Ciona_intestinalis Locus ENSCING00000012576
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000012576
Ciona_intestinalis
ENSCING00000012576
3q
SNORD14, SNORD14
1277..1417, 4390..4530
18303
GGTTAAGGTCCTCAATCGCTATGGTGCCACGTTTATGGTACATTAGATACTCAATCACG
CATTCTGTTTATTACAATGTACATAAGTGTTGCATATTCATTCATATTTTTCATTGTTTT
AAAAGTGAATTCACGATTAACAAATATTAGACTTTTTTACTACTTCGTTATATACTAATA
TCGTGGACATTGTAATAATAAAACAACCGCCAGAATACTTCTGCTTTGTGGTTGTTTCTC
CATGAAAATTGACCTTAATTCCCCCTGATTAGTAAAATTAAGGGCACAGCAGTGGATGAT
GCCAGTTACAGTACAGAAACAGATGTTGTACAAATGTTCTTGACAAATCACACTTAAATA
AAACACGCCCTTATCTTAAATTTTATGTTGTAAAATTAATACTTATCTGACCAGTGTGTT
AAAAACAGCAAGACTGCTTCTGTTAGTGTAAAGTCGAGCAGATGTTTTGACACGACGAAC
GCATTTCCCGAAGGTTCTGTGTGAAAAGCCATGCGTCACGTGAAGCGGGACAGCCCCGAA
ACCGTTGGTCGCGAAGCTTCCAGAACAAAATTAGTATCTTGCGACTTCCGCAAATAGTTC
CTAATGTTATCTTTAAAAATATAAAATTAAACCAATAAAAAATAGGTAACATATATGTAA
ATGGTATAATATTAGACATGAGTAAAATTAGTGCCAAGAGAAATTTAACGCTTCTTTGTT
TCATAAAAAAGTGATAGTAATTGAGCGCGGATGAATACAGAACTTTCCGGCTTATCGTGT
GAGAAAAAAAAGAGAGGGAACTTAAAACGAGAACACGTGCATTCATTCAAACGTGGTTCG
ACGTTGGAGAGTGTGGTTGACATTTTACGTTGGGCAGTCAGTTTAAATTTAAAGTCAGCC
AATTTACGTTAATATGTTGCCTAGTTCTTATTATACTTAACTAAGTTGGCTGTTTATATC
TCAGATTTGCGTACCTCTTTAGGTTTTTCGTTTAATTCAAATTTAGTCAATTTAACACCA
AAAGAATGGAACAGGAACACGAAGTTCAAGAGGACTCTGGGGAAGTCTTCGCTTTCCAGG
CAGAGATTGCACAGTTGATGAGCTTGATCATCAACACTTTCTACAGCAACAAAGAAATCT
TTCTTCGAGAATTGATTTCTAATGCATCAGATGTAAGTGAACTAAGGCTTTTAATTTATT
TGGGGAGGGTATCAATTGTACAATAAGTCTAGCTAATGTTACTGGTTAATGAAAAAGATT
GTTTCATTTACAAAATGCTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGAC
CGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCCAACTCTCATTA
ATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGTCTAATAGTTACATAATCATTT
GAAAATCTGTGATCTTGTTTTAGGTAACCTTAAATGGTCCTTTATATTTGGTGCAGGTCT
GCTATGTCAACTACATCCTAGCGGACCTCCACTTTTGAAACGCCGAACCTAATATTTGTT
TTCTATATAGGCCTTGGACAAGATCCGATATGAAAGCTTGACAGATCCCAGCAAACTTGA
CAGTGGCAAGGAATTGAAAATTGAAATTATCCCAAACAAAGATGATTACACCCTTACACT
TATTGACACTGGTGTGGGAATGACAAAATCTGACCTAATTAACAATCTTGGTACAATCGC
AAAATCTGGTACCAAAGCATTTATGGAGGCTCTTCAGGTGTGTTTTAACAAACATTGTAA
CCGAAAACTAACTTAGTTTCATTTACTTAAAACCTAGAAATATCATTTTTGGAGCCAGAG
TCTTAAATTATATTTGAATAAAAATACCTTGTTTTGGCATTCTGGTGCTAAAACTACATT
TTCCAAATAAATATACCATTTTTTGCAGTCTGGAGCTGACATTTCCANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATTCACACACGGAGTCTTTTTT
TAATTGAATTACCTGAGATTTTTAACAATTCCCTCTCTTTCTTCAGGAAGATCAACGGGA
GTACTTGGAGGAGAAGAAGATCAAGGACATCGTCAAGAAGCACAGTCAGTTCATCGGGTA
TCCCATCTCACTTCATGTGGAGAAAGAGAGAGAAAAGGAAATCAGTGATGATGAGGAAGA
TGAAGAAGAGAAAAAAGAAGAAACTGCCGAAACCGAAGAACAAAAGGTATATTTTATAGC
AACATTTCTGCTTTTCCTTAATGGAATGCCAAAGCGTCAGTTCGCAAGATTCTTGCCGGG
GAAGCCTGAATATACACGTGTTGAAAATTTTGTCAATGTTTTTTGCTGCTTTGATGATGT
ATTCCAACATTCGCAGTTTCCACCAGACCGAGATAAACATTAATATACAGGAAGGTAAAA
CTTGCTGTATATTAAGCTAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTC
TGAGCAGTCAATTAAATTTATTATTATGTGGTAGTGTAAGAGTATATAAAATGCATTCTT
TAATAAAAAGGGTTTTAAAATTTTGATAGTACCAATATCAGCTTGGGTAACATTGTGGAA
TGCATAGGTTTGTAAAGACCACCAGTATAGCATAGGAATCCTAATACATTCAGCTCTTTG
TTGACTATTTAAGATATACCAATAACCTCTTAAATTCAAAAGTTACCAAGTTTTAATTTT
ACTCAGGAATTCGATGGCAAGAACTTGGTTTCGATCACAAAGGAAGGTCTTGAACTTCCT
GAAGATGAAGATGACAAGAAGAAGTTCGAAGAAGCAAAGGCAAAGTTCGAAAATCTTTGC
AAAGTCGTCAAGGAAATTCTTGACAAGAAAGTGGAAAAGGTTAATAAATATATAGAATTC
TACTCTTAATCTCTGTTTTGAGTGAAAAAGCACAAAAGATTTAAATCAGTGTTAAAAATT
GTTTTAACAGGTTGTTATGTGTGTTAAAATAGGTTTTGCAGACCTATAAACCCATTTAAC
TTTTTTTTCCTTTAGTTATTTTACTAAAACTCGCTTATTTTAAAAGGTTGTTGTTTCGAA
CCGTCTTGTCCAATCCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNTTTACCTTAATTTTGTAATTTCTTCTAAACAATTACTTGATCTTCCAGGAAG
ATGACGACAAACCTAAAGTAGAAGATCTTGATGAAGAAGGTGAGGAAGCAAAGGATGACA
AGAAGAAGACAAAGAAAATCAAGGTAAAATGAGATGTCCCTTGCTGCACAAGTATTAACT
TTGTAATGTTCAATATGGTGATGGTGAACAATCTATTCCATGTTTTCTGTTTACCACCAA
CCTGCTAATAACCCTTATCACCATCCCCTGCCCATAACTAACAACCTCTTAACAACTCAT
CACCAGCCTAATCTGTAACGTACTGGATGATTCTTCACTAGTGTCCACATAATTGTTAAA
ATCTGTTCGAAGCCACTACTTCTTTTAAACGACTGGTACACACATTTTGTTGAGAGGTTT
TGGATAATGTTTATGATTAACATAATATTGAATTTCAATACAAAATTCTTTGCCATTCAG
GAAAAATACACCGAACTTGAAGAGTTGAACAAAACTAAACCATTGTGGACACGAAACCCT
GATGATATCTCCCAAGATGAATATGGCGAGTTCTATAAAAGTTTATCAAATGATTGGGAA
GATCATCTTGCTGTGAAGGTAAGGGCTTGGCAATAAAATTTGGTGTTCTATTTCAAAGTG
TAAATAGCTGGTTTTAATGTTCTACGGCTGCTTTCGCTGTCAAACATTGAGCACTAGTTT
TTCAAATATATTATCTGCTTTTAACTAAATCTTTTTCACAGCATTTCTCAGTGGAAGGTC
AACTAGAGTTCCGAGCCTTGTTGTTCGTACCAAAGCGTGCTCCATTCGATTTATTCGAGA
ACCGAAAAATGAAGAATAATATTAAGTTGTACGTAAGGAGAGTTTTCATCATGGACAACT
GTGAGGATCTTATCCCAGAATACTTGAGTAAGTTTAGGATTGTGTTTATAGGGTTAGGTG
TTTGCTTTTGCTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACCGAGATA
AACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCCAACTCTCATTAATGATGG
TTTAACGTTCCTTCCTTGGATGTCTGAGCAGTCAATTAAATTTATTATTATGTGGTAGTG
TAAGAGTATATAAAATGCATTCTATAATAAAAAAGGTTTTAAAATTTTGATAGTACCAAT
ATCAGCTTGGGTAACATTGTGGAATGCATAGGTTTGTAAAGGACTTCGCCAATATAGCAT
AGGAATTCTAATACATTCATAACCAGATTGTTGACTATTTAAGATGTACCAATAACCTCT
TAAATTCAAAAGTTACCAAGTTTTCATTTTACTCAGGAATTTGACGGCAAGAACTTGGTT
TCGATCACGAAGGAAGGTCTTGAACTTCCCGAAGATGAAGATGACAAGAAGAAGTTCGAA
GAAGCAAAAGCAAAGTTCGAAAATCTTTGCAAAGTCGTCAAGGAAATTCTTGACAAGAAA
GTGGAAAAGGTTAATAAATATATAGAATTCTACTCTAATCTCTGTTTTGAGTGAAAAAGC
AAATGATTTAAATCAGTGTTAAAAATTGTTTTAACAGGTTGTTATGTGTGTTACAAATAG
GTTTTTATAGACCTATAAACCCATTTAACTTTTTTTTTCTTTAGTCATTTTACTAAAACT
CGCTTATTTTAAAAGGTTGTTGTTTCGAACCGTCTAGTCCAATCCCCTTGCTGTATTNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATAATTAAAACAAAACTAATA
AATTTCCAGATCTGTGAAAGATCTCGTCATGCTGTTGTACGAAACCTCCCTGCTTGCTTC
GGGATTCTCCTTGGAAGATCCATCAACACACGCAACTCGTATTCATAGAATGATCAAACT
TGGTTTGGGTGAGTGGACTCAATTTCCTGATGCTAGTAGTTGGTTATAGTAAATATACAC
CTAAAGATAAAGATTAGAAATAATGCTCTCAATTTCCTGATGCTAGTACAGGTAGACCAG
AAAAATATAGATTGCACTGGCTCCAACCCCCGTTTACAGAATAGGTTAAAAGTTGTCAGC
CATGTAGAAACAGCATAATCAATATTCACCCACAGTGCAGCTGAATGAAACAGAACACTG
ACATGACTGCTGTTGCACCAACATGCGACTTGTTTGCTTGTGAATGTGGAAACAGCATTA
AAAATCAAATTTTAAACTTTCTTTTTTCCAGGCATTGATGAAGTTGATGGTGAAGAGACG
ACAGCTGCCGAGGAAATCGATGACATGCCACCATTAGAGGGCGATGGAGATGATGATGCA
TCGAGAATGGAAGAAGTTGATTAAACGATACACTCTCAAAGTTTTTCAACAAAATTTGCA
AAGTGTCGCTTTAGGACTTCAAACTACAACTTGCAACTGAAGTGAAAGCCAAACGTCATA
TAATAGTTCAACTTGTAGACAGTAACAAAACTTTAATCCCATTCTTAATGTTTCTTTTCG
TTCTTGCTGTTTCTTGTACACCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNATTATGTTTTTTTTTACCTGGCCAAGCTACGAAATTGCTCGAAACAC
AGTTGTGTCTTTGATCACAAATTGTCATCCTTTTTGTAAAAAATGCTCCTAAGCCGCCAC
CGGCGTATAAAATAGAACACCCGTTTTATAGCGACTCTTTGCCAGTGTATCATACTTTAA
CGCCTAAGCCCTAAACAAATGGCTAATACAAAATCTTGCCTGTCAAAATAAGCGCATTGT
TTTTTGCGTAAACAGCCATCAGTAATACGCCAACACAGGCCGACTGTAGAAGAATATTGT
TATTCCAATACGCCGACTGCCCCGTTTCCGTATACTGTAATTTAAAATACCGCTGAAGCT
TAATGAAGCTTTATATCGTTTTTATCACCGCATAGTTAACCAGTTGTATTCGTTTGGTTT
CGTAGAATGTCTTTCCTAACTCCTGCGTTTCTCTGCCTTGTCTGCTCATTCGTATTAACC
AGCGCAGAAAGTCGAAAAGTCAGCCTTGGAATATTTCCTGACGTACCTGGGGTAAGAACT
AAGTTCTGAATGCGATAATAATAATTTTTTTATTTTTCTCTTTAAAACGATAGCGAAGAT
CAAATTGTATCTAAAAAAGAAATTAACTGCAAAAAGACAGTCGTTAAAACACTATGGACA
AAAGTAACCGACTATAATTTTTTTATTAAAGTTCAACAGCCACGCTTTTTAACAGATGCT
TTTTTCCACATCTTTTTAATCATAGCCTACTGTCGTTTTTCTGTTATTAATTCTCTTTTC
TTCGCTGTTTCAATAGTATGATGATATTCTCTATCGTTTATGAAGAGATAGATTAATTAA
TATTAGGTTCTAACCTAGTTTTTACATCTTGTCAGCGCAACATGGACAAGATGTTCAGCA
AAGACGAGTTGGAGGAAATGTTGGAAACTATTGAGCCAGCTGGTTCGAATGAACTTTATG
ACAGCATCAAATATTCCACGTTAGTATATCATATTGTTGAATTAATACTAAAATTCCAAT
ATTACTAACAAACTATGTTACTTTAGAACCGCAACGTCTCTAAATCTGGCGAAGCAAATA
ATGTGTTACCAAGGAAAAAAGTGGAATTTGTGGAATGTCCTCTTGGTCGCTGCGAAATAT
GGGAAATATGGTTGCTGGTGTGGCGTCGGTGGTAAAGGAACACCGGTTGATGGAATTGAC
AGGTCAATAGGTTTAATAGTTTCTTGACAGCGGTTATTATCCATACTATAGCTACGTATA
CAGAAAATGTAATATGATATTTTAAAGTAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNAATCATCGTTTCATATTTTGCCAACACAGTATTGATATTT
TTCTATTTGCCTTATCTTTTTATCGTGATATGCATGCTGTAAATATTTTTATGGTTAAGG
TCCTCAATCGCTATGGTGCCACGTTTATGGTACATTAGATACTCAATCACGCATTCTGTT
TATTACAATGTACATAAGTGTTGCATATTCATTCATATTTTTCATTGTTTTAAAAGTGAA
TTCACGATTAACAAATATTAGACTTTTTTACTACTTCGTTATATACTAATATCGTGGACA
TTGTAATAATAAAACAACCGCCAGAATACTTCTGCTTTGTGGTTGTTTCTCCATGAAAAT
TGACCTTAATTCCCCCTGATTAGTAAAATTAAGGGCACAGCAGCGGATGATGCCAGTTAC
AGTACAGAAACAGATGTTGTACAAACGTTCTTGACAAATCACACTGATATAAAATACGCC
CTTCTCTTAAATTTTATGTTGTAAAATTAATAGTTACCTGACCAGTAAGTTAAAAACAGC
AAGACCGCTTCTGTTAGTGTAAAGTCGAGCAGATGTTTTGACACGACGAACGCATTTCCC
GAAGGTTCTGTGTGAAAAGCCATGCGTCACGTGAAGCGGGACAGCCCCGAAACCGTTGGT
CGCGAAGCTTCCAGAACAAAATTAGTATCTTGCGACTTCCGCAAATAGTTCCTAATGTTA
TCTTTAAAAATATAAAATTAAACCAATAAAAAATAGGTAACATATATGTAAATGGTATAA
TATTAGACATGAGTAAAATTAGTGCCAAGAGAAATTTAACGCTTCTTTGTTTCATAAAAA
AGTGATAGTAATTGAGCGCGGATGAATACAGAACTTTCCGGCTTATCGTGTGAGAAAAAA
AAGAGAGGGAACTTAAAACGAGAACACGTGCATTCATTCAAACGTGGTTCGACGTTGGAG
AGTGTGGTTGACATTTTACGTTGGGCAGTCAGTTTAAATTTAAAGTCAGCCAATTTACGT
TAATATGTTGCCTAGTTCTTATTATACTTAACTAAGTTGGCTGTTTATATCTCAGATTTG
CGTACCTCTTTAGGTTTTTCGTTTAATTCAAATTTAGTCAATTTAACACCAAAAGAATGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGTTACTG
GTTAATGAAAAAGATTGTTTCATTTACAAAATGCTGCTATGATGATGTATTCCAACATTC
GCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATT
AAGCCAACTCTCATTAATGATGGTTTAACGTTCCTTCCATGGATGTCTGAGCAGTCTAAT
AGTTACATAATCATTTGAAAATCTGTGATCTTGTTTTAGGTAACCTTAAATGGTCCTTTA
TATTTGGTGCAGGTCTGCTATGTCAACTACATCCTAGCGGACCTCCACTTTTGAAACGCC
GAACCTAATATTTGTTTTCTATATAGGCCTTGGACAAGATCCGATATGAAAGCTTGACAG
ATCCCAGCAAACTTGACAGTGGCAAGGAATTGAAAATTGAAATTATCCCAAACAAAGATG
ATTACACCCTTACACTTATTGACACTGGTGTGGGAATGACAAAATCTGACCTAATTAACA
ATCTTGGTACAATCGCAAAATCTGGTACCAAAGCATTTATGGAGGCTCTTCAGGTGTGTT
TTAACAAACATTGTAACCGAAAACTAACTTAGTTTCATTTACTTAAAACCTAGAAATATC
ATTTTTGGAGCCAGAGTCTTAAATTATATTTGAATAAAAATACCTTGTTTTGGCATTCTG
GTGCTAAAACTACATTTTCCAAATAAATATACCATTTTTTGCAGTCTGGAGCTGACATTT
CCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNCGAGTGGTTTCCAAGCATAACGATGATGAAGCATATGCATGGGAATCCTCTGC
TGGTGGTTCTTTCACCGTTGCTTCCATGGATGGAGATACTTTAACCCGTGGAACAAAGAT
TGTTCTTCATCTTAAGGTGAGTTTTTAAATATTTTGCACATCGTTAAAAGGGTCTTTATA
CACACAATAGAAGTCTAAATTTAAAAAGAACCTTTTTTTGAAAAAACTGAAATTTAGTAA
GATTTTCAACATTTTCCTCCTTTTTCAGGAAGATCAACGGGAGTACTTGGAGGAAAAGAA
GATCAAGGACATCGTGAAGAAGCACAGTCAGTTCATCGGGTATCCCATCTCACTTCATGT
GGAGAAAGAGAGAGAAAAGGAAATCAGTGATGATGAGGAAGATGAAGAAGAGAAAAAAGA
AGAAACTGCCGAAACCGAAGAACAAAAGGTATATTTTATAGCAACATTTCTGCTTTTCCT
TAATGGAATGTCAAAGCGTCAGTTCGCAAGATTCTTGCCGGGGAAGCCTGAATATAAACG
TGTTGAAAATTTTGTCAATGTTTTTTGCTGCTATGATGATGTATTCCAACATTCGCAGTT
TCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCTA
ACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGTTAATTAACATC
ATTGGTTTTGTTTACCTTAATTTTGTAATTTCTTCTAAACAATTACTTGATCTTCCAGGA
AGATGACGACAAACCTAAAGTAGAAGATCTTGATGAAGAAGGTGAGGAAGCAAAGGATGA
CAAGAAGAAGACAAAGAAGATCAAGGTAAAATGAGATGTCCCTTGCTGCACAAGTATTAA
CTTTGTAATGTTCAATATGGTGATGGTGAACAATCTATTCCATGTTATCTGCTTACCACC
AACCTGCTAATAACCCTTACTACCAACTTATCACCATCCCCTGCCCATAACTAACAACCT
CTTAACACTCATCACCAGCCTAATCTGTAACGTACTGGATGATTCTTCACTAGTGTCCAC
ATAATTGTTAAAATCTGTTCGAAGCCACTACTTCTTTTAAACGACTGGTACACACATTTT
GTTGAGAGGTTTTGGATAATGTTTATGATTAACATAATATTAAATTTCAATACAAAATTC
TTTGCCATTCAGGAAAAATACACCGAACTTGAAGAGTTGAACAAAACTAAACCATTGTGG
ACACGAAACCCTGATGATATCTCCCAAGATGAATATGGGGAGTTCTATAAAAGTTTATCA
AATGATTGGGAAGATCATCTTGCTGTGAAGGTAAGGGCTGGACAATAAAATTTGGTGTTC
TATTTCAAAGTGTAAATAGCTGGTTTTAATGTTCTACGGCTGCTTTCGCTGTCAAACATT
GAGCACTAGTTTTTCAAATATATTATCTGCTTTTAACTAAATCTTTTTCTCAGCATTTCT
CAGTGGAAGGTCAACTAGAGTTCCGAGCCTTGTTGTTCGTACCAAAGCGTGCTCCATTCG
ATTTATTCGAGAACCGAAAAATGAAGAATAATATTAAGTTGTACGTAAGGAGAGTTTTCA
TCATGGACAACTGTGAGGATCTTATCCCAGAATACTTGAGTAAGTTTAGGATTGTGTTTA
TAGGGTTAGGTGTTTGCTTTTTGCTGCTATGATGATGTATTCCAACATTCGCAGTTTCCA
CCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTAAGCCAACTC
TCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGTTTAAAATATACAATA
ATTAAATAGGTTATTGGGTGAACTCTGGCTTTAATCCCAGATCCCATAGCATGTCAAGCC
CTGACACCACCCATATAAAATAAAAAAATAGTAATTTTTTTTATAACATTTCTATCTCAA
CTTTGCAGACTTCGTTAAAGGAGTGGTCGACAGTGAAGATCTTCCCTTGAACATCTCTCG
TGAAACTCTCCAACAATCCAAGATCCTCAAGGTGATCAGGAAGAACATCGTGAAGAAGTG
CGTGGAGTTGATTGGTGAGATTGCCGAGGACAAAGAGCAATACAAGAAGTTCTACGAGCA
ATTCGGGAAGAACCTTAAGCTTGGAATCCACGAAGATTCACAAAACCGAAAGAAGTTGGC
CGGGTTCCTTCAATATCACTCATCACAATCAGGTAAGCTAAAACAAATATGAAATGTGTG
TAGTGAAGTTTAATTCAACAATTTCGAAACAGTTGTCTTAAATATGTCTTTTTTCCCAAC
ACTTTTGGAAAATCTTAAGAACAATTCAAACAGTGATGTTTCTGTAATGTTTGAAGTAGT
AGGTGTTTAAATAATGCAAAATCTTTAACAAACAAAGGAAGTCTTAACAAAGCAAGTCTT
GAGTAATAACTATACACCACTTGGGACAATGGTTTTCTTGAAAAATGTGACTGCCAAATT
TAAACCTGCGCTGTTACCTAGGTGACGAGATGACATCGTTGGAAAATTACGTCACTCGTA
TGAAGGAAAACCAGAAGGATATTTATTATATCACTGGTGAATCAAGAGACCAGGTTTCTA
ACTCTGCTTTTGTTGAGAGAGTTACGAAACGTGGGTTCGAAGTCCTTTATATGGTTGAAC
CAATTGATGAATACTGTGTACAACAACTTAAGGTAAGAGTTACTACTAATGGTAATTATA
TTGGTTTACTGTTTTCCTTTATCTTTTAAATGCTGCTATGATGATGTATTCCAACATTCG
CAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGTATATTA
AGCTAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGTCAATTA
AATTTATTATTATGTGGTAGTGTAAGAGTATATAAAATGCATTCTTTAATAAAAAGGGTT
TTAAAATTTTGATAGTACCAATATCAGCTTGGGTAACATTGTGGAATGCATAGGTTTGTA
AAGACCACCAGTATAGCATAGGAATCCTAATACATTCAGCTCTTTGTTGACTATTTAAGA
TATACCAATAACCTCTTAAATTCAAAAGTTACCAAGTTTTAATTTTACTCAGGAATTCGA
TGGCAAGAACTTGGTTTCGATCACAAAGGAAGGTCTTGAACTTCCTGAAGATGAAGATGA
CAAGAAGAAGTTCGAAGAAGCAAAGGCAAAGTTCGAAAATCTTTGCAAAGTCGTCAAGGA
AATTCTTGACAAGAAAGTGGAAAAGGTTAATAAATATATAGAATTCTACTCTTAATCTCT
GTTTTGAGTGAAAAAGCACAAAAGATTTAAATCAGTGTTAAAAATTGTTTTAACAGGTTG
TTATGTGTGTTAAAATAGGTTTTGCAGACCTATAAACCCATTTAACTTTTTTTTCCTTTA
GTTATTTTACTAAAACTCGCTTATTTTAAAAGGTTGTTGTTTCGANNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAAGATCACAAAACCGAAAGAAG
TTGGCTGGGTTCCTTCAATATCACTCATCACAATCAGGTAAGCTAAAACAAATATGAAAT
GTGTGTAGTGAAGTTTAATTCAACAATTTCGAAACAGTTGTCTTAAATATGTCTTTTTTC
CCAACACTTTTGGAAAATCTTAAGAACAAATCAAACAGTGATGTTTCTGTAATGTTTGAA
GTAGTAGGTGTTAAAATAATGCAAAATCTTTAACAAACAAAGGAAGTCTTCAGTAATAAC
TATTAGGGGTGTGCTGAAGTTGAAAAAGCTCGGGTTCGCCGAGCGCCGAGCTTCAACGAA
AAGCTCGGCACGAGCCCGAGCATCTATGACGTCATCAAGGAGAAAGGCGTATGAGAATGC
GTTCCTATTAAGCCGAAAAGCGCCGCTAATCAAAATAATACAGAACACGTGGTTTGCGGT
TAAAGACGCGTCTCGCTTTTCATAATTCCTACTGTTGCAAAATGTAAAATTCATACAAAA
AATATTTAATTAAAAAATTATTTATAACTGTTACAGCCAGTGGCACAACTAGCAAGTTTC
TACGCATGTTCATCTTGGATAATGTAACGATTATTTACGTCAGAATAAACCTTTACGATC
GTTACATCACAAACGAGATTGTTGGAAAACAATCGTGTTTTATTCGCTTCCATACGATCT
GTAGTTTGTGTATAAATTTTGTTTCTGATGATTAGTTTAATGCAGGTAAATCGCGATTAT
GTGAGTTTTAATTGGTGCAAATATAAGAGCGAGGAGCGACGCTATCAGTAAATTGGAACC
AACATAAATTGTAATATGATATTACATAGTATCGTCCCGGTCGAGCTTGGACAGAAGCCA
AAAAACATCGTTTGATGGCGCCGCACGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCTTTTTAT
TTAAAATGTGATACGAAAACATTGGGCGCTCGTGTAATTCGACACCTGCTATAATTCGAT
ACGGGCAAATTCGCTGACGTTGCGATTCGTTACTTGCGAGAGAGCAAATTCACAACGAAC
GAAAAATAATTAAAGAGAAAGCTACGCTGACTAGTCTCGTTATCTCTTAGTAGCTTCACT
TTTTTCATTTTTAATATTTTTCGCTCTCGCGTGCAACATTATAGCATAAGGCTCGGCGCT
CGGCCCAGTTTTCAGCCGAGCGTCAAAAAAGGAGACGCTCGGGCACGAGCTTTTGAGTTC
GGGCTCGGCACATCCCTAATAACTATACACCACTTGGGACAATGGTTTTCTTGAAAAATG
TGACTGCCAAATTTAAACCTGCGCTGTTACCTAGGTGACGAGATGACATCGTTGGAAAAT
TACGTCACTCGTATGAAGGAAAACCAGAAGGATATTTATTATATCACTGGTGAATCAAGA
GACCAGGTTTCTAACTCTGCTTTTGTTGAAAGAGTTACGAAACGTGGGTTCGAAGTCCTT
TATATGGTTGAACCAATTGATGAATACTGTGTACAACAACTTAAGGTAAGAATTACTACT
AATGGTAATTATATTGGTTTACTGTTTTCCTTTATCTTTTAAATGCTGCTATGATGATGT
ATTCCAACATTCGCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAAC
TTGCTGTATATTAAGCTAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCT
GAGCAGTCAATTAAATTTATTATTATGTGGTAGTGTAAGAGTATATAAAATGCATTCTTT
AATAAAAAGGGTTTTAAAATTTTGATAGTACCAATATCAGCTTGGGTAACATTGTGGAAT
GCATAGGTTTGTAAAGGACCACCAGTATAGCATAGGAATTCTAATACATTCATACTCTTT
GTTGACTATTTAAGATGTACGAATAACCTCTTAAATTCAAAAAGTTACCAAGTTTTCATT
TTACTCAGGAATTTGACGGCAAGAACTTGGTTTCGATCACGAAGGAAGGTCTTGAACTTC
CCGAAGATGAAGATGACAAGAAGAAGTTCGAAGAAGCAAAAGCAAAGTTCGAAAATCTTT
GCAAAGTCGTCAAGGAAATTCTTGACAAGAAAGTGGAAAAGGTTAATAAATATATGGAAT
TCTGCTCTTAATCTCTGTTTTGAGTGAAAAAGCAAAAGATTTAAATCAGTGTTAAAAATT
GTTTTAACAGGTTGTTATGTGTGTTACAAATAGGTTTTTATAGACCTATATAAACCCATT
TAACTTATTTTTTCTTTATTCATTTTACTAAAACTCGCTTATTTTAAAAGGTTGTTGTTT
CGAACCGTCTTGTCCAATCCCCTTGCTGTATTGTGACATCACAATATGGTTGGTCAGCAA
ACATGGAGAGGATCATGAAGGCTCAAGCACTTCGCGATACATCAACCATGGGCTACATGG
CAGCGAAGAAACATTTAGAAATCAACCCAGACCATTCTATTATGGAACAACTCCGACAAA
AAGCTGAAGCTGATAAGAATGACAAGTGTGTACCTTTTTCCTGACTTTTGGCTTTTTTAT
GTTTAAAATATTTTGTGGAAAATTTGCTGATTGATTCTCATTTTACTACAATTTTTTTTT
TAAATTTGCACTTATTTTTCTATATTTCTACAATTTTGATAATTAAAACAAAACTAATAA
ATTTCCAGATCTGTGAAAGATCTCGTCATGCTATTGTACGAAACCTCCCTGCTTGCTTCG
GGATTCTCATTGGAAGATCCATCAACACACGCAACTCGTATTCATAGAATGATCAAACTT
GGTTTGGGTGAGTGGACTCAATTTCCTGATGCTAGTAGTTGGTTATAGTAAATATACACC
TAAAGATAAAGATTAGAAATAATGCTCTCAATTCCCTGATGCTAGTACAGGTAGACCAGA
AAAATATAGATTGCACTGGCTCCAACCCCCGTTTACAGAATAGGTTAAAAGTTGTCAGCC
ATGTAGAAACAGCATAATCAATATTCACCCACAGTGCAGCTGAATGAAACAGAACACTGA
CATGACTGCTGTTGCACCAACATGCGACTTGTTTGCTTGTGAATGTGGAAACAGCATTAA
AAATCAAATTTTAAACTTTCTTTTTTCCAGGCATTGATGAAGTTGATGGTGAAGAGACGA
CAGCTGCCGAGGAAATCGATGACATGCCACCATTAGAGGGCGATGGAGATGATGATGCAT
CGAGAATGGAAGAAGTTGATTAAACGATACACTCTCAAAGTTTTTCAACAAAATTTGCAA
AGTGTCGCTTCAGGACTTCAAACTACAACTTGCAACTGAAGTGAAAGCCAAACGTCATAT
AATAGTTCAACTTGTAGACAGTAACAAAACTTTAATCCCATTCTTAATGTTTCTTTTCGT
TCTTGCTGTTTCTTGTACACCTGTAGTAATTGGATTGCTTTTTGTAATAATTGTGACCAT
TAAAAATAAATTACATTCAATGTATTGTATTGTAGTGTTGTTTGAAACTTCAGCTTTAAG
TTTATATTAGTTTTATTTGTAATGTGCGGTTTCGTAGCACAACGGTTGGGCAAACTTTAG
GAAATTGAATGCTTATTTTTTCAAGAGCATTGCATGTTGTTTTGGGACTGGTACCATTAT
GTTTTTTTTTACCTGGCCAAGCTACGAAATTGCTCGAAACACAGTTGTGTCTTTGATCAC
AAATTGTCATCCTTTTTGTAAAAAATGCTCCTAAGCCGCCACCGGCGTATAAAATAGAAC
ACCCGTTTTATAGCGACTCTTTGCCAGTGTATCATACTTTAACGCCTAAGCCCTAAACAA
ATGGCTAATACAAAATCTTGCCTGTCAAAATAAGCGCATTGTTTTTTGCGTAAACAGCCA
TCAGTAATACGCCAACACAGGCCGACTGTAGAAGAATATTGTTATTCCAATACGCCGACT
GCCCCGTTTCCGTATACTGTAATTTAAAATACCGCTGAAGCTTAATGAAGCTTTATATCG
TTTTTATCACCGCATAGTTAACCAGTTGTATTCGTTTGGTTTCGTAGAATGTCTTTCCTA
ACTCCTGCGTTTCTCTGCCTTGTCTGCTCATTCGTATTAACCAGCGCAGAAAGTCGAAAA
GTCAGCCTTGGAATATTTCCTGACGTACCTGGGGTAAGAACTAAGTTCTGAATGCGATAA
TAATAATTTTTTTATTTTTCTCTTTAAAACGATAGCGAAGATCAAATTGTATTTAAAAAA
GAAATTAACTGCAAAAAGACAGTCGTTAAAACACTATGGACAAAAGTAACCGACTATAAT
TTTTTTATTAAAGTTCAACAGCCACGCTTTTTAACAGATGCTTTTTTCCACATCTTTTTA
ATCATAGCCTACTGTCGTTTTTCTGTTATTAATTCTCTTTTCTTCGCTGTTTCAATAGTA
TGATGATATTCTCTATCGTTTATGAAGAGATAGATTAATTAATATTAGGTTCTAACCTAG
TTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1171, 1570..1814, 7410..7447, 9791..9915, 10048..10227, 10558..10644, 10992..11129, 11273..11438, 11768..12031, 15154..15344, 15788..15940, 16130..16344, 16508..16626, 16950..17303
1001..1171, 1570..1814, 7410..7447, 9791..9915, 10048..10227, 10558..10644, 10992..11129, 11273..11438, 11768..12031, 15154..15344, 15788..15940, 16130..16344, 16508..16626, 16950..17059
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved