Ciona_intestinalis Locus Q4H3G6_CIOIN
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis Q4H3G6_CIOIN
Ciona_intestinalis
Q4H3G6_CIOIN
9q
SNORD83
2710..2785
12253
ACACTACAAACGCACAGGTTCGCTTTTTTACGTTGGTAAACTTGTTGTAGCTCTGTATT
ATACCTCTAGTTCCCAATGTATAGTATTACTTTATTTTTGCTTCTGTTAATGATAAAACG
TTAAATGTATGTTTCCATGGGCGATTTTTAATTATTTATCACTAGTTATTTTTTGCGTAA
CCTTTTTATATGCTAAATGTTGCAGTTAATGGTTTGAAATGAATGGGTAATTTTAAATTG
TATTTTTTTCTATAAAAATGCTTAATTGTGATCGATGTCCACCACTGATTTATAAATCAC
TTGTAAAAGGTTGTGTTTACTTTGTGTGCAATGCAGATATTTATATATAGACCACTGTTT
CTGCATAATTGATACACTTTATGGTTTTGTAACTGGTTTTAGCTGTATTGACTTATTTTC
TATGTATGCTACATAGTCTGTTAATATATATCATGCCTTTTTACTTTGCACAATTTCTGA
AAATATTGCCATTAGTCTAAGTTGTTAAATATAATATAACCAAACCAGATTTGTTTTGTA
TCTTTCAAAATAATCGTTTTAATTCATAGTAAAGTTATTTTAAATCAAATTTGTGTGGTA
AATTAAATGCAGTTTTCTAAAAAGTTGTTTTCGTAACAATTATGTTGAAATGTCTATTAA
ATTGCTTCTGTCAGCCATATATGTAACCTTTACCTTTATCTGAAGTCTTTTGCGCATAAA
TATAAGTTTATACCAGAAAAAAGTAGACTGTTATGCAAAAAAGCTACTGAATAAGTTTTG
TTGTAACTTGTAACCACAAACGGCTCTTTTTTTGTGAAAATGCCACCGAATTTTTGCTCT
GCGAATTAAAACTAAATGTTACAAACTATCAGTTATATTTACCAGCGGTGATGATAATAC
CTGGACGTGATTTATAATGATGCATGTTGTATTCATACTGTCTGAGCTGGTTTCTTAATG
GTCACATTTTTTAGGGGATTCTATTAGCACCAGATGCTGTAGCAGGTCTGACATAATGTT
TATTGTTTAATCCAAGCAGCTTACAGAAGCCAAGGACAATCACTCCACTAATTCCCCTGG
GCCTATGGGAGACGCCCCTAACAAGAGACCCTTAGAAGATGGTGGTAAGCCATAAACAAT
TTATAAGCTATGATTTGTAACTAGGATAGCATTTTATTTATTTATTTCTCCATGGAGCTT
TATTCAGTAAAATTTCATTTAATACTATAAACCACATAAATCTGTGCATCCACTATGAAC
CATGCCTTTATTCAGTAAAATGTCAGTTATTCCCATAAACCACACAAATATGTGCACCAG
TATTTCTGTCCTGTTCCATGTAAATTCACAGGATGTAAAGTGAGTGTCATGCAGTAGGGA
GTCTGTATTTGGGAGCCTGCTTACATTTTTCACAGAAATGCAAAATACATTCCTGAAAAA
TCGACTTACTCTACATTCTTTTAAATATAAAAACATAGTACAGAAAGAAACCATGTACCA
TATTTTTTCTATTTTGCTTCTCTATTTGTAAACACCTCTATTACTATATTGTTTGCGTTG
ATGAGATTCTTTGGCATTTTTTGAATAAAGCCTTATGCTGATGATGAGTGTTGCCCGATA
CAGGATGTACGCCACGCACTCAGGAAATCTCATATTAGCCTCTCCCACTCTATCATACTA
AACTGCTTTATATTTGCCTGGACGGCTGTTAATAGTGTGAACCTACCATAGGTTAACGGC
AGCTTCTTTGTTCTTTGTCCTTCTGGTTTTGTTGAGTTGTGTATTAAAAGTTTAGCTTTA
ATGTATTATGATGTAATTGTATTTAGAGGTCTTGTGCATTAGGGTTTGAATTTAAACTTT
GTCATTTTTAGAAGAACCTGGCCCAAAGAAACTAGCTACTCCTCAGACGTCTGCTGCAAA
CAGTAAGTCAATTTTATTAGTTAAGATTGGAGATGTGTTTCTGTTAAAATCCAAAGGACA
CTTGTTACGGAGTTATAACAATATTGGCCTGGTAAAAATGGCAAGAATTCCTAGTGGTAT
ATTAATAAAGTTGTATAATTGAAAGATAAGAATATTATTTATTAACAGGTGAACAAATAG
AATTCGATAACCTTGGAATGCAACAAAATCCGTAAGTTATTTGTGTTTGTTCTTACGACC
TCACTTGAGCAAATAAGCTGTGATGAAGTTTAATGACCTTGACATTCCTGATAGTTTTGT
ATTCATACCCTGAGCTTTTACTACACATAAATTAAATGAGCTGTGGAAGAAAATAATGTA
ATAAATTTTTTTTTTTGTTCACAGAGATATAATGTCAGATACGATCAGATTGCCAGATGA
TCTTGTGGGATTAAGTAAGTTTAGCTTTCAGTTTCCTTTTGAGTTTTATCCAATCACTTA
CGAAGTTGCGAACGTGTTAACTTTTTAAGCAAGCGGGCACGAGGTGTATGAATCAGAACA
CCCATGTTATAAGCGACTCTTGGTACCCCACTACGTGAGGATAAGTAAGTTTCATTTACA
TTCAATGTATTCTCTTTCAGTTATTGGTAGGGGAGGGGAAAACATAATGCGAATGCAACG
TGAAACTGGATGTAGGATTCAAATCACGCAAAGTATTCCGGGCACCAAAGAAAGACCATG
CACACTGTCGGGCACTCAAGAACAAATAGAGTAAGACTTTCTCAATTGCTTTTGACAAAT
ACATTACAAAGCCACATGATGCTTTTTTAGATAACACAGTGTTAAACAATGATGACCTTT
TATCTATCACCCATTTACTGATGGCGTATATATGGCTGCTTAATACTTTTAATTATATAA
AATAACCTGTTTTTAATAGTATATGTATTTTCACAGAGTGTGCAGAAATATGTTGAATGA
AATAATCTCCCGTTCACAAGCGGGCACACTGGGCAGCAACTTTAATCTTTCACAAGGTGG
CTTGGGGGGTATGGGGGACGGAGGAATGGAGAAATCTATCGAGATCGCTGTCCCACCCGA
CAAGTGTGGTCTTATAATTGGAAAAGGTGGAGAAACAATTAAAATGGTAAGTTTATGTTT
TTGTACACAGAGAGTAAGAAAAATATCAGAATTTTGCGAAATTTAGTTGTAAAATGTATG
TTTTAAATTTTAATTTGTTTTACTTTAACAGTTGCAGCAAAGTTTGGGGGTTAAGATGTT
GCTGATTCAGGATTCTACTGATAACATCGGTCAGAGCAAACCACTGAGGATAACTGGTCC
ACAACTTAATGTTGATGTATGTGTATGCATGTGAATAGCTTTGACTTAACCGTCTATTAC
TAGGTTTTCTTACTTTTAGTAGGAGATATAAGTATTATACTTTTAGTTTAATTGCTAGAT
CCCACCCCCTCCCCTTGCATGTTGCATGTATTTGTTGAAATAATGTCTAAGTGATGAAAC
TGTAACTTGCCAGTTCTGCTTCTGAAATTTATTGATGCTACAAGTTACATAATACTGACA
GACATTTTACCAACAATAGTGCTTAATGTCCATGTAACCTAATGTTCTATTGCACATGGA
TAATAATGCAAACATATTACTTTACATTTGGCTTAACCAATATGATGGGTTCAAGTTCCA
TGAAATGCTTAAAATCATCTGTCTAAATTTAATGACTTCACGGACAAACTTTCTATTGGC
CAATTCCAGTTTCATTAAAAGTAATTTCCGTAACAGAATGCAGTGAGTGCAGTTCACCAG
ATGATGGCAAACCGTGACCAACAGATTGCTCAGCAGAAGATGGAGAGAGATGGAGGCGGC
GGTGGTGGACAAGGGGGCATGGATGTAAATAAAACCGTACAGGCTTAATTAGAACTCTAT
AAAACTAAACTATGATGTTTTCCTGTGGTTAAGATGGTTTTCCAGCCTGTGAAGAGAACT
TACTATACCGACTGAGTTTTTATTGCTACATATCTATTCTGTTTAAGTTTAATGGATTTA
GTTTCATCATTTCCCTTTATACAGCCCAATATGTTTGGAGATGATGTGAACAAAACCATC
ATCCCAGTTCCCAAAGCTGCCGTTGGAGTAGTGATTGGGAAAGGCGGGGACATGATCAAC
CAAATCCAAAACGTCACTGGAACCAGAGTTCAGTTCAAACCAGGTTAATAACTTAATTCT
GCGAGGTTTTGGACTGTTATAATGAAGCCACATGATGTGTAACAAAACATAGCAACAGCA
TTGATGACCACAAGTCTATCACCCATATAACTGATGGCGCATTTTCCTAATCCATTTGTT
TTGAACTCCTAGTTAATTATTTGTAAACAAAGTTATTTTCTCACAGAGGATCCTACTTTA
CCTGAACGTATGTGCAGCGTGATGGGACCAAAGGAAGGAGTAGATGCTGCTATTAGAAGG
ATCCATGAGATTATACAGAACGTACAAGAACGTGATGGTAAATAATAATGAATATATTTG
TGTAGCTATCATGATGAAACTGTAACATGCCAGTTCTGCTTCTGACTTCACTGATGCAGC
AAGTTACAAATATTCTGATTTACGATTTACCCAAATCCTCACCCATGTATAAATGATGTT
CATAGCCACTGAACCCTTTAAATACACCTCATACTTCTATAGCAGGTAACAGAGGAGGCA
GTGGTGGTGGAGGAGGTGGCAGTGGGGGAGGTCATCCTGGTGGAATGGGAGGATTTGGCC
AGTGGGAAGGACCAAACATGGGTCGGGGTGGTAGAGGCATGGGAATGGCATCTGAGGAAC
ACTTGGTGCCTGCTAATAAAACTGGACTGGTAATTGGAAAAGGTGAGAACTCCATCTTTT
TCCTGTTTTTTTGGAAATTTCGTTGCTTTGTTTTTTTTCTCATTTTTTAATGTTTTTTTT
ACAATGCTTTTTTTCCAGGTGGAGACACCATTAAACAAATCAACATGCAGTCTGGTGCAC
ATGCTGAGATACAGAGAAATCCTCCACCTGGTTCAGATCTTAATTACAAAACTTTCATCA
TCAAAGGTGAGTCTTAACCTTACCCATATCATTACCAATAATAACACACAGGCATATGTT
ACATTAAGGCTGCTTTGTAAGACATGTCACCCCAACTTTTGAAACCTGGGTGACCTGTTT
TAGCGCTTCAGTTTTAAATCAAAACACCTTTACTCTGTTGTCTTTATAAATTATTAGGGC
CAATGTATTCTCCATATTCGATGAAGCTCCCTATGTTTTAAAATACCAAGTGGGAACTGC
ATTTTAGCAATGTCACCCCAGATGTAATCGAAAATTGAAACAAACTTCTCCACCCAGGCA
CTCCTGAACAAATTAAAATGGCGCGCCAGTTGATCCAGGAGAAAGTTGACGCTGGTCCAG
GTGGTTCGAGCAATGGACAGATGCACGGTGGACACATGGGAGGCCAACCACCTATGAGTA
ACTTTGGTCCACCACCACACCAGGTAAATGCTGACTTCTTGTTTTTCATGAAATTCACCA
CTTACACTTATCACTAACATATTTCCGCAGGAAACTAAACCTACATGGCAATTTGCTCAT
TTTTTAGGGCAGTTTCATATTAATTATGTATTTTTTTGAAACACCTCAATTATGTGTCTG
TTTCATTTAACACCTTTTTCTCTTTTGTTGTAAATAACTTTGCAACAATAACATAGCCAC
ATTTTCATATTAATTTATTCAAGTTTTTAACTAAAGATCCTCTTACAGCAGGGAGGGTAT
GGTGGTCTCCCACCAGCAGCAGGATATGGACATCCAAGCCATAACCCATTGCAGGGGCCA
CCTCAGGCTCCCCAAGCACCACAGTCATACCAGCAACCATGGGGTAATCAATTTCAGCAA
TGGAATTCACCAACTGTGTCCGCTCCACAGCAAAACGGTGCTGATCCAAGTAAGTAAATG
GTCACTTTAGTAAATTTTAAAAGTTAGCTATGATGATATCCTGTGGTTAAGATGGTCTTT
CCAGCCAATGAAGACAATTTCTTAATTTACTGAGCTAACTATATTATTTTATACAAAAAT
CCTATCAGAAGCTGGATATTAAAATAACCCTTTATTTCAGCGAAACCTGTGGCTGATTCT
AGCAATGCTGCAGCTTGGCAGACGTACCTTCAAATGTATGGAGCACAAGCACAAGCATAC
CAACAACCTGCTGCTGCTGCTGCAGGTAAATGACATTCATTTGCATCACAATGTTAATAA
CTTAACCAATGATGAAACCGTAACTTGCCAGTTCTGCTTCTGAACACATTGATGTTACAC
GTTACAAATTTCTGACACTGTTGTTATAGTTCTTGTGCTTTCAGCAAATTCTTGTCACAT
ATAATAACACTCAATAATCCACAGTTTCCGCTGCACCTGCTTCACAACCAGATTATTCCA
AACAATGGGATGAATACTTGAAACAGAATGGTAAGCACTAATTATATCTGTTGTTTCTGT
GTATTATAAGCGTGGAAGGATCTTCTAGCCATTGTTACTTTTTCTGCTGCGCAAACTGTG
TCCTGCAACAGTGTCTCTGTCTTTAGCACAGTGGATACAAGTTGCAAGGCTTGACACTGC
TATCGCTGTCGGCATATGTGTCTTTGGCAAATCACTTAACATCAAATTAGATGATGTCGT
ATTGATGACAAACGAAACAGCATTTAACATCACCAAACAAACATTTTCCAGTAGATATGT
TTCACATTTGTAATGTCTACAGTTCACTTCGTATAAAGTGAAAGTGTCTACACACATCTT
ATCAATTGCATATTTCAGCTGCGGCAGTTGCAGAACAACGTCAACAACTTACTTTGGCCG
CTCCAGCCGCTGCTGCTGCCATTCAACAACAACAGGTAGCTGCTCCAGCTGCTGCTGCAC
CGGCTGCCTCTGCTGCTGTTCAACCAGCTACCACTCAGGTAAATTACCCCTCGTATGTGG
CATGTATTTGTTAAAATAATGTCTAAGTGATGAAACTGTAACTTGCCAGTTCTGCTTCTG
AATTTTCTTGATGCTACAAGTTACTTAATACTGACAGACTTCCATTTACACTAATCCCTA
TTTACCATTAACCCACCAAATACAAAATATCAGCTCTGATTTTTCTTAACAGGCGGCTGA
CTATTCTGCAGCATGGGCCGAGTATTACAGACAATACTACGCCATGCACGGACAAGCAGG
TTATGCGGCTGCTGCTGCCGCTGCTGGACAAGCCCCAGCCCCAACGTAAACATTTCCAGT
ATCACTGATCACCATTGTAAATATCCAAGGTAAGAGATTATACCAGCTGTCATTATTTTA
TTGGGAAAAGTTTCATTTCGTTTTCAATCCCTACATGCTTGTACTCTCAGTCAGTTTGAT
ATTCGTAACGAGTCAATGAATTGTTGCCAGTGCATTCTGCTTTGTAACTATTTCTGTATT
TGGAGTTTATGACAGATGTTGATATTAAGTGTCCGAAATACATGATTTATTCAATGTTTA
AGTGTATATAAATTGATATTTATATTGTTTATTTAACAATTCATAAAGTGCCTATAAATT
GGTGTAAATATTGTTTATTTAACAACAAGTGTCTGTAAATTGGTATTTAAATGCAGTGTA
AAGTTATATAATCTTTTACAAGTATTCGTATTTATCAAACCATTCACCGAATAATTTTCA
TTGGTAATATTTATCTGCCTTATCAACTCGTATGCCCTAAGTATGTCTCTGTTCTCACCC
ATTTATATAACATGTAGTATTGTAAGTGTAATGTATATTATACTGGTTTAAAAAAGATGT
TGGTTGTTATACAAAGTGGGTACAGCAAAAACTTTTATCTGTTATAGTAATATATATTAT
ATAATAATGTAAATCACCAAAAAAGTAACACTTTGTATAATAAGCATCATGTTGAATGTA
AGTTGTAAATATATTAATATACTGCCTCTGTTGATTTGTAATAATTTGTTAACAGTAATG
ATGTTGTAATTCTCATTTAATGATATCCCGATGATTAATTAACGTTCATGTACAATTAGT
ACAAAGTATCTTGTGTAGTGTTTTGATTTCAAATTGTCAGCGATAAACTTGTTATTTCGC
GCAATTCAAATCTTCTTTTACTATGGTGGAAACTTAAACATTTGCTGGATTTGTATATTG
TGTTCCTGTTTACCGATGTGTCAATCTTACTTCGTCGTTGCTTCTATGTTGAACAATGTT
GTGTCGCGTTTAAACTTGATCTAACTTGTCTTTTTGTATGCCCAGATGCAGGCCCAGAAG
ATCCCTCCTATGTACATAGTCTCTACTTTTGCACATAACTTCTTCCCGTCCGATGCTTTT
TCACATCCCTTGTAGAGCAGCAATGTTTTACCCCCACACGGTGGCGTGCCAACCCAACCA
TCTCATACTCCTTGCAGCACAATCGTGCCAAACCATAGCAATCCCTAGGTGGTTGCATTC
TCCATTTCAGAGCACCCGTGCCCGGTGCATAAGCCGCTAGCTTTGGCAAAGACAATAGAC
ATTAATTTGCATGCTTTGCGCAATCTTAAGCGCAACCATGGGTTCCGCATCTTATGTGTG
GAGGGTTCAGCCCAAACCTTGCCATACAAAGTTGATGGTCCCTTACGATGTTACTAGCAA
CAAACTTTTTATAGTTGTTGACCACTGCACACCTAGGGTTGTTGATATGTTAGCAATAAC
ACAGAGTGCACAACAAACATACGCAAATTATCTTAAGTTCACACCATGTACATTGATGCA
AGTAACAGATATCCATTGTACAGTTGTTTGTGTTTTTCGGAATATGTGTGTACGTGTGTT
TTGAGTGTTAAAGTATTGTCATCGCCTTGAAATCGGTTAAGAGTATTTTACCCCTAGGTG
CAAAAGTAGATTGCGTTTATGTGCGTCGCCCTCTCTGCGAAAACCACTGTCAAATCGAAT
CTCATTTCAGCGGCTTTAGTTCACATTTTAAACTCGTCGTCGTCGTAGCGTTAACTTCAT
TCAAATCGACCAATTAAATTTTTTCTTTCATAACGATGCTTTTTATTGCTATATCCTCAT
TCAGTTTATCGCAACCGTTTCATTGCAATTCTACCCGATGCTTTACTTCGCCCATGTTTT
TAGCAGCAGATGCACTTGAGCAACTAATTGTAATACGAACCCTTGAAGCGATTTCTTGTC
AATGTTTTTTGAAGGTGTGAGACAAAAATGTTAAGTATTTTGTATGAACTGCGCTGCTAC
TTCTGAATAATTAAACGCACATATTTTATCATGTTGAACCCACACGTTTTTGCTTATGGT
TTTGAGAGCGACGTACCTGTAACATACATTCGAAAATGTCTTGTGTTTATCTGTAATGTA
TATATTACATATTTACTTTTATCATAAATCTAACCTAAATCAATATTTTTGATTTCTAAC
AATATTTTCAGTTAGTGGTTTGCCCTAAACTTGCTTATAACGACATGTCTTATTGTGTGT
GCCTTGTGTGCTTTGTCCTTGTTTGCATTAGATCTGATGATATCGTCTACAACTGAAGTT
ACATCCCCATAACTTTGTGGTGCGCCCAGCATTGGGCTTTGTACATATTGTGGTGAACTT
TCATTCCTTCAACTCGGCAGGTATCCTGTCAACACTTCGTAAAACTAACTCGCTTAATTT
CTAATTTAAAATGTTAATATTAAGTTACTTGCACCTGTGTTAACCACCTGTTGCCCCAAC
CCTTCTGCGTAATCACACATCGGCAGTTCACATCCAGCTCAAACCGGTTCTCCCAATTAG
AGAATTCAAAAAAATTGAAAAGGCTCTTGCTGGCAGTCTTATATGATCCAGTGCTTCTAC
CTTTGCGTGCGTTTTACAAGTTAGCATCGCCGCCGCGTTTTTATTTTGACCTTCCTTTTT
TATTAACTGACAAACATTCATCAGTAGTTTCGATATTTTTTAACAAATTGTCGATTACCC
GCATTTTGTAGTTGCATTAAGTTATCGGTGTTTCAGTTCATAGCGCCAATTTTCAATCAT
CGTAAACTGTGTTCAGTTGTGTCGCAAAGTTATGCAAGCGAGTCACCTCCAAACGTTAAT
TTGTCGTAAACTTTTCTACCCGCCATGAATAATTCATTGATGATCCTTGTTGTGTTTCTT
AAACTTCCGTTTTACTTAGCGCCTAATGTACACATGATTGACGCGGATTAAGTTTTTTTT
CTTTTCTTTGGTGGTCTTGTATTATCAGCAATGTGCCCTGTTTTTGCGCGTGTGTTTTGT
TAAATTGATTCGAATTTGACGTTCGCCGCAGTTTTAACACGCATATCACTGTGACCGCTT
CTGAAATTGATCCACCTTTAACTTTTTCGCTCGGTAATGTTGCTGTTATTCCGCCGGTTT
TAGCCATTCGTTCTCACCGTTAAACGTGCGCAACTGTAATTTATTCCTCCAATGTCACTT
TAAACTAACGTCGCGATGTATTGTGCAACTGCCAGCGCCAGCCTTCACATGGAACCGGTT
TGAGCTGGTGTAAACTGCTGCCACGTTTTACAATTCACTTCAGCTTAGTGTTGTATTAGC
CATTCTCAACTGTACTCATAGTTGCCAGTACTATTTGATTCAAGCACTACTAAATAAATG
TGCCGGCTTGCGTTTAACCTGTTAACTCATTCATTTTGTGTACTTCCTAATCAATAGCAT
GCTTGTGTATCAAACCTTATCACCATGAGTGTTCATGTAGCTGACTGCCGCTCAATCACA
GAAACTGATGTTAGTGTTAATATAGTCATCTGTTGGTACTATTCACTGGTTATTTCATTT
CTGTACAAATTAAATGGAAAGCGCGTTTAATTTTAAATTAATGCTAATATTTCAAATGCT
TATTAGTGTGTGCGTGTTTGTATCCGTTTCTTCCTAATTTTGTGGCTCTATAGTTACCTT
TCAATAGTTTTGTGTCCTTGTACAAATACACCTGCTACATGCTATCTTGTGTATGTTTGG
TCCTAGAGAGAAGATGTTTTTAATAAGTCAGTGATTTAGTGTTGGTAATGTAGTATGTAG
TAGTTTTAAAGATTGGAATTCTGCTTAAATTATTTACAACTAAAAGGTGAGTAGCTTTTT
GTCTGTTTAAATTTGGTGGAATATTTATTACAAGATACTTTACAGTTTCAGGACTTCCAT
GGTTGAGGAAATATCCCTCCGCATCAAAATTGTGGAGAAAAACCATCTGGGACACAGATC
CGTAAACTGGCCAACTGTTTTTTGCTCCGTTGCTTGTGTTTGTATGTTTTATGTAGATGT
AATAAAATCACGCAATCGTAGAGTCGATGTAACATGTTTGTCCTTTCGCTGGGGTAATTA
CAGTCGTTCTAGCACCGGTGCTCTGTGACATATGTAACTTTTGTAGGTAACTATCTCTTG
AAGATTTTTTGTAATAGTGACTGAGACTGGGAAAACTAAATTTGTTCTCAGACTGGCACT
GCAAAAATACTGCTTACACGAAAGGTTAACAAGTAATTTATTTGACATGATGGTTGCATA
TTAAATTATTTCGACTATTACATTAAAGACATGATAAAAGTGAGCAGGATAAAAGTTGCA
TATGAATTAATTATAACAATTGAAGAAATGGTTAATACTAAGTAAGTACAACACAGTTAG
AGAACCAAATATTTATATTGTTTGATGTTTCTTATTGGCTGATAATCTAAAAAAGAAGTT
TATTAATTGATGCATGTAATAAGATAATTTTACTTAGCATTTTTTTAAACTGCCGATAGT
GTTTTTACCTGTGCAAGTGCAGAGCTTTCTTCAGTGATATCTCCAATAACACTAAAGTGA
TCAACTCCATTTAAAAACTTGTGTGTTACTTTGACACCACTGGATTTAAGCTCCTGAACA
GAAGTTTGTTGTATAGATCAGAAAAGTTCTTAGAAAAGTGAAATACAATACTGAGCAAAG
CACTTGTGAGTTCTTAGTAATGATTTGTACACAGCTGTGGTGTATATACTGTCAACCAAG
TTTATCTACATTATGTTACGTATGTATAACCCTATCTAACCTCATTGGCAGTGACAGTTG
TTACATCACAGACGTTAACTGTCATACACTGTAGCTAGCTTTACCACATGAGAATTTGGG
GGAGTTTTTGCCTTTAGGCTGGCAATTTGGACCACTGGGTTGCAGCAACTAATGTTAAGG
GTCTTGCCCAAAGACATATGGTAATAATGGTTAGCGTTATATCTGTATCCCATCCTTAAT
CCTGTGCCAAATAAATGATAAGAATCATAAATGTTTCTTAAGCTATAAAACTGTTAGTGG
ATTTAGATTTATGA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1123, 1871..1921, 2088..2130, 2304..2353, 2540..2669, 2856..3045, 3151..3255, 3696..3803, 3984..4122, 4306..4416, 4602..4781, 4878..4985, 5277..5422, 5688..5868, 6040..6144, 6324..6389, 6738..6877, 7072..7228, 11085..11253
1084..1123, 1871..1921, 2088..2130, 2304..2353, 2540..2669, 2856..3045, 3151..3255, 3696..3803, 3984..4122, 4306..4416, 4602..4781, 4878..4985, 5277..5422, 5688..5868, 6040..6144, 6324..6389, 6738..6877, 7072..7185
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved