Ciona_savignyi Locus Mono:1:SNORD15
snOPY snoRNA Orthological Gene Database
Ciona_savignyi Mono:1:SNORD15
Ciona_savignyi
Mono:1:SNORD15
reftig_131
SNORD15
1001..1073
2073
CAACATTTAAAAGTGGCCAACAGAACTTGTTGATTCATTTATATGGCCCAAAGTCAGAA
AACTAACCAAAATCCCCTACTTAACCAATTTATAATCTTTTTTGTGCTTGGTCTCGTCTC
TTTTAATGTATATTTATACATAATACATGGGTGTTTGTTACAATTTGTTGTTTTTAGTAC
ATCTAAGAGTCCATCTGATTGCGCCATTTGTTAAAGCAGTGACATGAATGACGAAAATTG
TCACAGTCGAGGCACCACCTATCCTTCATATATTTTCTTGCTACACAACAATGCCATAGT
TTAGTTTTTGTTTATTTAGTTGTATTTGCTTTTTTAAATAACAAAAATGAGGAAAACTAA
AAGAAGGGAAAGCGGGAAGGAGGGAAAGAGGGAAACTGTACTCTAAAATGATAGGGTTAG
TTTTAAACATGGGGTTGGAGTGAGGGTTAGTTCTGGGGTTGAGATTAGTGTTTAGGAAAG
GATTGAAATTAATTTCCATATTTTTGGCAAGCACTTTCCCTCCTTCCCCCCTTTCCGCTT
TCCCTTCGTTTAGTATTGCCCACAAAAATTAAAGAACCACTCACTTAAAATAAGGACAAG
CCGGAAAACCGGCAAAACGATAATCGTAGTATCACAGAAGAAACGACATAAAATATACGT
TAGTAAAATGCCAAAAAAGGAAGGAAAGGTTTGAGTTTATACAATCGACTAGCTATGAGT
AGGTTTCGAATGCACCTCTTTCCGTATGACGGTACGACGCGTTAAGATATGAGATAACCA
TCTGTAGCTTATACATCTGGCCCCACGGTCCTAGTGATGAGAACCTTACCATTTAACCCA
TTGTCAAATGATTTCTTACCAATTCAATAGGATGTATATGACGATTCAAACTAATCATCA
TTATCAGATGAGCCGTCCACTTTGATATTTATTCAACAACTAACCACAAACGGAAGAATG
TTCTGATATAATGCTACGTCTCCTCCGTAAGTTATACTCGGGTTCAGTGATGACTGTTGA
TGACGAGTCGTATTAACCATGCCGACTATGTAACGAGGCATTTGTCTGAGAACCGGTTTT
ATTTTTCCTACTGATCTGCATGTGGGTGATCCCACTTATACATGCTGCTTGTATATTTTC
AGGCACGGTTAACCACAGTCTTACTCTTGCGGTGCATGAGTTGAGTCACAACCGAGCCTT
TGGACACGGCAAGCATGCAATGTAAGCAATATAACTAACTAGAGTAATTTAACATAAATA
TATATACAATTTGGACTAAATCACTAAACATATCTGGTGGGCATAGCATCCAACCCACAA
GATTTCCAAACCACAAAAATTCATTGTGTTTAAACTCGTTAAAACATTGTGAGTTAAAAT
AGCGAGCTTGGAGATCAATATGTCTGCAATTTGGCGCTTCATGTCGCTTTGAAATTTTCC
TGACGAATTCCACGGTCGGCTCATTTCGTCTTCGGACAAATAAAGGGGGGAAAAGCGGAA
AGGAGGGAAACCGCACATTAAAATGAAGATCAGGGAATTCTAGCTTTAAACATGGGGTTG
GAGTTAGGGTTAGTTCTGGGGTTAAGATTAGTGTTCAAGGGAAGGGTTTAAATTAGTTTC
CGTAAATTTAGTGAGCAGTTTCCCTCCTTCCCTCCTTCAGTGTTGCCCCTTAAGCAAAGA
TTTGTTTTTTTTATATTTCAGATGGAATCGTGTCCTTGCTTTTATAGCCAACCTTCCCAT
TGGCGTCCCGTTTTGCGTATCGTTTAAAAAGTACCACCTGGAGCACCATAGGAAGCTGGG
AGTTGATGGCGTTGACACTGACATTCCGATGCCGATAGAAGGAAAACTCTTCAGGTGAGA
TTTAACTTACAACCGCTGTCGTGTGGACCAATAGTTAACGCGAAAGAGAAGTAACGGTAT
TCTGAACGAGGCCACCGTGGATTTAGAACTATGCCCAATAAAAAAATATTTGCACTTGAT
ATACTGTCATTCGAAAGTAACCGAAAAGTGATGGGATAGTGTAGGATGTTAATAATCTTG
TCCCCTGGGATTAGATAACAGAGAGTAGTCGGTA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved