Ciona_savignyi Locus ENSCSAVG00000000666
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000000666
Ciona_savignyi
ENSCSAVG00000000666
reftig_247
snoZ195, snoZ195
3129..3214, 4987..5064
6497
ATCACCACCATTGTTACTCAGCATAACGCCAAGACTAAAAACCATTCTTACCTAGAAAT
ATAAAACGCGGGAAACGGAAGACGAAAACGAAAAGTTAAAACCTTATACTTGGTGCAAAA
GTTCGACCCGGCCGACATAGAGAGATCAGTTGAATTGCGCAGCATCAAAATCTCGCCTTG
ATGTACGTTCGTGTGGCCGATTGGTTAACGCGACCGATACGTATATTCAAATGTATGCAA
AAACGAATTTTGTGATAACCATATATACCATGGGTTCAAAACTTAGTACGATACAAATTC
TTTGCTTTTATCGATTTTTTTCGGCCAATCCATTATTGACCGTATATCCTACTGCATATG
TAGCCTACTATTAAAGGCTTATATAATAGATATGGACTCTCCACGTTCAATTCCAGAATA
GCAAATAAAACACGTGTGTAGACGAGTACACTAAACACCCAGCACTGCCAAGTTACTGGA
GCTCTTGTAATGTATTGCATATAGATAATGAATCTAGCGAGATTACTTATAGGATAGGAT
ATCCATGTTTATCCCCGTGAATGGGAAAATCAAGAGGGTTATCACACGGGCAATCGTCAG
ATCACCTCGCGCCCACCGTCGGTTTTAACCCGCTGGATTCGGGCAACGTCCGTTAACAGT
TACACATTCCGGAATCCTTACCAAGGTTTAAATATTAGCATTCTGCCCAATCGTGTGTTT
GGTCTAGCCACCCACTGGACTTATCTTGTGGTTAAACACGCTAACTGCCATCTAACCAGC
GGCTGGTTACGATTTCACATGAAATCTGCCGATGCTCTTTTTTTAAGCTAATCAGATAAA
CAATAAAATAGGTAATTTTTTTATGTAATCATAACTTGTTGAACACATTGAATTAAATTA
ATATTTTTCAAATGCCCCCGGTTAATTCCTAATTATTACGTCAATAAAAATTTAGCCCGA
ATTTTGATTGGTTGTAATTCTATGGTGCTGTGACGTAAGAGCGGCTATGCGTGGTCTCTG
TCTTTTTCCAGCGCAATGGCTGACGGATTCCTGCAGGTTCGTTTTGGGTGTTATTTCTTC
GTTTTATGACATTTTATCCAAAATATAAACCCAGTTTATACTTGGGATAGTTCTGTGTTT
AAAAAGGAAAAGTTTTAGGTAGTTTTAAAGGCGAAAATAAAACTAAAAGCTTTATTTCTC
GTTTTTTTGGTTAAAAAGTGTAAATGGCTACAATTGGCCTTACATGTTTATTTCATTATC
TTGCCAATGATGTTTTCCTACATTGACTGGTGCTTAATGCACTGATATCTATTTAAACAC
GCTGAGGCAAGTTTAATTTTTTTTATCTCGCATATAATATGGGCTATTAATCTTGCTGCA
CTGAATTAGTTACGTTTGATTACCCATGTTTTACACATCCGCAGATATTAATATAAACAA
GTGTTTTATCCACTTTCCTAAATTAGTTTCTCCCAAAGGAGCAAATTTACTTTTAACAAT
TCTTTAACCGGCAATGAAACTTCGTTGTGAGAAATTTGGTGAATTAAAATAAAACAAAAT
AAAAATTGTATTGTAATTGTGTATACATAATACATCCACATTTATAATTGATGACAGAAG
TCAAAAAGGCGTGTGTCAGGACAGGAACTACGAAATGTAAACCAACATTTTTGTATCACT
GCCATAATTAATATACATGCGTCTAGAGACAGAACGGTAGTCTGATTTTTCTCTGCTGGA
TGGCGCTATTTATCAGCTGTACTAAAGCGGGGAGGAGGAAAACTACTCACTAAAATTACG
GACACTAATTTTAACCCATTCCTAAACACTAAACTTAACCGCAAGACTAACACTAACTCT
AGCCCCATGTTTATTACACCATTTACGCATTTTAAGTAAATAGTGTTTACAATCAAACCA
ATGCTTGGACAAATTCCAAAAATGCTCAGACAAGCTGAATGCGGCGTTATGATGAGTTTG
TTTATAACTAAGAAACAAAAGAGTTTAAAAAGCCTAAAAAAACCTCCCCGTCGGGGAATC
GAACCACAGTCTCGCGCGTTACAGGCGGCGACACTTACCACTATACTAACAAGGAATACG
ATTAGGAAGTGCGAAAACTAGTATAAGAATCAGTCGCGGGTGCCTCTAAATACTACAGGA
CCGTTTGGATCACTTAGATTGCTATGGAAAGTAATTCTAATTCTGTCCCAAACATTAATC
TCAACCCCAGAACTAACTTTAACCCCACACCCTAACATTAATATCAAAAATAGTCACTCC
CCAGATAATTCCAAAAAAATAAACTAGCGCCACCCAAGCAGAGAATAAATTTCACACTAT
GTCCGTTCGGTCCCTAGTCGCATCTAATTAATATTCATATACGGCAAAAGGGAATATTAA
GAAAAATTTGTTAGTGTGCTTAAAAAATTTGTTAGGATCAGAAATATATGATTTCTATGT
TTTGCAGGTGCGGGTTATAGACGCGAAGAATCACCTTCTCGGTCGATTGGCGGCATGTGT
CGCTAAGAACTTGCTCAATGGTGAGTATTCAAAACATTGTGTTACTCATTATACACTACC
ATTGCCGGTGATGACTTCCATATACCCAAATTTTCGAGTTTCATGTGTGAAATTCTGAGA
TCAAACATGCACTACCATCTGAGGCACAATAAACCAGGATATGCAAGCCAAATAACATGA
TGTATTCTCAAAATATGTCATTCTTGTATTTGAGGAGTAAAATAGTAAATGTGGCTTGCT
TATTGTAGTGGTGTAGTTTATGTACTCTCAAACCCACCTAAAACCCCCCATATCCACACT
CACAGGCCAAAAGGTTGTTGTCGTAAGATGTGAAAGCATCATAATCTCCGGCAACTTCTA
CCGGAACAAACTGAAGTATTTGGAATTCCTCCGCAAGCGCATCCGAACCAACCCCAAGCG
TGGACCGTTCCACTTCAGGTAAATCCATGTTGCCTCCGTAGGTATTTTGTCCGGATATTG
ACAGATAATTATTAGTGTTATCACCTGTTTGTGTGGGGTATGGCTGTCTTGCTTTCTTGA
CATCAAAGTATCAAGTATGATTAGACCATTACTGACAAACCCAATCTATTAGCGCTAACC
GTGATACTTTGTGTCGGTGATGATGATTCAACCACAAACTATCGAATCCTCTACGGAGGT
CATGTGACCAACCATGCACTACCATCTGAGACACATTGTATCAAACCGTTATTAAATATG
TAACAGACTGTTTTGCTGAATAAGTTTTTTTTTATATAATAAAGCATAGGTTTTACAAAC
ATTGGCCATGTTCAAGCTTTTTATCTTTAGTGCCAAATGTCCAGATTACAATATTTACGG
TAATAACACACAAGAAAGATGCACCGACATGACCCCCATGTTTCAACTATATATCCTGAT
TAAACCTCACAATATTGCACCTCAGAGCCCCATCCAAGATATTGTGGCGCACGGTGCGTG
GTATGTTGCCGCACAAACTCAAGCGAGGCGCTGATGCTCTCGATCGTCTGAAGGTGTTCG
AAGGTGTCCCCCCACCATATGATAAGGTATCGGACCTATTGAGTAATGAAGTTTGAATAT
GTAGATCGAGTTTATGGTAATAAGAGCGCTACATGGCCAAGGGTGCAGGGTTAGTTTTAA
CCTTGCTTCTGCTGTGTAGTTAACCTGGTTATGGTTACACTTGGCCTGATATAACAATAT
CTTCACATTATCTTGCCAATGATGTTTTCCTACATTGACTGATGCTTAATGCAATGATAT
CAATTTAAACACGCTGAGGCAAGTTTAATTCTAGGAAACTTCATAAACTCAGTTTAAAGT
AACCTTAATTTCTAGTTTAGTTTATTTTATTCCTTTTTTGCCCAGTATTAAAAAATGGCA
AATGAATCAAATTACGACACGGGAACAGGAGAAGACGTCAAAACGAACAGTCGTTGAAAC
ACGTCATTAAAAAACGGATATCGTTTAATAAATATTCTAGGACTCCACTAGCTTACTAAC
AATTGACAAATAAATAAAAAGCTAGAATATTTCTTCAAGAATATAACTATCTATCATGAT
TATTAGTGTTATAATAATATAACTTTTTCTTTTAAGGAAAATATTTCAAATAGGTTGTTT
TTACATAACATTTGAGAAAAAAAAATATTTATCCGACAGAAAAAAAGGTTTGTCGTTCCC
TCGTGCATGAAAGTTGTCAAGTTGAAGCCGAAACGAAGATTTGCTGTTCTTTCCCGACTC
TCCAGTGAGGTTGGGTGGAAGTACAACGATGTCATCGCAGCTTTGGAAGAGAAGAGGAAG
GCAAAGTCCAAGTTGTACTGGGACAAAAAGCAGGCCAACTTGGTATGTACAACTGTTGAC
TTTGTTCTATCCGACAGATTAGTCTGTTAGGTTTGTGTGTCGCCTATCATCCGAAGTGTG
GCAGATTAGCTACTTGGTTGTTTTCTTGTGCAAGACACTTAATGGACATTGTCAGAACCT
AAGGGATAATGGGTTCTACAAAATTTAAGAAACATGTAAATCATACGCAACATACTGCAA
TAGCTCAGGTAAGCTGACGATGGGTGCGAGGTGATCTGACGATTGTCCCGTGTTTTAACC
CCCCTGGTTTTCCCAATCATGGGGTTATATCATAGTAAAATTAAGAATAATTCGCAAGGT
CGTAGTCCAAATGCATAAGATAAACGAGAGTTAGCGGCAACATTAAACTTAAGGGAAACT
GCTCACTAAAACTATGGGAACTAATTTAACCCTAACTTCAACCCATGTCTAAAACTAACT
TTAATGTCCTAATCTTCAATTTAGTGTGCAGTTTCCCTCTTTATCTTTTCTTAGTTTTCC
CCAAGGGTTTACTCTCTCCCATCTTTAAATGCTGCGTACCTCATGCAAGCCTCTATGCAA
AAAAACTTTAGAATTAAAGGTTATTTGGATGACCAGTCTATTTAGTTCAAAGTCAGCTGT
AGGTTGATTTGCCAGTGATGACATGTTTACTCAAAACTTTCGAACTTGAAATGAGATAAT
AACATGCACTACCAACTGAGGCAACATAGTCATAACCTTGTGTGGGGCCATCATTCAACT
AATTGACAAGGGACTTTACTAAACTGCTGGAAAGCTGGGCGGGACAGTTGGAAGAGGGGA
GCAGGGTATTTTTGTCACTGACATAAGCGGGACGGGGTGTTTCATTTTAACCCGCTGTCG
CTTATGTTAGTGACAAAATACTTTGTCACACTTGTGGTATGATATAGTGTCCCGCAGATT
AATTAAGCCCTTGACAAGTTTAGTTGTCAAGGCCATTCTTTATCTTTCTTGATATATTAC
CGTTCTAAACTGGAGTTGTTTTCTTCCAGAAAGTGCGCAAACAAGCGATCACGAATGTCC
AGGACAAGATTGCTGACTTGGACAAACAGATACAGGACATGGGATGCTATGCTGTATGAT
TTGTCGAAATAAAATAACAACTGAATCCTTTCTTTCAACTTTATTGACTGTGTTGCTTAT
GGTGTCTGCAAAGAGATAGGGAATACTAGTTGTTTATTAGAGCGATTTGAATTGGTTAGG
CAAACTGTTAGGGATCAGTTTTATTGTTATGCGAGGCATTTAGAGGGATTGATTAAACCC
AACGGATTGTTAGCTTGTACATAAAATATAAGGTTGAATCCATAGTGCAGAAGGCAAACT
GTTAACTTTATATTAGCATGAGTAGTTGCATTTTATTATTCACAACCTAGCAATAAAATA
AATGAACGTATGCATCGAGAGTATTAAACCAGTTAAATTATTCTCCGAGATTGGAGGTGC
ATTCTTTAACCGTGCAGGTGTCGTATTCAGAGGTTATTTTTCGGTTTCTAACCGATCTTG
CTTGTTCCACTTGCATAACAATTAATATAAGGTTAATCACTTTGGTTTAATATAAGGTTA
ATAACTTTGGTTTAACATAGTCCGACAGATTAGTCTGTTAGGTTTGTGCGTCGTCTTTCA
GCTGAAGTGTGGCAGATTAGCTAGTCTGTTGTGTCCTTGTGAAAGACACTTAATGGACAT
TATCAGAACCTAGAGGAATAATGGGTTCTACTATTGAAGAAACGTGTAAATAATACTCAA
CATACTGCAATAGCTCAGGTAACTTGACGGTGGGCGCGAGGTGATGACGTTTTAGATTTT
TTCCTGGTTTTCCCAATCAATCCCCATTCAAACCTATCATATTAAAATTAAGAAGAATTC
GTAAGGTCGTAGTCCAAATGTATAAAATGAATGATGACACTTGCAGAAAGTTTTATCAGT
GCACACATATCAAAATCTATTGATACAAAATCGTACTTTATTTCGTTGAGAGCAGTAATT
AATAATTAAATAAATTAGTGAACTGTCATTATTAAAAAGCTATTAGTTTAATTTACAAAA
TACATTTAATTTTAGGTAATTATTTTGGTTAATAACATCATATCGTGCCTTTAAGAAAAT
AGTTGGTCAACACTACTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1055, 2467..2539, 2825..2952, 3440..3565, 4179..4361, 5369..5497
1035..1055, 2467..2539, 2825..2952, 3440..3565, 4179..4361, 5369..5455
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved