Ciona_savignyi Locus ENSCSAVG00000002810
snOPY snoRNA Orthological Gene Database
Ciona_savignyi ENSCSAVG00000002810
Ciona_savignyi
ENSCSAVG00000002810
reftig_11
SNORD14, SNORD14, SNORD14, SNORD14
1473..1615, 2508..2650, 3288..3430, 4055..4197
6047
TTCCTAAAGAACTTACCAAACTTATTCACTGTTTTTAGGTCATAACATTAAATAGTTTA
ACATGGTTAACAATAATATACTAGTTTAAAAAATGTAATGTTTGTATTTTTCATTCTTAA
GTTTAACGGCTGCGTCTGTTGTCTTTTGTTTATTGTGTGTCTAGTTGACGACTACCGTGC
AGACAGACGTCTACTGCGCATGCGCAGATTGAAATAAAAATTAAAATCTCCGCGAATACA
CGAGCAAAATGCTTATTTTTAAGGTCATGTTTTACCGAGCATAACTTACCGTATCCTAAG
AGATTATACTAACCCAGCTAAAGCACTTATTGTTTCGCTTTGCTTTAAAAATTGTGTTAT
GATGTGGACCGAGAACAAATTTTAGTAGTCGAGCTTTCGCTAATTTATGTAGTAGTCTGC
GTATGATCTTAAGAATAGAATAAGCCGTGTATTTGAGGTTAATCCTGGTAATCGAAAAAG
CACAGATGTCGTAACATCGTACTGTGAGTATGAAACCGTTGTTCTAGAAAATTCTGCTTT
CGTACGTCACGTGACTTCACACTAGCAAGCGCACATGAGTCGCGAACTTTCCAGAACAAA
ATTAGTATTTTGCGATTTCCGCAAATAGAATTAACCCGCCAAAATTATTTGTTCTGTTAT
ATATTTTTTTAAAATATATTATGAATATTTACATATTACATATATCGAAGTAACACTAAA
TAATGGTTTTTATACACTTTGAATAATTTATAAAAGAATATATCACCAAATAGTGATGGC
GGATGAATATGACAAATCGAAGCAAAGTGAGGAGAAAGAAAAAAGGGAGGGAAGTTAAAA
CTTGAGCACGTGTGTTAGTTCCAACGTGTTGCTTGAAACCGTTGGTATTCGTTGCGTAGG
TCGCTGTAGTTCGCATATAATATTGCGTTGGCTTGTTTTCCTTACCTAAAGTTTAATCAT
TCTTATGTTTTTTAGATCTGCTGGTTTGTCTCGCATAAAGCTTGAATTAAAATTTAACTA
AATTCCCCAAATATCGTAAGTAAGCGCAATAATTGTATATTAAAAGAAACTAAACTGGAT
ATAAAATAACAGATGGCGGATGAAGTTCAAGATGATGTTGCGGAGGTGTTTGCTTTCCAA
GCTGAAATTGCTCAGTTAATGAGCTTGATTATCAATACCTTCTACAGCAACAAAGAAATC
TTCTTAAGAGAATTGATTTCAAACTCTTCTGATGTAAGTGTCATTTATGTATAATTCAAT
GGCTATGATGTCGTGGCATAAGATTTACTTAATTGCACCCAGTTAATGCACGTTAAAAAA
GCGTTGTAGGTTTAGCTTTATTTTGTATGCAAGTTTGTCTGTTAATGGCAAACCAGGGAA
TGAAATTCTGGTAGTACAGACGTTTTAATGTATCTTACTCTTGGTTTTCCCCATCTAAAA
CTTGCTGTTTTCTGTTGTTTTTTTGTATCCCAACTGCAATGATGATGTATCCCAACATTC
GCAGTTTCCACCAGACCAGAGATAAACTTAATATACAGGAGGGTAAAACTTGCTGTATAT
TATGTTGATTCTCGATTTATGATGGTTTAATGTTCCTTCCTTGGATGTCTGAGCAGTTCT
ACAGTATTTAAATTTCGTCTTAAGTACACATAGCTTATATTCAAACTAAATGTGCAACTT
TTAATCCCTACAAAATTGAATTGCAGGCCCTCGATAAAATTCGGTATGAAAGTTTAACCG
ATCCAAGCAAGCTTGACAGCGGAAAAGAATTGAAAATTGAAATCATCCCAAATAAGGATG
ACCATACCCTCACCTTGATTGATACTGGTGTAGGAATGACAAAATCTGATCTGATCAACA
ATCTAGGGACAATTGCAAAATCTGGAACAAAAGCTTTTATGGAAGCTCTTCAGGTAATTG
AATTTTCATTTATGATGGTTAAAAATCTCTGTTCTTGTGTTAAAGGTTTATCTATGGCCG
CTATGTATCTGCAGTAGGTATTATAATCACTGGGTTTTTACAGTCGGGTGCTGATATTTC
TATGATTGGTCAATTTGGTGTCGGTTTCTACTCTGCATTTTTGGTAGCAGACAAAGTTAA
AGTGGTTTCAAAGCACAACGATGATGAACAATATGTGTGGGAATCTTCCGCTGGTGGCTC
CTTTACAGTTTCCAATGTAGTTGATGATGTTCCAGTCCGTGGTACCAAGATCGTTCTTTA
TATGAAGGTTTGTTCTTTAAACTAAACGCTTGTGAAAGTAATGACTGAAGCTTTTATTAC
TCAAGTTGACTTATTACAGGAAGATCAACGCGAGTACTTGGAGGAAAAGAAGATCAAGGA
CATCGTTAAGAAGCACAGCCAGTTTATTGGTTATCCAATCTCCCTTCATGTGGAGAAGGA
GCGGGAAAAGGAAATCAGTGATGACGAGGAGGAGGAAGAAGAGAAGAAAGAGGAAGCTGC
CGAGGAGGTTCAGCAGGTATGACGGTTTGCTATTTCCGCTTGTTTAATTTGCAATGATGA
TGTATCCCAACATTCGCAGTTTCCACCAGACCTGAGATAAACTTAATATACAGGAGGATA
AAACTTGCTGTATATTTTGTTGATTCTCGATTTATGATGGTTTAATGTTCCTTCCTTGGA
TGTCTGAGCAATGAAAAATAAATTGATACTAAATGGGTTTTGAAAATGTAGTAGTCTTAG
TTTTTTACATTTTGTTTCAGGAGAATGACGACAAGCCAAAAGTAGAAGACCTCGATGAAG
AAAATGAGGAAGCGAAGGACGACAAAAAGAAAAAGAAGAAAATTAAGGTTTGTACTGGAA
TGAATTTTACAATCCAGCAATAATTACAAATACTCTTTTGTCAACAGGAGAAATACACTG
AGCTTGAAGAGCTGAACAAAACGAAGCCACTGTGGACCAGAAACCCTGATGATATTTCAC
AAGATGAATACGGAGAGTTCTACAAAAGTTTGTCTAATGACTGGGAAGACCATCTTGCTG
TTAAGGTGATTTAGAAATTAAGTTCAAAATTAAAAATTAATTGCAGTATAAATAATTTGT
AAACAATTGTGTCAATTTATTTTTTTTCTTTTTAGCACTTCTCTGTAGAAGGACAGTTGG
AGTTCCGTGCCTTGCTCTTTGTTCCAAAGCGTGCTCCTTTTGACTTGTTCGAAAATCGGA
AGCTTAAGAACAACATTAAGCTTTATGTCAGGAGAGTATTCATCATGGACAACTGTGAGG
ATCTCATTCCAGAGTACCTAAGTAAGAACCTAACATTTTTGCTTTGCATTGCAATGATGA
TGTATCCCAACATTCGCAGTTTCCACCAGACCTGAGATAAACTTAATATACAGGAGGATA
AAACCTGCTGTATATTTTGTTGATTCTCGATTTATGATGGTTTAATGTTCCTTCCTTGGA
TGTCTGAGCAATGCAATATTTAAATATTTTTTCCTTATTTATGAAAATGTTTTAAAACAA
CAATGTTTAGATTTCGTGAAGGGAGTGGTGGATAGTGAAGATCTTCCTTTAAACATCTCT
CGTGAAACTCTTCAACAATCAAAGATTCTCAAAGTCATTCGAAAGAACATTGTAAAGAAA
TGTGTTGAATTAATTGGCGAGATTGTAGAAGACAAGGAACAATACAAGAAATTTTATGAA
CAATTCGGAAAGAACCTGAAGCTGGGTATTCATGAGGATTCTCAAAATCGCAAGAAATTG
GCTGGATTCCTTCAATACCACTCATCGCAATCTGGTAAGTAACTAATACTGTTGCACTGC
ACCTTTATAGGCTTGAGTGCACATTAAAATTAATATTTCTTTTATTATAAGGTGATGAAA
TGACAACTTTGGAAAACTACGTCACTCGAATGAAGGAAAACCAGAAGGACATTTATTACA
TTACTGGTGAATCCAGAGACCAGGTCTCCAACTCTGCTTTTGTTGAAAGAGTCACAAAAA
GAGGGTTTGAAGTCTTGTACATGGTTGAGCCCATTGATGAATATTGTGTACAACAACTCA
AGGTTGGTTCATTTACATCTTGCTACTTCGCTTTTATGCAATGATGATGTATCCCAACAT
TCGCAGTTTCCACCAGACCAGAGATAAACTTAATATACAGGAGGATAAAACTTGCTGTAT
ATTATGTTGATTCTCGATTTATGATGGTTTAATGTTCCTTCCTTGGATGTCTGAGCTTTG
TTTTTTTAAAGTTTGAGGACTATGTTAACCTTTGTATTGTTGGATCCTCGTTCTAATTTA
GTTCCAAACTTTCTAGGAGTTCGATGGGAAGAATTTGGTCTCCATTACAAAAGAAGGTCT
TGAACTTCCAGAGGATGAAGATGAGAAGAAAAAGTTGGAAGAAGCAAAGGCTAAATTTGA
AAACCTTTGCAAAGTTATCAAGGAGATTCTTGACAAAAAAGTGGAGAAGGTAAAATAACA
TTTTTTCTGGGACTATTTGAATTTAAATTACATGCTTTATTTCTTAGGTTGTGGTATCAA
ATAGACTGGTGCAGTCCCCGTGTTGTATTGTGACCTCCCAGTATGGTTGGTCTGCCAACA
TGGAACGAATCATGAAAGCCCAAGCATTAAGAGACACCTCCACTATGGGTTATATGGCCG
CTAAGAAACACCTGGAAATTAATCCAGATCATTCAATCATGGAGCAACTTCGACAAAAGG
CAGAGGCCGACAAGAATGACAAGTTAGTAACAATTTGTTGATCTGTTCTGCAGTATTTTA
ATTCTTATTATTCTAGGTCTGTAAAAGATCTCGTTATGCTTTTGTATGAAACTTCCCTGC
TGGCTTCTGGCTTCTCACTGGAAGATCCATCAACCCATGCCACCCGAATTCATAGAATGA
TCAAGCTCGGTTTAGGTAAGTTTTTTTCTGTTTTGTTTGATCAAATATATATTCATGGTT
TGTGAATATTCAAAGGTATTGATGATGTTGATGGAGAGGACGCAGCCACCGGCGACGATG
TTGATGATATGCCGCCACTGGAGGGTGATGCTGATGACGATGCATCTCGCATGGAAGAAG
TTGATTAAACCTATTAGTCGAAAGGTTGCCAAACCAATTTTTCCATCTTTCGGATTCGGC
ACACAATGCAGCTAGAGTGTAAAAATCGGTTCAGCACTCTTGTTCAATTTTTAGTTACCG
TCACATCCGTGTGAAACTCCTGTTCAATATTTCTTTTCTGCTGTTACGCTATAAATTGTC
CCGTTTTGTAATTGTATCGTATCCAATAAAACTAAATTTATGTAGATGTGTTTTTGAACT
GCTTAAATTGTCGTAGTTTGTATTACGTAAATCAAGACAAATTTGGTTCAGTTCGGCCGT
CACCGGGTTAAGAGCGTGTTATAAAATTTAGCAGTTAGGTGGATATTTGTACGTTGTAGT
AATGTCTCCCTTGTAGTTGGATTGTACGCAAACCAAAACTCTCGTTTTATCCAGATTTTC
AGCCCTTGTAATCTGGTCGGTGCCTTTGGAAGTATGTCTGAATAATGTCGATTGTGACGA
AACTCGTGTTTGTTGGGTAATAAACGTGGTTACTACAGCAGCAATAACTGGTTGCTCCTT
AATTATTTCGGTCAAAATGTCATCCGGGAACGATTCTGAAATGCTGCAGGTTCCAGGTAC
GCACAAGGGTCCGTCAAAATCTGTTCTGAATCGATGCGAATCTTCACGTATTACTTCGAG
GTTGGTTATTAGAGGTTATAACTTGACAATTTAAAATATATCTATTTTAATGTGTCCAGA
ATAAACGTGAACCATAAAACATCGGCTTATTTTCTCACAAGCAACCAGAATAAACGGGTA
CGTTGAATTTCCCCCCATTAATATCTGTGTTAAACAGTTGTCGTTTTTAAATAGAGAGAT
ACGAAACCAAATGGTTCGTCAAGTGGCAAACTAGGTGATGATATGAACCATCATAACCTA
AAGGAACTTGAAGCAATCTTTAAAGAAGCAGGTTCATTGTTTTTACTTTAGCCTAGTTTG
CAGGTCATTTCGTAAACACAACTTTCTAGTCAATTAAGCCCCACCACT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1034, 1092..1232, 1706..1912, 2023..2226, 2299..2466, 2720..2806, 2867..3004, 3095..3260, 3490..3753, 3831..4021, 4276..4428, 4487..4701, 4756..4874, 4935..5047
1092..1232, 1706..1912, 2023..2226, 2299..2466, 2720..2806, 2867..3004, 3095..3260, 3490..3753, 3831..4021, 4276..4428, 4487..4701, 4756..4874, 4935..5044
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved