Ciona_intestinalis Locus ENSCING00000000145
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000000145
Ciona_intestinalis
ENSCING00000000145
scaffold_435
SNORD14, SNORD14, SNORD14
1276..1416, 4478..4618, 6873..7013
9774
GGTTAAGGTCCTCAATCGCTATGGTGCCACGTTTATGGTACATTAGATACTCAATCACG
CATTCTGTTTATTACAATGTACATAAGTGTTGCATATTCATTCATATTTTTCATTGTTTT
AAAAGTGAATTCACGATTAACAAATATTAGACTTTTTTACTACTTCGTTATATACTAATA
TCGTGGACATTGTAATAATAAAACAACCGCCAGAATACTTCTGCTTTGTGGTTGTTTCTC
CATGAAAATTGACCTTAATTCCCCCTGATTAGTAAAATTAAGGGCACAGCAGCGGATGAT
GCCAGTTACAGTACAGAAACAGATGTTGTACAAACGTTCTTGACAAATCACACTGATATA
AAATGCACACTTCTCTTGGATTCTATGTTGTAAAATAAATAGTTACCTGACCAGTAAGTT
AAAAACAGCAAGACTGCTTCTGTTAGTGTAAAGTCGAGCAGATGTTTTGACACGACGAAC
GCATTTCCCGAAGGTTCTGTGTGAAAAGCCATGCGTCACGTGAAGCGGGACAGCCCCGAA
ACCGTTGGTCGCGAAGCTTCCAGAACAAAATTAGTATCTTGCGACTTCCGCAAATAGTTC
CTAATGTTATCTTTAAAAATATAAAATTAAACCAATAAAAAATAGGTAACATATATGTAA
ATGGTATAATATTAGACATGAGTAAAATTAGTGCCAAGAGAAATTTAACGCTTCTTTGTT
TCATAAAAAAGTGATAGTAATTGAGCGCGGATGAATACAGAACTTTCCGGCTTATCGTGT
GAGAAAAAAAAGAGAGGGAACTTAAAACGAGAACACGTGCATTCATTCAAACGTGGTTCG
ACGTTGGAGAGTGTGGTTGACATTTTACGTTGGGCAGTCAGTTTAAATTTAAAGTCAGCA
TATTTACGTTAATATGTTGCCTAGTTCTTATTATACTTAACTAAGTTGGCTGTTTATATC
TCAGATTTGCGTACCTCTTTAGGTTTTTCGTTTAATTCAAATTTAGTCAATTTAACACCA
AAAGTATGGAACAGGAACACGAAGTTCAAGAGGACTCTGGGGAAGTCTTCGCTTTCCAGG
CAGAGATTGCACAGTTGATGAGCTTGATCATCAACACTTTCTACAGCAACAAAGAAATCT
TTCTTCGAGAATTGATTTCTAATGCATCAGATGTAAGTGAACTAAGGCTTTTAATTTATT
TGGGGAGGGTATCAATTGTACAATAAGTCTAGCTAATGTTACTGGTTAATGAAAAAGATT
GTTTTATTTACAAGTTCTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACC
GAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCCAACTCTCATTAA
TGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGTCTAATAGTTACATAATCATTTG
AAAATCTGTGATCTTGTTTTAGGTAACCTTAAATGGTCCTTTATATTTGGTGCAGGTCTG
CTATGTCAACTACATCCTAGCGGACTTCCACTTTTGAAATGCCGAACCTAATATTTGTTT
TCTATACAGGCCTTGGACAAGATCCGATATGAAAGCTTGACAGATCCCAGCAAACTTGAC
AGTGGCAAAGAATTGAAAATTGAAATTATCCCAAACAAAGACGATTACACCCTTACACTT
ATTGACACTGGTGTGGGAATGACAAAATCTGACCTAATTAACAACCTTGGTACAATCGCA
AAATCTGGTACCAAAGCATTTATGGAGGCTCTTCAGGTGTGTTTTAACAAACATTGTAAC
CGAAAACTAACTTAGTTTTATTTACTTAAAACCTAGAAATATCATTTTTGGAACCAGAGT
CTTAAATTATATTTGAATAAAAATACCTTGTTTTGGCATTCTGGTGCTAAAACTACATTT
TCCAAATAAAAATACCATTTTTTGCAGTCTGGAGCTGACATTTCCANNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTGAGCACAACTATTTCTATCCG
TTATTTGTTGTACTGACCTATTTAATTTGAAGCTGTGTCTTTGTTTTTTCCCTCTGTTTT
CAAATGATAAGTCAGCCTTTCGTTATAATTACGTATTTACGTATATACCTTACACAGAAT
TCCTTCTTTTTGCTGTTATCTTATATAAACGTTACTATGTTTATGACACGATCTGAGTAC
GACAGAGGTGTAAACACCTTCTCACCAGAAGGGAGACTTTTCCAAGTAGAATATGCCATT
GAAGCAATTAAACTTGGATCAACGGCAATTGGAATTCAAACTGCTGATGGAGTTGTACTT
GCTGTGGAAAAGCGAATAACTTCCCCATTGATTGAAGCATCCAGTATCGAAAAAGTCTTT
GAAATTGACACTCATGTTGGTAAGGAGCATTACTAGTTCAGTTACGTACCAAAACAGCTT
TTTTGTGTTATCGATTTTACCAAATAGACTTTACTGCTTTAAAGAACACGATTATTTGCA
GCAAATTATTATGTACTAATGTCTGCAGTCTAAATGAAGGTGTGTGTTCACATCTCACTT
CTAACACCATGTAGTTAGTCTCTATACTCCTATTTCTAGTTTGTCTTGTATGTTTATATC
ATGTCTGGTTAGAATGGAAGAGAACGATCAAGGTTNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNACTCTGCTTTCTTGGTCGCTGACAAAGTGCGAGTG
GTTTCCAAGCATAACGATGATGAAGCATATGCATGGGAATCCTCTGCTGGTGGTTCTTTC
ACCGTTGCTTCCATGGATGGAGATACTTTAACCCGTGGAACAAAGATTGTTCTTCATCTT
AAGGTGAACTTTTAGCAACTAAAAAGATTCACACACGGAGTTTTTTTTTAATTGAATTAC
CTGAGATTTTAAACAATTCCCTCTCTTTCTTCAGGAAGATCAACGGGAGTACTTGGAGGA
GAAGAAGATTAAGGACATTGTGAAGAAGCACAGTCAGTTCATCGGGTATCCCATCTCACT
TCATGTGGAGAAAGAGAGAGAAAAGGAAATTAGTGATGATGAGGAAGATGAAGAAGAGAA
AAAAGAAGAAACTGCCGAAACCGAAGAACAAAAGGTATATTTTATAGCAACATTTCTGCT
TTTCCTTAAGCAAGATTCTTGCCGGGGAAGCCTGAATATAAACGTGTTGAAAATTTTGTC
AATGTTTTTTTGCTGCTATGATGATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGGTTTAACGTTCCTTCCTTGGA
TGTCTGAGCAGTTAATTAACATCATTGGTTCTGTTTACCTTAATTTTGTAATTTCTTCTA
AACAATTACTTGATCTTCCAGGAAGATGACGACAAACCTAAAGTAGAAGATCTTGATGAA
GAAGGTGAGGAAGCAAAGGATGACAAGAAGAAGACAAAGAAAATCAAGGTAAAATGAGAT
GTCCCTTGCTGCACAAGTATTAACTTTGTAATGTTCAATATGGTGATGGTGAACAATCTA
TTCCATGTTTTCTGTTTACCACCAACCTGCTAATAACCCTTATCACCATCCCCTGCCCAT
AACTAACAACCTCTTAACAAACACTCATCACCAGCCTAATCTGTAACGTACTGGATAATT
CTTCACTAGTGTCCACATAATTGTTAAAATCTGTTCGAAGCCACTACTTCTTTTAAACGG
CTGGTACACACATTTTGTTGAGGGGTTTTGGATAATGTTTATGATTAACATAATATTGAA
TTTCAATACAAAATTCTTTGCCATCCAGGAAAAATACACCGAACTTGAAGAGTTGAACAA
AACTAAACCATTGTGGACACGAAACCCTGATGATATCTCCCAAGATGAATATGGCGAGTT
CTATAAAAGTTTATCAAATGATTGGGAAGATCATCTTGCTGTGAAGGTAAGGGCTGGGCA
ATAAAATTTGGTGTTCTATTTCAAAGTGTAAATAGCTGGTTTTAATGTTCTACGGCTGCT
TTCGCTGTCAAACATTGAGCACTAGTTTTTCAAATATATTATCTGATTTTAACTAAATCT
TTTTCACAGCATTTCTCAGTGGAAGGTCAACTAGAGTTCCGAGCCTTGTTGTTCGTACCA
AAGCGTGCTCCATTCGATTTATTCGAGAACCGAAAAATGAAGAATAATATTAAGTTGTAT
GTGAGGAGAGTTTTCATCATGGACAACTGTGAGGATCTTATCCCAGAATACTTGAGTAAG
TTTAGGATTGTGTTTATAGGGTTAGGTGTTTGCTTTTGCTGCTATGATGATGTATTCCAA
CATTCGCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGT
ATATTAAGCCAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGT
TTAAAATATACAATAATTAAATAGGTTATTGGGTGAACTCTGGCTTTAATCCCAGATCCC
ATAGCATGTCAAGCCATGACACCACCCATAAAATAAAAATTAGTAATTTTTTTTATAACA
TTTCTATCCCAACTTTGCAGACTTCGTTAAAGGAGTGGTCGACAGTGAAGATCTTCCCTT
GAACATCTCTCGTGAAACTCTTCAACAATCCAAGATCCTCAAGGTGATCAGGAAGAACAT
CGTGAAGAAGTGCGTGGAGTTGATTGGTGAGATTGCCGAGGACAAAGAGCAATACAAGAA
GTTCTACGAGCAATTCGGGAAGAACCTTAAGCTTGGAATCCACGAAGATTCACAAAACCG
AAAGAAGTTGGCTGGGTTCCTTCAATATCACTCATCACAATCAGGTAAGCTAAAACAAAT
ATGAAATGTGTGTAGTGAAGTTTAATTCAACAATTTCGAAACAGTTGTCTTAAATATGTC
TTTTTTCCCAACACTTTTGGAAAATCTTAAGAACAAATCAAACAGTGATGTTTCTGTAAT
GTTTGAAGTAGTAGGTGTTAAAATAATGCAAAATCTTTAACAAACAAAGGAAGTCTTCAG
TAATAACTATTAGGGGTGTGCTGAAGTTGAAAAAGCTCGGGTTCGCCGAGCGCCGAGCTT
CAACGAAAAGCTCGGCACGAGCCCGAGCATCTATGACGTCATCAAGGAGAAAGGCGTATG
AGAATGCGTTCCTATTAAGCCGAAAAGCGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGTTTCTACGCATGTTCATCTTGGATAATGTAACGATTAT
TTACGTCAGAATAAACCTTTACGATCGTTACATCACAAACGAGATTGTTGGAAAACAATC
GTGTTTTATTCGCTTCCATACGATCTGTAGTTTGTGTATAAATTTTGTTTCTGATGATTA
GTTTAATGCAGGTAAATCGCGATTATGTGAGTTTTAATTGGTGCAAATATAAGAGCGAGG
AGCGACGCTATCAGTAAATTGGAACCAACATAAATTGTAATATGATATTACATAGTATCG
TCCCGGTCGAGCTTGGACAGAAGCCAAAAAACATCGTTTGATGGCGCCGCACGAGAACCA
GAGTTTCATTACGTCATTTTTCACGAGAATAAATTCACAACGATTGCTTCGTTTGTTACG
TGTGGAATGTATGCTACCGCATGCGTCTTCCTTTATTTCATACGCCGGCGCAGAGTGTAA
AAATGTGACGCTGATACACGATGTTTTGATCTCGTGGTTGGTTGGGCTGCCCAATTTGGG
CAGTGGGCACATTCCTCCCGATTGTTATATTATAAAACGTCATAATTGATAGTTACGTTG
CGATAGGACACGTGTCGTAACAATTGAATGAAAAATTGTTCTAATTCCAAGCGAAGGAAT
GTTATATTGAATGCAACGCGTGTGTGTGCGTCTTAGCACTTTCTGGCTGCGTGCGTGTCT
GCGGTGAAGGTGGCTTAGGGGTTGCAAAACCCTGTGGTTGCAAAACCGTGGTTGCAGCAA
TTTATATTATTTCATTATAAAAAAGTTTAAGAGTTTTTGGCTTTTTATTTAAAATGTGAT
ACGAAAACATTGGGCGCTCGTGTAATTCGACACCTGCTATAATTCGATACGGGCAAATTC
GCTGACGTTGCGATTCGTTACTTGCGAGAGAGCAAATTCACAACGAACGAAAAATAATTA
AAGAGAAAGCTACGCTGACTAGTCTCGTTATCTCTTAGTAGCTTCACTTTTTTCATTTTT
AATATTTTTCGCTCTCGCGTGCAACATTATAGCATAAGGCTCGGCGCTCGGCCCAGTTTT
CAGCCGAGCGTCAAAAAAGGAGACGCTCGGGCACGAGCTTTTGAGTTCGGGCTCGGCACA
TCCCTAATAACTATACACCACTTGGGACAATGGTTTTCTTGAAAAATGTGACTGCCAAAT
TTAAACCTGCGCTGTTACCTAGGTGACGAGATGACATCGTTGGAAAATTACGTCACTCGT
ATGAAGGAAAACCAGAAGGATATTTATTATATCACTGGTGAATCAAGAGACCAGGTTTCT
AACTCTGCTTTTGTTGAGAGAGTTACAAAACGTGGGTTCGAAGTCCTTTATATGGTTGAA
CCAATTGATGAATACTGTGTACAACAACTTAAGGTAAGAATTACTACTAATGTGTATTAT
ATTGGTTTACTGTTTTCCTTTATCTTTTAAATGCTGCTATGATGATGTATTCCAACATTC
GCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATT
AAGCCAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGTCAATT
AAATTTATTATTATGTGGTAGTGTAAGAGTATATAAAATGCATTCTATAATAAAAAAGGT
TTTAAAATTTTGATAGTACCAATATCAGCTTGGGTAACATTGTGGAATGCATAGGTTTGT
AAAGGACTCGCCAATATAGCATAGGAATTCTAATACATTCATAACCAGATTGTTGACTAT
TTAAGATGTACGAATAACCTCTTAAATTCAAAAAGTTACCAAGTTTTCATTTTACTCAGG
AATTTGACGGCAAGAACTTGGTTTCGATCACGAAGGAAGGTCTTGAACTTCCCGAAGATG
AAGATGACAAGAAGAAGTTCGAAGAAGCAAAAGCAAAGTTCGAAAATCTTTGCAAAGTCG
TCAAGGAAATTCTTGACAAGAAAGTGGAAAAGGTTAATAAATATATGGAATTCTGCTCTT
AATCTCTGTTTTGAGTGAAAAAGCAAAAGATTTAAATCAGTGTTAAAAATTGTTTTAACA
GGTTGTTATGTGTGTTACAAATAGGTTTTTATAGACCTATATAAACCCATTTAACTTATT
TTTTCTTTATTCATTTTACTAAAACTCGCTTATTTTAAAAGGTTGTTGTTTCGAACCGTC
TTGTCCAATCCCCTTGCTGTATTGTGACATCACAATATGGTTGGTCAGCAAACATGGAGA
GGATCATGAAGGCTCAAGCACTTCGCGATACATCAACCATGGGCTACATGGCAGCGAAGA
AACATTTAGAAATCAACCCAGACCATTCTATTATGGAACAACTCCGACAAAAAGCTGAAG
CTGATAAGAATGACAAGTGTGTACCTTTTTCCTGACTTTTGGCTTTTTTATGTTTAAAAT
ATTTTGTGGAAAATTTGCTGATTGATTCTCATTTTACTACAATTTTTTTTTTAAATTTGC
ACTTATTTTTCTATATTTCTACAATTTTGATTATTAAAACAAAACTAATAAATTTCCAGA
TCTGTGAAAGATCTCGTCATGCTGTTGTACGAAACCTCCCTGCTTGCTTCGGGATTCTCA
TTGGAAGATCCATCAACACACGCAACTCGTATTCATAGAATGATCAAACTTGGTTTGGGT
GAGTGGACTCAATTTCCTGATGCTAGTAGTTGGTTATAGTAAATATACACCGAAAGATAA
AGATTAGAAATAATGCTCTCAATTCCCTGATGCTAGTACAGGTAGACCAGAAAAATATAG
ATTGCACTGGCTCCAACCCCCGTTTACAGAATAGGTTAAAAGTTGTCAGCCATGTAGAAA
CAGCATAATCAATATTCACCCACAGTGCAGCTGAATGAAACAGAACACTGGCATGACTGC
TGTTGCACCAACATGCGACTTGTTTGCTTGTGAATGTGGAAACAGCATTAAAAATCAAAT
TTTAAACTTTCTTTTTTCCAGGCATTGATGAAGTTGATGGTGAAGAGACGACAGCTGCCG
AGGAAATCGATGACATGCCACCATTAGAGGGCGATGGAGATGATGATGCATCGAGAATGG
AAGAAGTTGATTAAACGATACACTCTCAAAGTTTTTCAACAAAATTTGCAAAGTGTCGCT
TCAGGACTTCAAACTACAACTTGCAACTGAAGTGAAAGCCAAACGTCATATAATAGTTCA
ACTTGTAGACAGTAACAAAACTTTAATCCCATTCTTAATGTTTCTTTTCGTTCTTGCTGT
TTCTTGTACACCTGTAGTAATTGGATTGCTTTTTGTAATAATTGTGACCATTAAAAATAA
ATTACATTCAATGTATTGTATTGTAGTGTTGTTTGAAACTTCAGCTTTAAATTTATATTA
GTTTTATTTGTAATGTGTGGTTTCGTAGCACAACGGTTGGGCAAACTTTAGGAAATTGGA
TGCTTATTTTTTCAAGAGCATTGCATGTTGTTTTGGGACTGGTACCATTGTTTTTTTTTA
CCTGGCCAAGCTACGAAATTGCTCGAAACACAGTTGTGTCTTTGATCACAAATTGTCATC
CTTTTTGTAAAAAATGCTCCTAAGCCGCCACCGGCGTATAAAATAGAACACCCGTTTTAT
AGCGACTCTTTGCCAGTGTATCATACTTTAACGCCTAAGCCCTAAACAAATGGCTAATAC
AAAATCTTGCCTGTCAAAATAAGCGCATTGTTTTTTGCGTAAACAGCCATCAGTAATACG
CCAACACAGGCCGACTGTAGAAGAATATTGTTATTCCAATACGCCGACTGCCCCGTTTCC
GTATACTGTAATTTAAAATACCGCTGAAGCTTAATGAAGCTTTATATCGTTTTTATCACC
TCATAGTTAACCAGTTGTATTCGTTTGGTTTCGTAGAATGTCTTTCCTAACTCCTGCGTT
TCTCTGCCTTGTCTGCTCATTCGTATTAACCAGCGCAGAAAGTCGAAAAGTCAGCCTTGG
AATATTTCCTGACGTACCTGGGGTAAGAACTAAGTTCTGAATGCGATAATAATAATTTTT
TTATTTTTCTCTTTAAAACGATAGCGAAGATCAAATTGTATTTAAAAAAGAAATTAACTG
CAAAAAAACAGTCGTTAAAACACTATGGACAAAAGTAACCGACTATAATTTTTTTATTAA
AGTTCAACAGCCACGCTTTTTAACAGATGCTTTTTTCCACATCTTTTTAATCATAGCCTA
CTGTCGTTTTTCTGTTATTAATTCTCTTTTCTTCGCTGTTTCAATAGTATGATGATATTC
TCTATCGTTTATGAAGAGATAGATTAATTAATATTATGTTCTAACCTAGTTTTTA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1171, 1569..1775, 2157..2226, 2752..2882, 2974..3153, 3561..3647, 3988..4125, 4269..4434, 4760..5023, 6622..6812, 7259..7411, 7601..7815, 7979..8097, 8421..8774
1001..1171, 1569..1775, 2157..2226, 2752..2882, 2974..3153, 3561..3647, 3988..4125, 4269..4434, 4760..5023, 6622..6812, 7259..7411, 7601..7815, 7979..8097, 8421..8530
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved