Ciona_savignyi Locus Mono:2:SNORD83
snOPY snoRNA Orthological Gene Database
Ciona_savignyi Mono:2:SNORD83
Ciona_savignyi
Mono:2:SNORD83
reftig_132
SNORD83
1001..1076
2076
CAGCGTTTTTGTCTGCATCGTTAAAAAATATGTCTTTATGTCCCAATTTTTATTTCAGT
TGTGAAATTTCGATAAATGTGAGCATTGCTATTGTATTTTCCCATCACTGCCTGTGGCAT
TTGTAGTTTTGAGTGAAGCACTGATACTGCATAGTACAGGATATGCGCCACGCAATCAGG
AAGTTCCTATTTCATAAAAGGCGCTCCCATTACTGTTCTTACTAAACCTAAGCTGCGTAT
TAGTGGAGCACACCATCTGCTTGCCACTATAGTTGGAAATAGCTTTAAAATTAACTCTCT
CTAAAAATATATCATCAGTGTTCAGTTTAAGTTTATTACTAAACCAAGTGCATGTCTTAA
TATAATAAAGTTTATATAATTTTAGAAGAACCTGGACCAAAGAAACTAGCTACTCCTCAA
ACATTTGCTGCAAATAGTAAGTTCTAGATCTATTAGGCTGCTGAGTTGATTGTATTACAG
TTTTAATGTTTGTATTGTTGCTTAGGTGAATTCGCGGAATCTAATAAACTTGGAATGCAA
GAAAACCCGTAAGTTTGTTATGCCTTTTTTAATTTTCATGTTAATTTTAGCTATGATGAA
AACAATTTCAGTGCTGAAATTATATGATAGTATTTGTATTCATACCCTGAGCTTTATCTT
TTGCAATGTATAATTAACTCTTTAGTATTACAAATCACTATAGTAAGTTTTTTGGCAGGG
ATATTATGTCCGAGACAATCAGATTACCAGATGACCTTGTTGGGCTGAGTAAGTTGCTGT
TTGTGTGATTAAATACATGCATTTGGCAGTTGTTTAATTGATTTGTTGCTTAGTTATTGG
CAGAGGTGGTGAGAACATTATGAGAATGCAACGCGAAACTGGTTGCAGAATTCAGATCAC
GCAAAGTATACCGGGCACTAAAGAACGACCATGCACACTATCGGGCACCCCAGAACAAAT
TGAGTAAGTTCTTTTTCTGTAGTAAAAACATGTCCTTTTAAGCCACATGATGCTTTTTAG
ATACCATAGCGTTACTGCATTGATGACCTTTTATCTATCACCCATTAACTGATGGCATAT
TAAACTCACCCTCTTGTTTTCTATGAAATAAACCGAGCAATGATAACAAAGCGCTTCCGT
TACAGAGTGTGCAGGAACATGTTAAACGAGATCATCTCGCGATCCCAAGCGGGAACACTG
GGCAATAACTTCAACCTTGGAGGACAAGGGGGAATGAGTGGAAGTGGCATGGATGGTGGA
ATGGGGGGAGGTATGGGAGGGGGCAACATGGGGGGAATGGGTGATGGAGTCGAGAAATCA
ATCGAGATTGCCGTTCCTCCTGACAAGTGTGGGCTCATTATCGGCAAAGGTGGCGAAACT
ATCAAAATGGTGAGTACCGACTTTTCGTATGGTGCCACAATTTTAAAACTTTCCATCTTT
CCCACAGTTGCAGCAGAGCTTAGGCGTGAAGATGCTTCTCATCCAGGATTCAACCGATAA
CATCGGCCAGAGCAAACCTCTCAGAAATAACAGGGGCACAGATGAATCTAGATGTAAGTA
AAACTACATTGCAAAAAACGCTGTTTTTTTGCACTTCCTTATTTTCAATTTTTCCATGTT
TTCACTTTTTTCCATGCTTCCGTATTTTAGTTTCTTTTAGATCTGGGCGAAATTACAAAA
TTATGCCTCTAAAGTGAAGTTTAAAGGTTAATTCTCTCTGTCTATCATCAAAATACATCC
AAAAATGCAATAATTTTTGGGTGTTGTTTAAATCATGATAACGTCATAAAAATTACGGAA
TTACGAGCTGCCGTAATTCCGTAATACAACTTGATCAATTACGCCCAGTTGTAGTTACTT
TCTTAGTTTCCATGTTTTGGTTTGTTTCTATGCTCACATATTTTTGTTTCGTGTGCGTAC
TACAGAATGCTGTGAATGCGGTTCACCAACTAATGGCGAACAGAGACCAGCAATTGGCCC
AGCAGAAAGTGGACAGAGATGGAAGTGGAATGGATGTAAGTTCTCAGAAATTCTGTGTTT
TAATTCGGTTATAGCGAAACCTGCATCATTCAGCAAG
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved