Ciona_savignyi Locus ENSCSAVG00000003294
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000003294
Ciona_savignyi
ENSCSAVG00000003294
reftig_132
SNORD83
1286..1361
11327
ATAAAGTATTCATACTGTCTGAGCTGGTAAAATAATTACATCACATTCTCAACTTAATT
ATGTTTTTGTTTAACCTGATAATGTTACTAGTTTAATTTATCCAGCTGACTGAAAAACAA
GAAAACAATTCACTGAGTTTTTCTGGGCCTATGGGAGACGCCCCTAACAAGAGACCTTTA
GAAGATGGTGGTAAGTAGATATCAAACTACTTCTGCTAGTAAAAAAGCATTACCACTATT
TTTAAATATAAATTCTCTTGTGGTCAGTGCTGGGAAAAATGCAGAGCAGCGTTTTTGTCT
GCATCGTTAAAAAATATGTCTTTATGTCCCAATTTTTATTTCAGTTGTGAAATTTCGATA
AATGTGAGCATTGCTATTGTATTTTCCCATCACTGCCTGTGGCATTTGTAGTTTTGAGTG
AAGCACTGATACTGCATAGTACAGGATATGCGCCACGCAATCAGGAAGTTCCTATTTCAT
AAAAGGCGCTCCCATTACTGTTCTTACTAAACCTAAGCTGCGTATTAGTGGAGCACACCA
TCTGCTTGCCACTATAGTTGGAAATAGCTTTAAAATTAACTCTCTCTAAAAATATATCAT
CAGTGTTCAGTTTAAGTTTATTACTAAACCAAGTGCATGTCTTAATATAATAAAGTTTAT
ATAATTTTAGAAGAACCTGGACCAAAGAAACTAGCTACTCCTCAAACATTTGCTGCAAAT
AGTAAGTTCTAGATCTATTAGGCTGCTGAGTTGATTGTATTACAGTTTTAATGTTTGTAT
TGTTGCTTAGGTGAATTCGCGGAATCTAATAAACTTGGAATGCAAGAAAACCCGTAAGTT
TGTTATGCCTTTTTTAATTTTCATGTTAATTTTAGCTATGATGAAAACAATTTCAGTGCT
GAAATTATATGATAGTATTTGTATTCATACCCTGAGCTTTATCTTTTGCAATGTATAATT
AACTCTTTAGTATTACAAATCACTATAGTAAGTTTTTTGGCAGGGATATTATGTCCGAGA
CAATCAGATTACCAGATGACCTTGTTGGGCTGAGTAAGTTGCTGTTTGTGTGATTAAATA
CATGCATTTGGCAGTTGTTTAATTGATTTGTTGCTTAGTTATTGGCAGAGGTGGTGAGAA
CATCATGAGAATGCAACGCGAAACTGGTTGCAGAATTCAGATCACGCAAAGTATACCGGG
CACTAAAGAACGACCATGCACATTATCGGGCACCCCAGAACAAATTGAGTACGTTCATTT
TCTGTAGTAAAAACATGTCCTTTTAAGCCACATGATGCTTTTTAGATACCATAGCATTAC
TGCATTGATGACCTTTTATCTATCACCCATTAACTGATGGCGTATTAAACTCACCCTCTT
GTTTTCTATGAAATAAACCGAGCAATGATAACAAAGCGCTTCCGTTACAGAGTGTGCAGG
AACATGTTAAACGAGATCATCTCGCGATCCCAAGCGGGAACACTGGGCAATAACTTCAAC
CTTGGAGGACAAGGGGGAATGAGTGGAAGTGGCATGGATGGTGGAATGGGGGGAGGTATG
GGAGGGGGCAACATGGGGGGAATGGGTGATGGAGTCGAGAAATCAATCGAGATTGCCGTT
CCTCCTGACAAGTGTGGGCTCATTATCGGCAAAGGTGGCGAAACTATCAAAATGGTGAGT
ACCGACTTTTCGTATGGTGCCACAATTTTAAAACTTTCCATCTTTCCCACAGTTGCAGCA
GAGCTTAGGCGTGAAGATGCTTCTCATCCAGGATTCAACCGATAACATCGGCCAGAGCAA
ACCTCTCAGAATAACAGGGGCACAGATGAATCTAGATGTAAGTAAAACTACATTGCAAAA
AACGCTGTTTTTTTGCACTTCCTTATTTTCAATTTTTCCATGTTTTCACTTTTTTCCATG
CTTCCGTATTTTAGTTTCTTTTAGATCTGGGCGAAATTACAAAATTATGCCTCTAAAGTG
AAGTTTAAAGGTTAATTCTCTCTGTCTATCATCAAAATACATCCAAAAATGCAATAATTT
TTGGGTGTTGTTTAAATCATGATAACGTCATAAAAATTACGGAATTACGAGCTGCCGTAA
TTCCGTAATACAACTTGATCAATTACGCCCAGTTGTAGTTACTTTCTTAGTTTCCATGTT
TTGGTTTGTTTCTATGCTCACATATTTTTGTTTCGTGTGCGTACTACAGAATGCTGTGAA
TGCGGTTCACCAACTAATGGCGAACAGAGACCAGCAATTGGCCCAGCAGAAAGTGGACAG
AGATGGAAGTGGAATGGATGTAAGTTCTCAGAAATTCTGTGTTTTAATTCGGTTATAGCG
AAACCTGCATCATTCAGCAAGTTTTGTGCAGGTTTCAAAATAATAGCAATGATGTATTCC
TGTGGTTAAGATGGTCTTTCCAACCTATGAAGACAACTTATTAAACCGACTGAGCTTAAT
TAAACCCCTATGCTAATCATCCCGGCCAGTAATTTTTCCATCCTTTCTAAGCATTGATAT
TCCCACAGCCCAACATGTTTGGAGATGACGTGAACAAGACCATCATTCCGGTCCCCAAAG
CAGCTGTTGGCGTTGTTATTGGGAAAGGTGGTGACATGATCAATCAGATTCAAAATGTCA
CCGGAACCAGAATCCAATTTAAACCAGGCAAGTAAATAAAATAGTAAATAAATCTTAAAT
TAGGTTTAGTATTACCGTTCACAGGTTCTAAAAAAAGTTTGTGCTTAAGTCCTTGTTGTT
AAGCACTACTTACAAAAACAATAGTTCTATCTATTATTGAATCCGACTGATTAGTCTGTT
GGGTTTGTGCGTCCCTCAACCAAACCAAATGGTTGCAGATTCAAACTGGTCACTAGCTAG
TCAGTTGTGTCCTCACGGACATTAGCTGAACCCAGTGGATTAATGGGTTCTTGAAGGAAC
TTCAACACACTGCAATAGCTGTGGTAACCCGATGGTGGGCGCGAGGTGATATGACAATTG
CCCATGTGTTATTAACCCTTGGTTTTTCCCATACACAAGGATAAAACTTAATATCCTATC
CTATTTATTGTTTGCAACCAGCCACATGATGCTTAGCATAACATAGCTCACGCTTTGATG
ACTCAAAGTCTATCACCCATATAACTGATGGCAAGTTGTAATTTTCAGCTTCATGTGATC
ATGTCATTAATTCCTTGCAATTTTCATTTCCCAATCCATTGATTTCCTACAGAGGATCCT
GGCTTACCTGAGCGAATGTGTAGCATCATGGGACAGAAGGAAGGAGTGGATGCGGCTATT
AGAAGAATACACGAGATAATACAGAACGTGCAAGAGCGTGATGGTATGTCCTGTTCATAC
GTTAAATATAAACAATTCAAAATAATGTGATGAAATTGTAACCTGCCAGTTCTGCTTCTG
AATACCTTGATGTAAAAAGTTACAACATATCTGATATTTTTTCGCTAATTCACCATTATA
GACTAAGTTGCAATGAATATCGAGTAATTCTCCCACTTCCAGGCAACCGTAGCGGGGGTG
GTGGTGGTGGTGGCCCTCCAGGGGGCATGGGGAGTTTCGGACAATGGGAAGGCCCCAACA
TGGGCCGCGGCAACCGTGGGATGGGTGTGAGCTCTGAAGAACACTTAGTGCCTGCCAATA
AGACCGGACTTGTCATTGGAAAAGGTGAGGTTGATAAATTAGTTTTGAAAAACCAATATT
GAAAGCAACAAAAGAGAAATTGTGATACATTATTAAACTCTAATACAGATTTATGCATGG
TGCTTATTTTTGTATTTAAACTACAATTTATTTTTGAACCTTTTATAAATTATTTTGTTA
AATTGGTTCCTTATGTTAAAATTTATGTTTCCCATTGCACTACAATACAATATGATGAAA
TTGTAACTTGCCAGTTCTGCTTCTGACAAACATTGATGATACAAGTTACACTACTTCTGA
TCTTCCTCCAATCACACTATGACCAGTATTAACTCTCTCACATAAATAACCTCATCACCA
CCATACAATACCCACAGGCGGTGACACGATAAAGCAGATCAACATGCAATCGGGCGCTCA
CGCTGAGATTCAAAGGAATCCTCCGCCTGGTTCCGACCTCAACTACAAAACCTTCATCAT
CAAAGGTGAGTAGTGTAAAACCAACCTAGAATTGTTAGTTGCCGTCAAACCGTAATGCTG
GCAATACTGCTAGCTAAATAGATTTTTGAATAATAAGTAGCCTTGTTAAGACACTAACTT
AAGGATATTTTATATTTTTTGGGGGAAAGTTTCGTTTTATTTTGTATTATAAAAATGTAT
TATTTTTAAATGAAAAATTTTCCAGTGAAGTTTCCAGGAGTTTTGCAGCTCTAATTATGC
ATTTGTATAATGGCGACTTTTGACCTGCATATTTAAATACGCGTTCACTAACGAGCTTCT
TGTTACTAAGGAACTCCGGAGCAGATAAAAATGTGTCGACAGCTGATACAAGAGAAGGTG
GACGCTGGACCTGGTGGTCAGAATAATGGTCAGATGCAAAGTAGTCACATGGGTGGTCAA
CCCCCGATGGGCAACTTTGGACCACCTCAAGTATGTTGTAGAAATATGTAGTAGCAATAT
ATACCACAAGTATGTAGTAGCATTATGTAGCACTGTATGGGACTTAGAGAAAGTGTACTC
TCTTTAACCACATTTTTGTAACATTTCGATAGAGTTTATAATCTTTTTTAGCGTTATTTA
TAACATTTCTAAAAAGTTACCTTATTTACGATTTTTTGTAACATTTCTAAAGAGTTAAAA
TCTTTTCTTTCTCTACATTTTCTTTACTGCTTGGAATATTAATTTTTGGTGAAAGTTGAT
TAAATCTTTGTTTTTTCCAGCAACAAGGTGGATATGGTGGTCTTCCACCAGCTGCAAGTT
ACGGCCACCCCAACCCACTGCAAGGCCCTCCTCAGGCCCCACAAGCGCCCCAGTCGTACC
AGCAACCGTGGGGGAGTCAGTTCCAACAGTGGAGTTCACCCAGTGTCTCAGCCCCACAGC
AAAACGGTGCAGATCCAAGTAAGTTGATTCACCCAAAACAACTCTTTCTTGCTGTGCAAT
GATGCTACCCTGTGGTTAAGATGGTCGATATCAGGCCGATGAAGACAACTCTTACCTACT
CTGAGCCAATATAATTAACCCTCTAACATATAAGCTTTATCACAAAAAACTCGAAATTAA
TATCGATTTTTCTTCCAGCGAAACCAGTGGCAGATTCGAGCAATGCAGCAGCATGGCAGT
CTTACCTTCAGATGTATGGAGCCCAAGCACAAGCTGCATACCAGCAGCCAACTGCTGCAG
CTGCAGGTAAAGCACATTCATCACTTTAACTCAATCTGTGATCATAGCAGCCAGCCATTA
TTGTGGGGGGAAACTAAAAGAAGGGAAAGCAGGAAGGAGGGAAACTGCACACTAAAAAAA
GCAAAATGACATAAAGTTAGTTTTAAACATAGGGGTTGGAGTTAGGGTTAGTTCTGTGGT
TGAGATTAGTGTTTAGGGCAGGGTTTAAATTAGTTTTCATAGTTATAGTGAGCAATTTCC
CTCATTTTCTCTTTCCTGTCTTCCCTCTTAGTGTTGCCCAGTATTGTGGCCTTAAAGAAA
TAAAACTCAAAGAAATCTGGTCGTATTAGGAAAATTTCTATAACTGAAGTGAATGACTTG
ATGGTGCATATTGTCCTCCGTTCCATGCATACAATGATGATATTGTAACTTGCCAGTTCT
GCTTCTGATTTGAAGTGATGATAAACATTACAACCATTCTGAGAATATCAACTACACATT
TATCAAATTCTTTCTACTTAATTTGTATTTAACACCAATAAACCCCCACATTCCAGTTTC
TGCTGCCCCAGCCAGTCAACCAGACTACTCCAAACAATGGGATGAATACCTGAAGCAAAA
TGGTGAGTTGATTTTGTTGCGAATTAAGTAATTTTCAATGTCAGTATTTTTAATTTATCA
ACCCTCTAAAAACTCGCGTCTGTTATCTAACGTTTAAAGCCTCATTTGTTGGTAGAGAAA
GCTTTTGGGCATTCTTAACATAAACTAAGTACATATAGAACGCTGTTTAATTTAAATGAA
TTTGAATCTAATAAACTACCTTGTTAACATTCTGGAAACTCCTGGAAGATCAGTATAAGT
TTTATTACTTTAATCGAAAACGTAATGGTAGTTAAAACATATTCAGAGGTACAACGCTCA
CGCAACTCAACATACATGTTATATAAACACAAACGCGTCAAATATATGCAACACTTCATA
ATCCCAGGTCTCACGGCTGCAGCAGTTGCTGAGCGTCAACAGCTCGCACTGGCTTCCCCT
GCCGCGGCTGCTGCCATCCAACAACAGGTTGCGGCTCCAGCCGCCGCGGCTGCTGCACCA
ACTGCTGCCGCCGCCGCAGTTGCCCAACCCGCCACCACCCAGGTAATGTGGGGTATTTCA
AACTGATGTTTGATGGTAATCACTATATTTTTCAAACTTAATCCATATTTTGTTAAATTG
TTTGCTCGTTGTTACCAGATAAAACTACCGTTAAATTTGTAATAAAACATGTAACTACAT
TGCCTTATGATGAAACTGCCATACAATATGATGAAATAGTAACTTGCCAGTTCTGCTTCT
GACCAAAATTGATGCTACAAGTTACACTACTTCTGATCTTACCAAAATCACACCACTCGT
TAATCAAGAAGTCCCAAACGTTCCAAACCCCCATCATAACCCCCCAGGAGTAATGGGCCT
CCTATGGCCTTAATTCCTGGTCCCAGTGCTACCGTGGACCCGCCCATACTAATGTAATGT
AATAACCCCACAGGCGGACTACTCTGCAGCATGGGCTGAATACTACCGACAATACTACGC
CATGCACGGCCAAGCTGGATATGCGGCCGCAGCAGCTGCAGCTGGACAGGCACCTGCACC
AACGTAAAGCGCTTCCTACACAAACACATTGTATATAAAGGTAAGCCAATGTTCGGTTGT
ACGAAAGTAATACCTTTTTCATCTTTGGGGTAATACAAGTGCTGTAATTATGTTGTGCTT
AACTTAGTTCTTGTGTACAATTTGTGTACGACAACATATTTTCGTATTGCGTTCGTTATA
TTTCTTGTTTTGTCAATTGTGATTTCTGCGGACATAAATTGTGTTTTAACTGAATAAATC
ACAGCACATTTAACTGAACTTATTATATGTGGTTTAATTTAACATTTAGAAAGGTGTACT
TGCATACAAAGTCTTAATTATACGTTTTAATTTAACCAGTTAAATATGTTCCTTTAATTT
AATTAATAATTGTACACCATGAATTTGTTTCCACGCCTTGTATATTCATGTATATTTTAA
AAACTGGTTGATTTGCGTAATATTAACTTGTTGTACCATTCATTGCATAGCTCATAAAAT
TGTTTTGGTTATTGGTAACACTGTTGTCTTTCATTGATGCAAATTGTTGATTGTGTTCAT
GTCTCGCATTTGTGTGTTGATGCCGTTTTCTAACTTGTTGTTTTTGTGTGTCCAGATGCA
GGCCCAGAAGAACCCTCCTGTACATATTCTCTCCTTTTGAACATAGCTACTTCTTCCTCA
GTACGATGCTTTAAACATGAGCATCCCTTATAAACCCCCAGTGGAGTGCCAATCCATTAG
CTTTGCACTTTGGTGCCAAATCATAGCAAACCCTAGGCGGTCCACACAAGCGCAGCTCAG
ATGAGCGTCAGTGCCACATATTAATGTTGGCCACACTTGCCAAAGACAATTGACATTAAT
TTGCATGCTTTGCGCAAAATATGCATTTTTGAAGCGCCACATCTTTGCCCACGGTCCAGC
CCAAACCGTGGGTAAGATTTAAGTGGTGACTTGCGACCACTCGCAAAAATTTGCGAAGCG
ACTTGTTAAAACCCCTAGGTTTGCCCGTCATAGCAATATAACCAGTTATCTTGCCTTAAC
CATTTTCCCACCCCAATGTGTTTGATTGTAGCAAGCAGGAATCTCATTTTGGTATTTGTA
TTTGTTCGGTTTTGCGGATTGTGTGTCGAGTGTTATGTGTTGTCCTTCTAATACGAGAGT
ATTCCTACCCGTTGGTGCAAAATAGATAACGTGCGTCGCCTCACCCCGAAAACCACTGTC
ATTCGATTATCGTTACAGCGGCCGTAGTTCACATTTTAAACTTGTCATAGCGCTAATTTG
TTCAAATCGACCAATTAAACTATTTATTTCATGCTCCCTGTTATTTTTTAGTAACGTCAT
TTCAGTTTTCCGTGTTTCATTGCAATCCTACCCCCAATGCTTTTTCCGCACGTTTTTAGC
GATAAATTTGAATGCACTTCAAACAATAGTTTTGTGAAGCGTTTCTTGTCGAAAATATCC
GAAGGTGTGAGAATTGTTTCGTGACGCGCTGCTGTGTAACTTAAATCGTTTGCTGTGTGT
ATTTTATCATGTTAAACCCAATGTTACTTGCCTAATTTTGAACAATACTAAGAGCGACGA
CGTACCATTGTAAAAATTCATTCCGTGTATATAGATATACATATATCTACTGTATGCTTA
CCACTACAAGTTTTTAAAAAGTATTTATTTTCAGTAAATGATTTGCCGATTAACTTTCTT
GCTCAACAACTCTTATTTGTGTGTGCCTTGTGTGTCTCCTGTATTAGACCCGATGAAACC
ACCAACTCAGCTTGGATAATGGTGCCCCTATATGGGGATTCCCCCTATACGGGGATTGTA
TATATTTATATGTGGTGAACTGTCATTCCATAATCTCTCGGCAGGTATATAGCGCCGCTT
TAATTTAAAATGCTCTGGTAAGTTATTCAAACCATGTAAATCGCATGTCGGTGTGGCAGT
TTAAACCGGTAAACCAGATGCTGATTTTAAAAACCTGAAGAAACCTCCCAAAGTTTCCCT
GTGACCTTTGCTGGCAGTCCTAGTGCTTCTGTATTTTCGCGTATGTTTTCAAAGTAATGT
TACCGCCTCGCTTTTATTTTGACCCCTTTTTTATAGAGTTAATCTCCTTCACACACCCCC
GTTCGCTATTTTTAAAGTCGATTTTCTGCATTTTCTAATTACATCAAGTTCGCCGTGGTT
TTTAGTGCGTCGTTGTCAATCATCGTAAACTGTGTCAATATGCAAGCGTGTTATCTTTTT
TAAACGTTAACTTATCAAATTTTTCTATTCCGCCATGAATACCTAAGGTCCCCTGTGTAC
GAACTCTAGTTATTATGAACGCCATTTGCATCATTGCGGATTAGTATTTCAGTGGTCTTG
TTATATTGTCAGCAATGTGCCCTGTTATTGTGTTTCGTTAAATTCGAATATGACTTCCCC
TCGCCGCAGTTTTAACACGCATGTCACTGTGACCGCTTCAGAAATTGACTCTTTTTTTTC
CGCTCGATAATGTTGCTACTATTTCGCCCGGTTTTAGCCATTTTTCTTTCCCTGATGAAG
TGCAACTGTCATTTACCCTTCCACCACCGTCACCTAACGTCGCGATATTCTTATGTATGC
TACTGCCAGCATCGGTCACTAACTGCAACTGGTTTGAACCGGTTTAAACTGCCTGCTGAA
TTTACCCTCTACATCAGCTTTTTGTCATTTTAGCGAATACTGTACACCTATGTAACCTGT
GTTTTACAACTAAGAAACACTTAAAATTGCATATTTAGTTAAAGCTTAACTATCTGCTTA
GCGTAATGTAATAATGCATGTTGTGTGAACCCTATGTTAATCCAGAGTGTTTAATATGTA
GCTTACTGCCGTGAATCACAACTGATGGCATATAATGTTAGTGTTAATATTTGTTGGTAC
TTTATACACTGGCTTTTTTTTCTGTATACAAAGTCAATCAAACGCGCGTTTAATTTTGTC
AAAGTTTCTGTTGAAATCTGAAAAAATGCCTGTAACTTGTGTGTTATCCTGTCTCTTCTT
AATTTTGTGGACCTTTCTAGTTACCTTTAAACGGTTTTGTGTTCTTGTACAAATACATCT
GCTACATGCTATTTGTTGAGGGGTCTTTAAATATGTAGGGAAATTTAGGAAGTTTTGAAA
TTGGGTGAGTAGGCAGCTATAGAATGGTAAGTATTGCTGTAATTTCTATTGGCGTCCACT
TAATCCGGTGTTTTTACCTTGCAGGGGGATGGTCTAGCACAAACGCAGTTGGCGTTTTCA
ATCATAATTTCGATCCAAACTAATTTTTCAACCGTGCTGAGAATGTACATTGTTACGAAC
CATTATTACTCATTGTGCCGTGTGCTCTGTCGTTTTCAAGTAGCTCTAAATAAATGCTGT
CATTGAAATGAGTTTTCGTAATATCTTTTATTAAAACTGATTGAGATAAACAATTATAAG
ACACCTTTCATACAATTTGTTACATAGCTGCGTATTATTACATGTGTGTTGTGCATAGGG
GGGTCAATTGCATGGACGTAAAATTACCGAACTGATGATGGCAAATAGTTTTAAATGGCA
GAAGAAGCGATTCACTGGACAATTATCTGCAAAGCATTGATTGTAGAGGTTATTTCCTTA
AGGTTTTAGACTTCATACTTTTGTCAGGTAAAACCCATTTATCCACTTGGTTCAGGTGGT
GTGCTGTGAGTTACCAATGACAACAGCCTAGGTTTGACCACATCCGCCTTGGCTGACAAT
GTGCTGCCAGTGAAGCTAACCAGTGGGAATGGGTAGGAAAGGATATTCATGTTTATCCCC
CGTGAATGGGAAAACCAAGGGGGTTAACACACGGGAAATCGTCAGATCACCTCGCGCCCA
CCGTCGAGTTACCGAAGCTATTGCAGTGTGTTCTGTATGATAGATACGTTCCTTCGATTT
GGTAGAACCCATCAATCCATTAGGTTCAGGCAATGTCCGTAAAGTGCCTTGCCCAAGAAC
ACAATTGACTAGCTAGCGACCAGTTTCGCACCTGCAACCTTTTGGTTGAAAGGCGACGCA
CTAAACCGCCAGACCAAACGGCCGGATGGAATGATTAAACATAAAACCTGGTAATTTAAC
TCACTTGAGCAAGTGCGGATGCAGGATCAGTTATATTCTGTATCACATTAAAGTGGTCGA
GTCCATTCAGAAGTTTGTACGTCACATGTACATTGTTGGATTTCAATTCCTATTTATTTT
CATGGTTAAATAACGAATGAAAAAAAAAAACGTTAATGTTTAACAGTAGCCTAAATTGTC
AGACTACCTCATGCCCACACTTTGTCAGATGATGCACAGTTTTTTATTGCCTAATTTTGT
TTTGGATGCTTTTAATATTTTACTGCATGTGTAGAGCTTTACCAAAAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1052, 1118..1265, 1529..1673, 1732..1836, 2209..2271, 2528..2670, 3439..3683, 4037..4144, 4450..4596, 4887..5057, 5253..5345, 5876..5954, 6439..6466, 6853..6999, 10164..10327
1001..1052, 1118..1265, 1529..1673, 1732..1836, 2209..2271, 2528..2670, 3439..3683, 4037..4144, 4450..4596, 4887..5057, 5253..5345, 5876..5954, 6439..6466, 6853..6948
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved