Ciona_intestinalis Locus ENSCING00000014892
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000014892
Ciona_intestinalis
ENSCING00000014892
6q
snoZ195, snoZ195, snoZ195
1826..1913, 2763..2850, 3421..3508
5494
GCATCATTGTCTCAAAACAAAATCCAGCAAAGTGAAATTTTTATTTAACAAAGAAGCAT
TTTAGATATTTTAGCCTTATTACTTTTACCGAAGTCAGCATATTTTTACAGCATTTTATA
CCAGTATTATTGCATTTTCAACATATTTATTTACCAAACGTGTAGCAAACTCTGTATTGC
GAGTATTTTTATGCAGTTTAGTTACATTTTTAGACAAAAACAACGCCTAACTTATTTCCT
TTTCGTAGAAAATTACTTTTTCTAATTTCTCCCTTCATATTTTCCTCGCTGTATAAGCGT
TAAACCATACAGTTCCCAGCAAAGGCTGCTATTTATATTACTGTTTTATACCGTTGCAAT
TTTATGCAGTATTATTTCAAATTTTTACATACTGCCTTTCGTGAATTTTAGACAATAAAA
CATTCCAGTTATTTTAAAACGCGTATCGGTTGTTGTGTAGAATGTATGTCATTTGTTTCT
CCCGCTCGGCAATTTATATAACAAGGGTGTTTTGTTTCATACACCTTAGTGACCACTGGT
TTGAAGCAATTACCGTTATAGCAGACAACCACGAAACACGACCACAAAGATTGCAGAATC
GATCTTCGAACCTTATGTCTTCTGATTGGGATGTATGTACGTTTATATTAGACAAACTTA
AGCAAAAAATTGCATGTAACATCGGTTAAACAAAGAACGCGAAATGTAACTTATTTATCC
TCGCATGGGCGGTGCAGCCAGGGGTGTTATAACACGAGTGTTCTGTTTCATACACCTCGT
GCCCGCCTACGCGTTATCACATATGTAACTTTGTATATAAAACAAGACAAATAACGAGCG
TGACTATTGTTTGTTATAAAGTCTATGATGTAAGTGAACAGCAGTAAAATCTTTTCTTCT
GTCTACTCCCTTTTACATCAGTCCCCAAATAATATCTATTTATTACGTCACGGCCGAATT
TCCTCCTGTTCTGATTGGTTGTAATTTTATGGCAATATGACGTCATTTTGACTATGCGTG
GTCTCGTTCTTTTTTCAGCGAAATGGCCGACGGCTTCGTGAAGGTAATTTCTTGGTTTGT
TTTTACTAATTTACGATTATTTAGACAAATTTATTGCTGTTAGTAAGGGTTAAACGATGC
AGTATCAACACAAGCTTATATTTAAGCCCGTATAAGTTAATTTACTGCCGTAAAAGGACT
TCGTGTGTCGAAGTTTTTCTAAATTTAGTCCGATTTTTCATGTACTTTTTGGACTGTTTT
TTTATTATTGTTCTTGCCGATGATGCTTTCCTACATTGATTGATGCTTCACGCACTGATT
TCAAATTTAATACCTGAGGCAAGAACAATTAGAAATAATTATTTATGAAACGAATTGGAG
CTGGCCAAAGTTACAAATCTTCAAATATATTCGTAAAAAATAGACACTCCTATTTCTTAC
TATATTAATACATGTTAAAATCAATTGACTCCAGTCATACAAATTACACTAACTACTTAA
CATATTGCTAATTTTGGTTTCTTATTTTTTGCTATTTTCTGCTTGGAAAATTGGTTTTGT
ATTTCCAAAGTGACCCCATTATATATATGCATATCCTTGATTATGTTACCTGTATTCCCA
GGTGCGGATAATAGACGCCAAGGACCACCTCTTGGGTCGTCTGGCAGCATTGATCGCTAA
GAATTTATTAAATGGTAAGAGTTAATGGTTGGTAGTAGTAAAAAGTTTACCAAGTATCAT
AAACTAACCAGAAAAAAAAAAACTTGGAGAAATTCTAAGCGAATTTTCAATGTGGTATGT
CTAACATATTGCGCTAAGAAATTATAGTGGCCAATGATGATGAATATATACCCAAATTTT
CGAATTTCTTTTAAGAAATTCTGAGATAACAACATGCACTACCATCTGAGGCACAAACTA
TAATTCTATTCTGTATTGGTAAGGTTCTCTAGCAAGGCATGCCATGGAACCTGAAGATTA
GACCAAATTTAGCCATTCCCCCAAGTTTATGTGGGTGTGGTCTTTGGTAAAACATATGTT
GTGGGTCATTGAATTTACGCCAGAGTTATCCCATTCCCCCTTTTCTGTTTGGGTGAGGTC
CTGTGGCAACGCACGCAATGAAATTAAAATTTTTGCCAGAGTAGGCCAATTACCAAAAAC
CCATACTAATAATGAATTAACCTCACTAGATAATAAAGCCTGTAACTTCACCCAGGTCTA
TATGCTGGTAAGATTGTACAGCAATAAACTCCACCCAAAGTTTAGACCAGAAATGGCCTT
TACGTATTAAAATAAATCAGTCAAATAAATACTACAAATACATTAAACCAAATTCAAATC
TTTCAGGCCAGAAAATAGTTGTTGTGCGATGTGAGAGCATTCTTATATCTGGTAACTTCT
ACCGTAACAAGCTCAAGTATCTTGATTTTCTTCGCAAGAGGATAAGAACCAACCCAAAGA
GAGGTCCCTTCCATTTCAGGTTAGCTAATACACTAATCATAAGTAAACGGACGTCATGTT
TTTGAATTTTCAATAAATTCTGTAGTGACAAAACACAACAATGATAGTTGTTAAATAGTT
AAACTCGTTGATTAATGTGTTGAATGCAGTATAATTTGGCTCTGCTGCTTTGTATAGGCA
CCTAACAGCAGCTATTATATGGTGTAAAACTGTGATGTTAAAGCATGTGATATCACCACT
GTTTCATAAACTTGGTAACTCATATTTGTCTTCACCTTAAAATATTTAAAAAATTAAAAC
ATTTGTGTCAGTGATGATGTGTTTAACCACAAACCAATCGAATTCTCCTCGGAGGTCATG
TGACCAACCATGCACTACCATCTGAGACGCAATGTTTTAAATAAAAACAAACAAATAAGT
AATTCGCCCACCACTTTATTACCATTTTCTTGCATTAATAAATACAACTTTTAGAAATTA
ACGTTGTTAATAAATTTTTCCGAATGTGTGAACCGGAAAATATTTGAGAACTATTGTTAT
ACTGTAGACCTTTATTTTTAGAGCTCCTTCCAAGATCCTATGGAGAACTGTACGTGGTAT
GTTACCTCATAAACTCAAAAGAGGTGCAGAAGCTCTTGATAGGTTGAAGGTATTTGAAGG
GGTGCCTCCACCTTATGATAAGGTAACTAATGTCCCAATATCATGTAACTGTTGATACAT
ATATGAACATAATTACTAGTATAGAACTATTGTGTACAAAATTATGTTTCTATTTCAAGT
GGTTCAGGTTACACAATGTGGCTGCCCTGGTGTAAAAGTCCAAAATTTAGGTCGTACTTT
GCCCCCTGCCACAAAACCCTGAAAGGATAATGGACCAACTCTGTCTTAAATTTTACCGAC
TTGAAATTATGCTAGTCTAATCTGCAATGTCATTTTTTTAACTTTAAAACTTGAGAAATA
GTTGGCCAATGATGATGACACATACCCAAATTTTCGAATTTCCTTCAAGAAATTTTGAGA
TAACAACATGCACTACCATCTGAGGCAACTAAATTTTCTCAAGGACTAAAACCTATCTTA
AGATAAAACTTTGGTGGAAAATGGAATCTTTATTTAAAAATTAAAAATTGGCACCTAGAG
TTCATGGCTCTGGTCTTGCTGCTGCTTTTATTTGTTTGATTTATTAAAGTTTGCATCAAC
CAGTTTTTATTCTTTGAAGTGTCCTTGTTAAGGACCTGGGATTTAGGTCAGACTTGGCCC
ATCAACCAGTTAAATGTTAAACTGTTTTTGTTTTTACAGAAAAAGCGAATGGTTGTTCCA
TCATGCATGAAAGTTGTCAAGCTCAAGCCAAAGAGAAAGTTTGCTCTCTTGTCTCGACTC
TCAAGTGAAGTTGGCTGGAAATACAACGACGTCATTCAAGCGCTAGAAGAGAAAAGAAAG
GCAAAGTCCAAGCTATACTGGGATAAAAAGCAATCCAACTTGGTATGAAAAAAATAGTTC
TGTAACAAATTTAGTTCCTAAAGAGCTACTACAGTTTCTGTAAGAACTAAATTTGTTACT
AATATTGTCTGTAGGAACTAAATTTGTTACTAATATGTAACAAATTTAGTTCCTACAGAG
CTACTACAGTTCTGTGGGAACTAAATTTGTTGTTAATTTAATATAACATGGCCATAATTT
ATTTAAATTTTGACCATGATAACTAAGGAAAATTAATTATATACACTCAAAATGATGTCA
TTATACCGAAAAATAAATTGATTTAAACATATACAAGAGTAAAATTTTAAAAATATAGGA
TTTATTAAAATCTTTGTAAATTGTTAAGAAAGTTAAATAAGTTTTTATGTACTTTGTGCA
TTTGGAATGAATTACCATGTAAAGTTGATTCTTTCTTTTTTCAGAAAATCCGTAAAGAAG
CAATCGCTAACGTTCAAGACCAGATTGCTGATTTGGACAAACAAATACAGGATATGGGTT
GCTATGCTGTATGATTTGTTTCAATAAAATAACAACCAACAAAATATGGAGTGTCTTTTT
GTCTCTGGTAGACTTGTTATTCTGTTGAAAGACTGTTAAATGCATAATTGCATTTAATTA
AAAGAAGCGTAGCCGCTACACCTTTTGTGTTCAGTGACAAGACTAGTAGCCAACTTGGTG
TGTAACTTCTGCGTTGAGTTGTTAGAATCTCAGAGCATACATGTTGTTTTGCACACCCCA
TGCTCGCTGTCAAAGTTATTTTATAGCTGTCTTTATATACCAGACAAATACACTGTTTCC
GTTCACCTCGTGTCCACTGGCGAGTTATTTTATGGGTGTGTCTTACGACGTGCTAGACAG
AAAAGTTGTATTCCTATAACTCATGCTCGCTTTTTAGGTATAGTATGAAGCCTCATTATA
TAACAGTTACAAGTGAGGTTTAAATACACCGTATGCTCTGTGCCGAGCTATACCATGTGT
GACTTCTAATGCACCAAGTACACATGATCCTTAAATATAAATGTTGTATAAATTATGAAG
CTGTATAGAATTTTAGCTGTCTGTGTAGGGCACAGGGTGTTAGAATTTATGAAATAAAAG
AAGTGAATTAGTTGGTGGATAAAAAAACATTGTTAATCTAATGTAAAAAGTATATTATTA
TGCCATAATCGTTGATATGAGAGCAGTATTTCAGTCAAGCGCTGTAACAAGATTACAAAA
TCCATTTCACCTGAAATGCATGATGACATCTCTAGAAATTTCTGCCGATGCTAGTGATTC
CCATGTCTTTACAAAGTACATTTCAAAAAGAGTTAATTTCATTGTTCATGAATAATATTG
CATTTTATAAGAGCATTAAATAATATTATAGTGTTTTTAATATGATTCACGCTGAAATTT
TGGTTTAAACACTTTATAATTTACGTGTAAAGGAAAAAATCGAAAATAGTTGTGTAACAC
TGGTGTGTACTTTTTCTAGAACACACGTGGTTTTTGATTTTACCCTCACGTGTTTTATTT
TACATTGCCCATGAAACAAGTTGCGTGTCGCGTGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1062, 1621..1693, 2346..2478, 3021..3141, 3759..3940, 4364..4494
1042..1062, 1621..1693, 2346..2478, 3021..3141, 3759..3940, 4364..4463
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved