AAAAGCCGATCGCGATGGCATTTTCACCTATTTGATGAAAATAATTGGAATTATGCGTTG
TAGGTATAGAGAGCAAAGCGTTTGTTGGTATATTGTCGCACATTGATACTTCTATGATCG
GAATGTTAATTTAACACATGAACTCGAAACGCTTGGTCTGTTGGTGCGTCGTCGAAAAGG
TTATGGGATCAAAACCAGCGGTAGCGCAGACAGAAGTGCCTTGCCCAACGACACACCCGA
CTAACTTGCGACCTTGGTCGAATCGGCAACCTTTCGGTTGATATGCATCGCACTAACCTA
CCAGACTTATCTGTAGGACAATCAAGAAGGTATTTAACAAATAAAGCCCGAACCAACGGA
GTGCTGGGCTTGACTAAGGATGTATGAACGTGTGTATCATACACAACACACTGCAATAAC
TTCGGTAACCCGACGATGGTTGCGAGGTGATCTGACGATTGCTCGTGTGTTAACCTCCTT
GGTTTTCCCAAGTACAGTGCCTGCATAATAAACCACTCACCATGATCGACTGGTCGCAGC
CTTCAAACCGCCCAGAGGTTGTATGGTACGCCATGTTTCGCTGGTTTCGATCGCCGCCAT
TGAAAAACCTTTCGTCCGAGTCCAGTAGAATATGGTAACTGTGATGCAATGATATTTTTA
CACGGGGCAAGGTCCTTATGTAAATTAAGTTAAACTGTTTTACTTTAATAGCTATTATAT
TCGGTAAGAAATCATGTTTATGTTAATTTTTGAGTGGATAAATATTCATGTTTATCCCCG
TGAATAGGAAAACCAAGGGGGTTAACACACGGGTAATCGTCAGATCACCTCGCGCCCACC
GTCGGGTTACCGGAGCTATTGCAATGTGTTGTGAATGATTTACACATTCCCTTAATTTAG
TAGAACCCATTAATCCGCTGAAGCGAGTTTACTAATTTAGCTTGATGCACACCGATATAC
ACATCTTAAAATATAAGTGTGTTCTTCAAACCAAAGTGTCAGGTCTATATCTTACTATTT
TTCATTTTACCCCAACTATAAATATAATATCTTCAACTAGTCGGCGATGTCTACAAAGCC
AAACGAACCTTCCATCTTTTCGCACCGGAATCCGGTAGTTGTTGTAACTGTTGGTTGGAT
GAAAGTTGAATATAAACACGAGCCCAGATCGTTCGAACGCCAGCACCTTGTCGCTTTCGT
GCACACGAGTCACTTTAGCCTGTATAGAGAGGGGAGTTGTATTTACTTCTATATTTGAAA
CGGTATTAGTAGAAATATTACGATGTTTCGTTATCATTACAAAACAACAAATTATTATGT
CGAACGATTCCTTCTATAGTTCTTGTTTAGAATTATGGCAAAACCAGATCTACCCACATG
CTTATACGAGTGGCTGATTTATGTTTGTTAAATTATAATGAATGTACGCTCGGATGCAGC
ATTACTCAAATCCAAATTGATTTTATTACCGGGCTAAGATTCGAACCCATGATAGGCTCT
TCTCCAAGACCGATTTATATGGTTGGTATATATATCAGTCGAGTTAACCATTCAGCCACA
CGACCTTGCAAGTCCACATCGTATTGAATAGGAACCTGCCTAATCTGTGGTAACTTCGGT
TTCTCTCATCAATGTGCAAATATCACAACTTACCTCATTCGACTTTAACCATCCAAACTT
CTCTTCCAACTTATTAAGGGCGATGTCGAACCTGTTGAGATACTTGTATCGGAGCTGTTC
GTCGTCTGCGAGTTGGAATCTCCGACGAGCAAACTTGAAGTTGTCCCCGTTGGTTGGCGC
TGGTAATTCTACCCAATCAGGATGACCGAATTCGTTTCCTGATTTCGGATTGGTTAATTC
AAACACACAACGTGAATGTTCAATCGTGTATTAATTGCTCGCGATGCGCGTTACATAGAA
GATAAAAGAAACTAAATCTTTTGTCGACATGTATGACAACAAATTAAAAAAACTGGTAAA
AAATCGTTTTAGATCTTGCCAAGAAAGGTCATAACAATGCACACGAAGCCCAATATTCTT
GGCGCTTTATTACCTATGAAGTTTACGATGCCGCGGCCGCTAAATACATGGGTGAGGAGC
CGAACCATCTTGTAAAGACTCAACCCTCGCTCCAACTCTATGGGCGTTTCGGAGCTTCCC
AGCATAGGGAGTTCCCCGATAAGTTTGCGACTCAAAGTTATCCGGTCGACTCCATTCTGC
GAATGTTGGAGGAAAAATGAGTCGTTTAGTTTAGATCACCACAAAGTCTAGTTGTCAGAG
TTGTTAATGTGTGCAGTATTTTACCATTTGGAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1162, 3109..3518, 3542..3769, 4409..4553, 5035..5156, 5721..5903, 6362..6522, 6841..6959, 7353..7574, 9249..9352
1066..1162, 3109..3518, 3542..3769, 4409..4553, 5035..5156, 5721..5903, 6362..6522, 6841..6959, 7353..7574, 9249..9352
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved