Ciona_savignyi Locus ENSCSAVG00000004129
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000004129
Ciona_savignyi
ENSCSAVG00000004129
reftig_131
SNORD15
2497..2569
9502
TTGCTTTCATATCCTGCTTTGAAACGCGTGCACAATAAAACGACTTCTGTCAAATATGT
TGAGTTATTCAATGACTACCAATCCTGTATAAACGTTTTAGCACAATTTTTCTTATTTTT
TACTTATTCGTTTGTGGTTTTAATGTTTGCCAGAGATATGCCGGAAAATTCATAATTAAC
AAAAAAATGGTGAAACGTTCTCTAGTTTCAAGTGCTGTCGGTGGCATTAGAGCCCGGCTT
GAAGTAGGAAGTCTTAACTGGTCTCGTTCCGCCATTAATCTCCCCGGATGCACTATTCTC
TATGCAGTGGTGACCCCGACAAGCACATAACAAACGTTTTCTAAATTTACTTGAATTTAT
GGGAAGTTTCAACTAAATAATTAAATACACTGCAATGCCTCGGAGACTTGACTGTGGGTA
CAAGGTAATCCACTGTCTGTCGTTGCCCGGTGTCTGTAATGGTATAATCAGGAGTCCCAT
CCTACTATAAATCGCCCACATCTAACTTGCAGCAAAAGTTTTAAAGATACGAACAAGAGG
TTATGTATAGCTGATAGCTAATTTAAAAGACACGGTCCATTTAAACAGCTGGTAATACAA
CAGACTTCATTGGAATTTCAGTTTTAAGAATACTCAAATCATAACCGCAAAGTGGCCCTA
GAGAGCGTTTTAAGTGACGTCATAAAGTCAAGTGCCCACAAGTTAACACAGATTGTGATG
TCATATACTTCAGTATTAACAACAGCTGCAGTTGTTAGGCTCTACCGGCGTGTGTACCAG
GTATTTAACACAATTTAAAATAACTGAATATAATATAATCGGCCTGTTTACATCGGCGAA
ATGATGTTTGTTTTTCTAAAAGTAGATCTTTAGCGTTTGAATTAAAGTGTCTCGAAGGGA
TTTACACTGTCTGCTAAGGTAGAGTTTGCTCTAAATAAGTAAAAAAAGAGTCTAGGTTTT
AGGTTAGCCTAGTCTGCATATAATTCGGATATTATAAAGAAATGGGCAATTACGTAACTA
GAACATCGTACGAATGGGTGTATACCGACGAACCACATGCCAGCAGAAGAAAAGAAATAT
TAGGTAGGGGTAATTCTAATGTTGATTTATTAAACAGAAAATCGCCGCACATGAGATTAA
GGCGTCCAGGTGTCGGCTGTTTTCTGCTGTGCCAGTAGCTAACCCAACAGTGGCAAATGA
CGGGCATTGCTCACATATACCGTCTTTAGAAAGTTTTAAACATCAGATTATAGGATCGGG
TTTGTGCTATTTGCAGTGTATACTGCTTTATTGACATATTTGGATCGACATTTTATTGAC
CGAGTTTTAATCAATTTTGCTGTCGAAATAAACACAAGAACACAGATTCGGCCTGGTTAT
CCAAAGCGCTTCATTCAAAATTTTATAATAAAGGCAAAGCGTCTCCATATTTAGCTTTCT
TTCAATATGAAGATTAAAAGTGTTTACTGGTGAACTACCTTAGGTGTTAAAAAAGTGTTA
AATAACAACCTAAATTCTGGTTGTAAAATCATGTACAACATACTAGCATAGCTCCGGAAA
CCCTACGGTGGACAGGATCTAACTATTTCTGTGTTGTAAATTTTCCAACTATTTGGAATA
AAAACTTCAACTAGTCTTGCAGACTTTGTATTTACCATACATAGCAAACCGAGTGCTCAT
AAGAAAGGTAAATGATATTCATGGGTATTCCCGTGAATGGTAAAGCGCATTTAGCGTTTT
TTACGCGAAAATCAGATGACACCACAACCATATTTTGTTTTGTTCAGAAAAATACCCGGA
CATGAAGAAGCTTATGAAGGTAAACCCACATTTCAAGTGGGTGGTGGCGGCGGAAATTGC
ATTCCAGATGATTATGTGCTACTTGGTTAAGGATGCCAGTTGGTTATGGGTGTTTGTGAT
CACTTATGTTATCGGAGGTGGGTAGTTTATAGGCAGTATACAATAAGACGCAAATGTGCA
ATGTATGTGATGGTTGTGAAAGGTTAGACCTTAAAATAATAATTGAAATGCTTAAAGATT
TTCTTTCCGTCCGGGGACAATGTTATAAAATCATTAATCTAATCACCTCCTGCCCATAAA
CGCCTTAGAGAAGCTGAAACATTGTGGTGTGAATATTTAGGAGCAATGTCATGTTTTTTT
AACCTATTAATTCACTGATGTTAATTATGTATTGCCAGAGAACAGGACCGGCAAGATATC
GGTTGCTTTTGTTACCATTTCATTCATTTTAGCTGACTGTCCGACACGTTACCATATAAA
TCAACCAAAGCTTCAACACATGGCCAATAATGTTGATAATCATGAGAACTCTACATTTAC
TATCCGTCTAATAAACTTTTCTTGCAATGAAGATGTCCATAAGCATACATACTTATTTTT
ATCAAATAATTTTTAATTTTGGTTTTTTTTAACAACTTACCACAAACTGAAGAATGTTTT
GATATAATGCTACGTCTCCTCCGCAATATTATGACGGGTTCAGTGATGACTGTTGATGAC
GAGTCGTATTAACCATGCCGACTATGTAACGAGGCATTTGTCTGAGAACCGATTTCATAT
ATCGTATTGATCTGCATGTGGAAGTTCCACCTACTTATACATTCTGCTTGTATATTTTCA
GGCACAGTTAACCACAGTCTTACTCTTGCGGTGCATGAGTTGAGTCACAACCGAGCCTTT
GGACACGGCAAGCATGCAATGTAAGCAGTTTATTTGTAACTAGAGTAATTTAACATAAGT
AGATATACAATTTGGACTAAATATATCTGGTGGGCATAGCATCCAACCCACAAGAGTTCC
AAACCACATAAATTCATTGTGTTTAAACTCGTTGAAACATTGTGAGTTAAAATAACGAGC
TTGGAGATCGATATGTCTGCAATTTGGCGCTTCATGTCGCTTTGAAAATTTCCTGACGAA
TTCCACGGTCGGCTCGTTTCGCCTTCGGAGAAATAAATGGAGGAAAAGCGGAAAGGAGGG
AAACCGCACATTAAAATGAAGATCAGGGAATTCTAGTTTTAAACATGGGGTTGAAGTTAG
GGTTAGTTCTGGGGTTGAGATTAGTGTTAAGGGGAGGGTTTAAATTAGTTTCCGTAAATT
TAGTGAGCAGTTTTCCTCCTTCCCTCCTTTCAGTGGTGCCCCTTAAGCAGAGATGTTTTG
TTTATTTCAGATGGAATCGTGTCCTTGCTTTTATAGCGAACCTTCCCATTGGTGTCCCGT
TTTGCGTATCGTTTAAAAAGTACCACCTGGAGCACCATAGGAAGCTGGGGGTTGATGGCG
TGGACACTGACATTCCGATGCCGATAGAAGGAAAACTCTTCAGGTGAGATTTAACTTACA
ACCGCCGTCGTGTGGACCAATAGTTTGTTTTTTTTCTGTTTTTTTTTGTATAAGAGTCGG
TATATATATCGGTCGCGTTAACCACTTGGCCACACGACCGTTCAAGTTAACGCGAACGAT
ACAGGGTATCCTGAACGAGGCCACCTTGGATTTAAAACTATGCCCAATAAAAAAAGATTT
GCGCTTGATATACTGTCATTCGAAAGTAACCGAAAAGTGATGCATGGGATAGTGTAGGAT
GTTAATAATCTTGTCCCCTGGGATTAGATAACAGAGAGTAGTCGGTAATGAAGATAATAC
ACCACAATCATCAGATTACCTCATGCCCTTCGTCACGTTAACGGTTATAATACCGTGACT
AAAATACGTTGGAAATATTGTTCAGGTTTAAGCAACGTTGGTAAATTGCCGTTTGGAGGA
TACGCCCGAATAGCTATAGGGCCTGGTTTCGATCCGTTCCCCATTCGACTGACTGCTGAC
AAGGCTACACATTAGCTGTCAGGCCGACTTAAATCGTCTTGTTCGAGGCTGCAGGGAATA
GAGCAATGTACTGTGGTCTCCATAACCTCTTTCTAATGCGCATTCCTTTCAGGACCACAG
CCCGCAAGTTGCTGTGGGTTATATTACAGCCGTTTCTCTACTCCTTACGTCCATTGTTCA
TTAATCCGAAACCGTTGAACAGACTGGATTATTTTAACCTAGTTCTACAAATTCTTTTTA
ATGGTGAGTACGTTAGATAATGTCCAGTGTGCCGAAGTGTGCCCCTTTTGCTTTATTTTT
TCCTTCAAAACCATACATTCGTTAAACCGAACCATGCGGCTACAAAGTACTGTTACTTGA
CCAAGTTAGTGTTAACTTAATGGGATTACATGATAGGATAGAATATTCATGTTTATCTCC
GTGAATGGGAAAACGCAAGGGGCGTTAATGCACGGGCAATCGTCATATTACCTCGCGCCC
ACCGTCGAGTTACGGGAGCAACTGCAGTGTGTTGTATATGATTCACACGTTTCTTACACA
CAGTTTTATAGAACCCATAATTGTAATTGGTTTAGGCAATGTCCGTCCCATGGACACAAT
CCGACTCGCTATCAACCAGTATTGAATCTGCAAACTTTCGGCTGAAGGGCAACGCACTAA
CACCGTCAATCTAATCGGTCGGACCATTGTAAATTAAAAATCTATGCTACTGTTGTACTA
ACAAAGTACATTGTCAGTCAGTTTATCACCCATTTAAATAGTACTCAAACTAAGTAAATT
AGTAGCAGAGCGCTGATTAAACTTCTCACCTAAACAAGAGTGGCGTAATTCAACTCTTTA
TTCGCTACCATGAGGAAATTTTGAATACGCCGTTAATAAATTACCTGCGCTCTGATTTTG
CTGATGACACCGATAGCCAACCATAGGTTACCAGACTATCAGTCTATGCTCTAAAGCAGT
GGTTCCCAACCTTTTTCCCTTGGTGACCCCCTTAAAAATTTTCGAAGATTCCGTGACCCA
CACTTATATTCTATCCTAAATGCAAAATTAGAAGGTTATCACAAAAATGCTTTACTTGTT
ATTTATTAACAAATCAGTGCGATCGTTGACCTTGTAGATCTGCAGCTAAACGCATATGAT
GCTCCCCCCGTATTGCTTTACCAATTCCAAGTCTTGAGCTGATTCTCTGTTAGTATTAAT
ATACTAGGCTACTTCCCTAACAAAGTTCCAATTTGCAGCTATTGTACGTTTACAGTCAAG
TGGTCATAATTTATGACATCACAGTGGACGATATGACATCACAGTGGACGCATACTGATG
CAATAATATTGTGCTACTAAGCAATCCGAATGAAATGTCTCAATGAAAAATTATGCACGG
GATAGCATAATAGAGTACTAATATATATTAGTACTCTATGATAGCACATACTACGAGCGT
ACCGGTGCACCCAGTCCTATTGACATTTACCTTTGTTCTTACATTAGTAACAGCTTCGCG
ACCCCCTTTAACATGCTTTGCGACCCCTTTGGGGGTCGCGACCCCCAGGTTGGGAACCAC
TGCTCTAAAGATCAGATTTAGAATTTGCTGCGGATAATATAATATTTATTTCAATGGACA
TTACTCATATTTGTCAAAACCCAGCATCTCGCCGAATAAAATACTAAAACCCTATATTAA
CCCATAAACTAACGCACCGAGAAATGCTTAATGCCAAAAAGTATGTTTCTTTAAAAACGT
CAACATTAATATTGCACACATACATAATTCGGAATAACCTTTTTTCCAGGTTTTATTGTG
CACAGTTTGGGAGCGAAACCGCTGGTTTATTTGATCTTGGGAACTTTCCTGGGTTTAGGT
TTGCACCCAATATCTGGCCATTTCATAGCCGAGCACTACATGTTCTTGAAGGTAGGGGTT
TGTCGATCGGACTCAATATGTTTATACTGGTACCATTTGGAATATTCGTCACAAAACCCT
ATAACCCACATGACCAAAGTCGGCTAAACATAGCTAATACAGTATGTTCCTTATTTAAGG
ACGTCTTCGGACTAGGTTTCGATCCCATGATGGGCTCGTCACAAATTCCGTTTTTTTATC
ATATTGGTGTCGGCATATGTATCGGTCGCGTTAATCATTCGGCCACCCTACCGTACAATG
ATGCATTGTTTTAAACAATGCATTTGCATTATGATCCTGAAATCCGTATGCGGAAAATAT
GCATTTGTGTCAATCGTATATTGCCGAAAAGCTAACGCGGCCGATTCTTATTCACACAGC
ACAAAAACGCGGGTGCCTCTAAATACTACAGGACCGCTTGGAGCGCTTGGATCGCTTGGA
TCACTTAGATTGCTATGGAAAGTAATTCTAACCCTGTCCCAAACACTAATCTTAACCCCA
GAACTAACTTTAACCCCAACCCTAACATTATTATCACGGCTTTTGTAATTACGAAGTATA
GTAAGCGATCCAAGCGATCCAAGCGCTCCAAGCGATCCAAGCGATTTAAGCGATCCATGC
GCTCCAAGCGGTCCAAGCGGTCCTGTAGGTATTTAGAAGGTACCGGCCCAAAAACGCACC
GAGAGAAAGATACATCCCCGTAGGTCAGAAGGATTTACCGACTATATAATATAATATACT
TAAATTTAAAATTACTGAAAACGCACCTAGCATTGTCCTGGTTTTGAGGCACAGCCCTGT
AAAAATACAGATCCTGATATGTGTTTATTACTTGATACCAATGCAACTTTTTTTCGACGT
ATTTAATTCCACTGGATGAAAGTGGCGTCGTAAGCTACCTTTCCATGTGGTACAATCAAG
GTATAACCAACTGCACATTATTTGCGGTCAATGAGTTATCAAACGCGCAGCCTTAAAAAC
GAAATATGTTCATGCGATTTCTCTTCCCAGGGCCACGAAACATACTCCTATTACGGGCCT
CTCAACACTCTAACCTTCAACGTCGGCTACCATGTGGAACATCACGACTTTCCTAGTATC
ACTGGTTCTAGATTACCGCTGGTATGTTCAGAATGTGCTGCTTTTTTACAGGGAAAAGTT
TTGAAACCGTGATGGTCTCGTCACATACCGTTTTTTATATAGAAATCGGTTGCGTCAACC
ACACGACCACACAGGATATGTACGACCGTGTATGGTTAACGCGACCGATACATATACAAT
ACATACAAAAAAAACGGTTTTAGCAAGGAGCCCACCCTGGGTTCGTAAAAAAGGCCGGTT
AAAAAAACTACATAGGATGTGCTGCTTACCATGATACTTGCCATATACCGCAACCACAAT
AACATATGGTCTAACGTGATTTTATGATATTCTAGTAGCTAGAAATATTGTTATATAGAT
ATATGGTTCGGTCGCGCTAATCATTCGGCCAATAGACACTTGTCCAAAATTCTATTCTAC
ACCAACTTTCATGTGCTCAACACACTGCAATAGCTTCGACGGGAATAGCTTTAGAATTTT
ATTTTAGATATGTTTCCAAATAATCTTATGAATTAAGCCGGATTTACTCTTATTACTGTG
TCTTGCTTGCACACCTTTTGTTCATGGTTCTAATATTATTAATTTGGATTTGAATAAGTT
TGCTGCAATTTATTTTTATTTGGTTCATGTTTAACGGCCACGTCACTTTTTCCCTTTTTA
CACCGTTTACGGACGTGTTTTAACTATTGTAGTTGCCGTTTTTTTGCAATTATTTTATAA
TATAATAAAGGAGCAAAGAAAACTAAGCTAAATGCCGCTAACCCGACGCTGCGCACAAGG
TAGCCCAATGTCCATGTTACAACGCTAATCTTTCTTCCGGTTTTCAATTGAGGAGTATTC
AATGCTATCCAAACATTTAATCTTATACCAGGTGAAACAGATCGCCCCCGAATTCTACGA
CCATCTGCCCATGTACAGCTCATGGACAAAGGTGATCCACGATTTTGTTACCGACCCATC
GATCGGTCCATACTCAAGAATCAAACGCGCAGGTTTGTCACGGAAAGCATAATTATTAAA
AAAAAACTGGAAATGCGGAAAACCTAAAATTAACCACAGCACCATTATAATTTTGTAAAA
CCTTTTTTAATGGGTTAAGTTTCGATCTCAAGATAGGGTCGTCACAAGTCTTTATATAGA
ATTAGCTGTACGAAACGTCGCGCTAACCATTTTGTCATACAACCGTTTGATTGCATGCGT
TTTTTTTAACGGACTAAGTTTCGAAGCCATGACAGGCTCGTCCATTAGACCGTCGTTTGT
ATACAATTCCGTTTATAAAACGGTTACTTTAACCACTCGGCCACACGGCGTGAATTTTTA
TGTGTTTTCTTATTAAGCCAAGGTTTAACCTCATTATGTGCCAGTCTCTAAGACTGTTTT
GTATAGAAATGATATGTATATATATATATATGTCAGTTGCCTTAACCAGACCGATCGGTT
TACATGTGTTCCGGATGTGCTTGCAGGCATTCAATGAAAGAGGACACGGGGTGGTTATTG
AAGAATATGTTGTACACGGACACGAACAGAGGATACCTGTTCAACAAGTTGTTTTTTTAT
TATGAACATGCAATTAAACTTAAAACGTTAAACAAACAGTTTTTTGTAAGTTTCAGTTGC
TGTATTACCGTGTGTTTTCAAATAAACGTTTTTTGTAGTTGCAAATTTTAAAAAACTATG
TTGTTTCAATTTGTTGTTGTTATAAAAGACATAGCGTCCCTTTAGGTTAGTCTTTTTGTA
CCATGGATCCATTCCCGGCCACTGATAACGATAATATTTATCAATTGAAATTTTCGGAAT
GGTGGCCTATGTGAGTCAATTTGCAGTTAATATCCACTGGATGTTATATAAATTTAAGCA
ATGGGCATAGACGTCGGTACATTGGAGATAATTTTAAGCACCCATGTTTAAACCGGAACC
TGCAGCACAAGGTTAAAATAATTCAGTTTGTTCAAAGAAAACTAGCTAAGTCCGTATCCT
TTCGTTGGGTTGTACGTAGCGGCATGGGTGGTCATCTGAAAGTTGAAAGGATCAAAAACA
CTTACGCGGGTTTCAACCGTACATGTTTTAACTCGCACAAGTTTTAACTGACACCGATTT
CAAGTAACACGAGTTTTAACCAACATGGACTTCAACTCAAATGAGTTTCAACTAAAAAGG
CTTTATCTCATACGTGTTTTAACTCACACGAGTTTTTCAACTCACATCGGCTGCAACTCA
TGCGAATTTTAACTGACACGGATTTTAACTTACATGGGTTTCAAATTACACGGGTTACAA
CTCGAACGAGTTTCCATTCACACGAGATTTACTCATAAGAGTTTTAATTCATACGAAATT
CAACTGAAAGTTTTAACTGTCACTAGTATCAACACAAATGGCTTTCAACCAAGACGAGTT
TACCGCCACGATTTTCTTTAATAAGTTAAAAATAAAACTTGTGGCGGTTGGGTGCTTTGA
CCACGAGATAGATCACTGATCAAGTACAAACTTTTTATGTTGAACTAATCAGATCGAATT
AATCAGATCTATCGAAAAACTACTACATGACTAATATCACGATCATGTTACTGTGAAATG
CAAATCGGTTCTCAGACAAATGCCTCGTTACATAGTCGGCATGGTTAATACGACTCGTCA
TCAACAGTCATCACTGAACCCGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1082, 1787..1936, 2641..2719, 3190..3342, 3952..4082, 5629..5750, 6750..6860, 7711..7831, 8306..8502
1001..1082, 1787..1936, 2641..2719, 3190..3342, 3952..4082, 5629..5750, 6750..6860, 7711..7831, 8306..8313
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved