Ciona_intestinalis Locus ENSCING00000007592
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000007592
Ciona_intestinalis
ENSCING00000007592
scaffold_224
SNORD18
3851..3918
6602
TACCACATATGTAACTTGTTTATCATCGTATGGCGTGGCAACGACAGTCGGTATAACAT
GGGTGTTTTGTTTCATACACCTCATGTCTGCCTACAAGTTACCACGTATGCAACTTACTG
AGCAACCATTATTTTGGGATCGGATTTTTTTTATAACTTTTGGCTGACAATTTTGGCAAC
CCACGGGACCGCTGAATAATGATTAAGTTTTTTTTTTCAGTCCTAGAAGACGCAAGTTTG
GAAGAGTTACATGATGCTCTTGATTTTCTATACTCTCAAGAATAGTTAAATACTAATTAG
ACGATCAAATGCGCATAAATGGTTGTCAGTAAAATAAACAATCTCGGTGTACAAGTGTGC
TTGTGTTATATAGCGTGGAATGTGAGTGGTAACTAAGGGGCGAACAAGGGGGAATTTACC
CCTCTACAAACTACAATTTTACCATATACGTATTATACGGCGGAGTAGAAATGGTCCAGT
TTTACCGCCTATTTTTATTTGATTTTTTAAGCTTATTTACACATTTGTTTAATCCAGTGG
TTCCCTAAAGTTGTTTCATATTAAACTTTCAGCCCCCCAAAAAATATCAACAAAAATAAT
TATTAAAATTGGTTGTTTTGCTTTTTTGATAAAATAAAAACAAAATGTTATTTTTACCCC
AATAAAAAACGATTTGTGACGTCACTTAAAACACGCTGCGAACGCAAGTTGGTGCTGTCC
ACGCGAGGCCGCTGTTCAATCTGGGGTTTTGTGAAAATTTTCTTCCTTTTTAGAAACCAG
GATGGTAAGTGACGTCGGATTGTATCTGTAATCATCTTATGCTACGTTTAATATCCACAA
ACAGTTTCTGAACAACTGTTGAAGTCAGTTATGGAAGTTTAGGGTTAAATAGTTAAGTTA
CCGGAAAGTTTGGTGTAAATATTGATATCAGAAGCGAAAGATTTGAACTAGAGATCCGCC
ATTAGACATGGAACATACATTAGTTAACCTCGGTCTAATTCTTTCAGGCGCGTGGACCAA
AGAAGCATCTGAAGCGCTTAAATGCGCCCAAGCATTGGATGTTAGACAAACTGACGGGTG
TTTTCGTAAGTAATATTTTATATTTTTCTAAAACCGAATAATTTTGGGATATACGATATA
AAGTAAAAGACAGAATATATCAAAATAAGATTATAACTCTCCCTTGGTCAAATGTGTATA
TAGATAATTTAAACTGTTGCAACATTAATACAATATATTGAATACCTTTAAAATGTGAAA
CCTGAAGTTTTAAAAAGATTATTTTGTTGTACCTTTTTTAAACTATCTATTAGTAAAGAA
CCCTTACCCCCCCCAGTTGCCCATATATCTGATCTGTAACTCCCGATACTTCACTTTTAC
CTCAAAATAATTTGTTTTAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCGAATAGTGACAGTT
ACTTTGGTTTCTGCCGTTATATGGACACGTTAGGCGGGGGCAACGTTAGTCGTTATAACA
CGGGTGTTCTGTTTCATACACCTCGTGCCTGCTTACAAGTTACCACATATGTAACTTGTT
TATCCTCGTATGACAGGGCAACGACAGTCGGTATAACATGGGTGTTTTGTTTCATACACC
TCATGTCTGCCTACAAGTTACCACGTATGCAACTTACTGAGCAACCATTATTTTGGGACC
GGATTTTTTTTTATAACTTTTGGCTGACAATTTTGGCAAGGGACCGCTGGGTTGTAGAAA
TATGAATAATGATTACGTTTACGTTTTTGTTTCAGTCCTAGAAGACGCAAGTTTGGAAGA
GTTACACGATGCTCTTGATTTTCTATACTCTCAAGAATAGTTAAATACTAATTAGACGAT
CAAATACGCATAAATGGTTGCCAGTAAAATAAACCATCTCGGTACAAGCGTGCTTGTGTT
ATATAGCGTGGAATGTGAGTGGTAACTAAGGGGCGAACAAGGGGGAATTTACCCCTCTAC
AAACTACATTTTACCATATACGTATTAAACGGCGGAGTAGAAATATTACTTTGTGATGGT
CCAGTTTTACCGCCTATTTTTATTTGATTGTTTAAGCTTATATACAAATTTGTTCAATCC
AGTGGTTCCTTAAAGTTGTTTAATATTAAACTTTCAGCCCCCCCCCCCATAAAATATCAA
CAAAATTAAATATTAAAATTGGTCGTTTTGCTTTTTTGACAAAATGAAAACTAGGTTTTT
TTACCCCAATAAAAAACGATTTGTGACGTCACTTAAAACACGCTGCGAACGCAAGTTGGT
GCTGTCCACGCGAGGCCGCTGTTCAATCTGGGGTTTTGTGAAAATTTTCTTCCTTTTTAG
AAACCAGGATGGTGAGTGACGTCGGATTGTATCTGTATTCATCTTATGCTACGTTTAATA
TCCACAAACAGTTTCCGAACAACTGTTGAAGTCAGTTATGGAAGTTTAGGGTTAAATAGT
TAAGTTACCGGAAAGTTTGGTGTAAATATTGATATCAGAAGCGAAAGATTTGAACTAGAG
ATCCGCCATTAGACATGGAACATACATTAGTTAACCTCGGTCTAATTCTTTCAGGCGCGT
GGACCAAAGAAGCATCTGAAGCGCTTAAATGCGCCCAAGCATTGGATGTTAGACAAACTG
ACGGGTGTTTTCGTAAGTAATATTTTATATTTTTCTAAAACCGAATAATTTTGGGATATA
CGATATAAAGTAAAAGACAGAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNCGTAATCGTCTGCATTATGCTCTCACTTACGATGAAACGAAGCGGA
TCCTCATGCAAAGATTGGTGAAGGTTGACGGTAAAGTTCGAACTGACACAACATATCCAG
CTGGATTTATGGGTTAGTTGTAAAGTTTTCTGCAGTATATAAAAGTTCCTGAACAATTCC
TGTCAATCCAATTGTTTAAAATCTGCCGCCAAAATAAGTATTTTAACAACCGAAGTTCTA
AAATTATTCGGACAGCAAAATAGTCTTGCCCTGATTGCTTTATAATTTATTTGAGACCGG
CTCAATACCTTTCACGCATTTTAACAGGTAAATTAATGTTACTAGTTTTTGAAATTATAC
GTTGGGTATCACTGAAACTTAACAGAACTTATTTTCACCGATAAAGTTATACCTAGTGTA
CAATTTTGATAATTGTATTTATGCTGTCTTTCAACAAAAAAAGTTTTAAATTTGCCATTT
TATTTTTAGACGTAATCACCATTGACAAGACAGCTGAGTATTTCCGTCTCATCTACGACG
TGAAAGGACGTTTTGCTGTTCATAGAATTACTTCTGATGAAGCAAAGGTATATGTTTGAC
ACTACCAAGTATTGGTGGTGCCTAACATGGGCACACTGTGTATGAATGACCTAGAATAGC
TTAGGTTATGAATCCGTTTATGAAGTATATAAATTTAGGTACACACAGTAATTGGCAAAC
TCATGGTAATGAATCATTTAAATAAAGCAGTATGGCCTAAAGACACCCCTCATTTTTCAA
AAGTTGGTGCCTATGCTGCCAAGCGTGAGATAAATTCAAAAATATCTGTTGGTAAAAAGT
TTCAATGCCCTGCTAAGATTGCAGAGGTTTAATTTCACTTCTTATTCATGATAAGAAATG
TTGGTTTAAAAACTGAATTGCCAGTGTGGTTGTTTTAGAAGAAATTTTAAGTTAAAACAA
ATATTGTTGTCGGTTAATGATGAGTCAACTTCAGGTCCGTGTTTTTGAAACTAATGATAA
CAACTGAAGTTCTGAATACCGACGTATTGTTATATTTAATACGCTAATGTGAGTGTGGAT
AATGTAACAGACATAATTCAAATCCAGTGAATTGATTGATGTGAAAGATATATAGTTGTC
CAAAATAGCATCATCAGTCTCTTATTTAAATAGAACCACCTAAGTTTAAGAAGTTTTACT
TTGGTTATTCAAATAAATATGTTTAAGTTCCATTTACTGATGGAATAATAATGCAGAAAA
ACTCAATTTGGAAATATTTTAGTACAAGTTGTGCAAGGTGAAGAAGGTTGCCACGGCGCC
CAAGGGAGTCCCGTACCTCGTCACCCACGATGCACGAACCATTCGTTACCCCAACCCCGA
TATTAAGGTACACGATACAGTGGTTGTTGATATCGCGAGTGGAAAGATTACTGGTTTTGT
GCATTTGGACAGCGGTGAGTGATTCAAACATTTCTCTAGTAATGCATAGTCTCTTGTGTG
GTAATTATTAAAAGTTGTATTTTGCAGCTGTAGTGAATATTTTATTATGCGATTAGTTGG
ACTTGATTTTTGTCAGTTATGTTTTTGTAGCACCGGATCCCTATAATATTTTTTAGGTTT
TATGCTTGTTTGGTTTGAAACAAATCACAGTACATTTATTACTGCATGTTTATCTGTAAC
AAACTTATAGCACCCAAGTGTGTTCAAGTCTGTGATCATGGAGGGAAAAATAGCCTTTTG
CATATTTGGTAACTTGTTAGGCATGAACAAGGTGTAATAAACAGTCAAGTCACCATTGGA
ACTATTATGGGAGCTGGCCCACCACGTGGAATATATGATTATATAATAAAACCCATGTAG
GTAACATGTGCATGATCACTGGAGGTCACAACTTGGGGCGAGTAGGAACAGTTATGCATA
GAGAGAGACATCCAGGATCATTTGACATCATCCACGTAAAAGATGCGCTCGGCCACACCT
TTGCTACCCGTCTATCGAATGTTTTCATCATAGGCCAGGTTAAACATACTTGCTAACCAA
ATTTGATAATATAGTTTTAAAAAATTTAATGTTTACCTGGGTTATTGAACAGTTTTATTT
CACTGGCTCCCAGATTTTAGATATGTTCTGCCACAGTAAATACCAAACTTATTGTGAACT
AGATTAAGTAGCATACTGAAGCTTATTTCTTGTATGAAAAATACAGTTTGAGAAGTGATG
GTTAAAATATCTAACAATATTACCTACATTATCAATCTGACAATTCTTCACCCAAGCAAA
CTAATTCACAATATTTTGTTGTCGGTTAATGATGAGTCAACTTCAGGTCCGTGTTTTTGA
AACCAATGATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NCATTCAAATACATATATTTTACCAGCTTGTATAAGAATACTGAGATACAGTTTATTGAA
ATAACTTCATTAACATTTGATGTGGAGGGGTAAAAGTTACACCAGTCGGTAAAGTTACAC
CAGTCTAAATTCGTTCATACTTAACAACTAAACTTACTGCAAGAAATATTAACACAATCA
TATTTTTAACAGGCCAACAAACCAATGGTTTCCCTTCCACGAGGAAAAGGAATCAAACTG
ACGATCGCTGAAGAGAGAGACCGTCGGTTGGCAACAAAGTAAATGCCATTGAATTGAGCA
TTTCAATAAATATTGAAATCGGATTTAGTTTTGTTTCTTTATTGTGTATAGCCACAGATT
GCGTAAGTTCTAAAAGCAGGCAATGCAGCCTATATAGTATGCTGGGAACAGACTTAATTT
TATCCCAGCACAGCATAAAACTCTAGTTTGTATTCTTACTTTGCCAATTGAATCTGAATT
ACGAGATTTTAAAATCAAACCCTGCTTTTTCTAGTTGGAAAAAAATGTCAAGTGTTTACA
CTTATGTAGGCTGTTGGGGATCGGGTTTTATTTCTAGAGAAAGTTTTAAAAGGCAGGGCT
GGCTGTTGTTGAATGTTTATTACAATTTTAATATGACTTTAATTAGTAAGTGAGCTACTC
TGCCAACTGAGTCTTCATATGTTCAGTAGAATAAACACAATAATAGTTAAACTTGTTTCA
ATGTTAATTATTCATAAACATGGAATACACAATAGACAGTATTGGTTTACAACTTTACAG
TTATTGCACCAAATTGCAAAGGTTTTCGGAACAAATCAAAGACACAAAGAAATTACTTAC
AATAATAAACCCAAAATGCACCTAATTTTACCACAAATAAAAACACACGTTATCATAACA
TCATAGGCGTCCTACACAACGGGCAAGTGGATTGATTACTTGTGTCAAACCACTTGTACA
AGCATTCTGCATGGTATTTTTTCTTGCATGTCTTGCATTGTAGTTTTGGTAAGGACTGTG
AGTTGGAGCCGTGCACTACAGAGAAACATATCATGCATTCCTCAAGCCCATGGAGCCTTT
TGTCAACCTTTTCCTTCCACAAATACAAAGCATCCAGTATTTGGCCGTTCTGGTGTCGTA
ATAACATTGTCATCTGCAGAATCCAATATCTCCATTGAGTTGCTTTCACTCCTGCTTTTC
TAACCGTGTTTACTTGTACAGGGCTCAGAGGGTAATTTGTTGGTAGTTGTATTGAAATAA
CAAACTCTGCGTCAGTGATTTGATATGTCGCAACAACTTCTTTCGAAGCTGGACGTGCAA
CAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1078, 2081..2120, 2476..2549, 2936..3011, 3369..3466, 4162..4333, 4740..4897, 5472..5602
1001..1078, 2081..2120, 2476..2549, 2936..3011, 3369..3466, 4162..4333, 4740..4897, 5472..5558
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved