Ciona_intestinalis Locus ENSCING00000006512
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000006512
Ciona_intestinalis
ENSCING00000006512
3q
SNORD14, SNORD14, SNORD14, SNORD14, SNORD14
3168..3308, 4782..4922, 5918..6058, 7007..7147, 9840..9980
14817
TAGTAAATATACACCTAAAGATAAAGATTAGAAATAATGCTCTCAATTTCCTGATGCTA
GTACAGGTAGACCAGAAAAATATAGATTGCACTGGCTCCAACCCCCGTTTACAGAATAGG
TTAAAAGTTGTCAGCCATGTAGAAACAGCATAATCAATATTCACCCACAGTGCAGCTGAA
TGAAACAGAACACTGACATGACTGCTGTTGCACCAACATGCGACTTGTTTGCTTGTGAAT
GTGGAAACAGCATTAAAAATCAAATTTTAAACTTTCTTTTTTCCAGGCATTGATGAAGTT
GATGGTGAAGAGACGACAGCTGCCGAGGAAATCGATGACATGCCACCATTAGAGGGCGAT
GGAGATGATGATGCATCGAGAATGGAAGAAGTTGATTAAACGATACACTCTCAAAGTTTT
TCAACAAAATTTGCAAAGTGTCGCTTTAGGACTTCAAACTACAACTTGCAACTGAAGTGA
AAGCCAAACGTCATATAATAGTTCAACTTGTAGACAGTAACAAAACTTTAATCCCATTCT
TAATGTTTCTTTTCGTTCTTGCTGTTTCTTGTACACCTNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNATTATGTTTTTTTTTACCTGGCCAAGCTACGA
AATTGCTCGAAACACAGTTGTGTCTTTGATCACAAATTGTCATCCTTTTTGTAAAAAATG
CTCCTAAGCCGCCACCGGCGTATAAAATAGAACACCCGTTTTATAGCGACTCTTTGCCAG
TGTATCATACTTTAACGCCTAAGCCCTAAACAAATGGCTAATACAAAATCTTGCCTGTCA
AAATAAGCGCATTGTTTTTTGCGTAAACAGCCATCAGTAATACGCCAACACAGGCCGACT
GTAGAAGAATATTGTTATTCCAATACGCCGACTGCCCCGTTTCCGTATACTGTAATTTAA
AATACCGCTGAAGCTTAATGAAGCTTTATATCGTTTTTATCACCGCATAGTTAACCAGTT
GTATTCGTTTGGTTTCGTAGAATGTCTTTCCTAACTCCTGCGTTTCTCTGCCTTGTCTGC
TCATTCGTATTAACCAGCGCAGAAAGTCGAAAAGTCAGCCTTGGAATATTTCCTGACGTA
CCTGGGGTAAGAACTAAGTTCTGAATGCGATAATAATAATTTTTTTATTTTTCTCTTTAA
AACGATAGCGAAGATCAAATTGTATCTAAAAAAGAAATTAACTGCAAAAAGACAGTCGTT
AAAACACTATGGACAAAAGTAACCGACTATAATTTTTTTATTAAAGTTCAACAGCCACGC
TTTTTAACAGATGCTTTTTTCCACATCTTTTTAATCATAGCCTACTGTCGTTTTTCTGTT
ATTAATTCTCTTTTCTTCGCTGTTTCAATAGTATGATGATATTCTCTATCGTTTATGAAG
AGATAGATTAATTAATATTAGGTTCTAACCTAGTTTTTACATCTTGTCAGCGCAACATGG
ACAAGATGTTCAGCAAAGACGAGTTGGAGGAAATGTTGGAAACTATTGAGCCAGCTGGTT
CGAATGAACTTTATGACAGCATCAAATATTCCACGTTAGTATATCATATTGTTGAATTAA
TACTAAAATTCCAATATTACTAACAAACTATGTTACTTTAGAACCGCAACGTCTCTAAAT
CTGGCGAAGCAAATAATGTGTTACCAAGGAAAAAAGTGGAATTTGTGGAATGTCCTCTTG
GTCGCTGCGAAATATGGGAAATATGGTTGCTGGTGTGGCGTCGGTGGTAAAGGAACACCG
GTTGATGGAATTGACAGGTCAATAGGTTTAATAGTTTCTTGACAGCGGTTATTATCCATA
CTATAGCTACGTATACAGAAAATGTAATATGATATTTTAAAGTAGNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATCATCGTTTCATATTTTGCCAAC
ACAGTATTGATATTTTTCTATTTGCCTTATCTTTTTATCGTGATATGCATGCTGTAAATA
TTTTTATGGTTAAGGTCCTCAATCGCTATGGTGCCACGTTTATGGTACATTAGATACTCA
ATCACGCATTCTGTTTATTACAATGTACATAAGTGTTGCATATTCATTCATATTTTTCAT
TGTTTTAAAAGTGAATTCACGATTAACAAATATTAGACTTTTTTACTACTTCGTTATATA
CTAATATCGTGGACATTGTAATAATAAAACAACCGCCAGAATACTTCTGCTTTGTGGTTG
TTTCTCCATGAAAATTGACCTTAATTCCCCCTGATTAGTAAAATTAAGGGCACAGCAGCG
GATGATGCCAGTTACAGTACAGAAACAGATGTTGTACAAACGTTCTTGACAAATCACACT
GATATAAAATACGCCCTTCTCTTAAATTTTATGTTGTAAAATTAATAGTTACCTGACCAG
TAAGTTAAAAACAGCAAGACCGCTTCTGTTAGTGTAAAGTCGAGCAGATGTTTTGACACG
ACGAACGCATTTCCCGAAGGTTCTGTGTGAAAAGCCATGCGTCACGTGAAGCGGGACAGC
CCCGAAACCGTTGGTCGCGAAGCTTCCAGAACAAAATTAGTATCTTGCGACTTCCGCAAA
TAGTTCCTAATGTTATCTTTAAAAATATAAAATTAAACCAATAAAAAATAGGTAACATAT
ATGTAAATGGTATAATATTAGACATGAGTAAAATTAGTGCCAAGAGAAATTTAACGCTTC
TTTGTTTCATAAAAAAGTGATAGTAATTGAGCGCGGATGAATACAGAACTTTCCGGCTTA
TCGTGTGAGAAAAAAAAGAGAGGGAACTTAAAACGAGAACACGTGCATTCATTCAAACGT
GGTTCGACGTTGGAGAGTGTGGTTGACATTTTACGTTGGGCAGTCAGTTTAAATTTAAAG
TCAGCCAATTTACGTTAATATGTTGCCTAGTTCTTATTATACTTAACTAAGTTGGCTGTT
TATATCTCAGATTTGCGTACCTCTTTAGGTTTTTCGTTTAATTCAAATTTAGTCAATTTA
ACACCAAAAGAATGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAATGTTACTGGTTAATGAAAAAGATTGTTTCATTTACAAAATGCTGCTATGATGA
TGTATTCCAACATTCGCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAA
AACTTGCTGTATATTAAGCCAACTCTCATTAATGATGGTTTAACGTTCCTTCCATGGATG
TCTGAGCAGTCTAATAGTTACATAATCATTTGAAAATCTGTGATCTTGTTTTAGGTAACC
TTAAATGGTCCTTTATATTTGGTGCAGGTCTGCTATGTCAACTACATCCTAGCGGACCTC
CACTTTTGAAACGCCGAACCTAATATTTGTTTTCTATATAGGCCTTGGACAAGATCCGAT
ATGAAAGCTTGACAGATCCCAGCAAACTTGACAGTGGCAAGGAATTGAAAATTGAAATTA
TCCCAAACAAAGATGATTACACCCTTACACTTATTGACACTGGTGTGGGAATGACAAAAT
CTGACCTAATTAACAATCTTGGTACAATCGCAAAATCTGGTACCAAAGCATTTATGGAGG
CTCTTCAGGTGTGTTTTAACAAACATTGTAACCGAAAACTAACTTAGTTTCATTTACTTA
AAACCTAGAAATATCATTTTTGGAGCCAGAGTCTTAAATTATATTTGAATAAAAATACCT
TGTTTTGGCATTCTGGTGCTAAAACTACATTTTCCAAATAAATATACCATTTTTTGCAGT
CTGGAGCTGACATTTCCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNCGAGTGGTTTCCAAGCATAACGATGATGAAGCATATGC
ATGGGAATCCTCTGCTGGTGGTTCTTTCACCGTTGCTTCCATGGATGGAGATACTTTAAC
CCGTGGAACAAAGATTGTTCTTCATCTTAAGGTGAGTTTTTAAATATTTTGCACATCGTT
AAAAGGGTCTTTATACACACAATAGAAGTCTAAATTTAAAAAGAACCTTTTTTTGAAAAA
ACTGAAATTTAGTAAGATTTTCAACATTTTCCTCCTTTTTCAGGAAGATCAACGGGAGTA
CTTGGAGGAAAAGAAGATCAAGGACATCGTGAAGAAGCACAGTCAGTTCATCGGGTATCC
CATCTCACTTCATGTGGAGAAAGAGAGAGAAAAGGAAATCAGTGATGATGAGGAAGATGA
AGAAGAGAAAAAAGAAGAAACTGCCGAAACCGAAGAACAAAAGGTATATTTTATAGCAAC
ATTTCTGCTTTTCCTTAATGGAATGTCAAAGCGTCAGTTCGCAAGATTCTTGCCGGGGAA
GCCTGAATATAAACGTGTTGAAAATTTTGTCAATGTTTTTTGCTGCTATGATGATGTATT
CCAACATTCGCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTG
CTGTATATTAAGCTAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAG
CAGTTAATTAACATCATTGGTTTTGTTTACCTTAATTTTGTAATTTCTTCTAAACAATTA
CTTGATCTTCCAGGAAGATGACGACAAACCTAAAGTAGAAGATCTTGATGAAGAAGGTGA
GGAAGCAAAGGATGACAAGAAGAAGACAAAGAAGATCAAGGTAAAATGAGATGTCCCTTG
CTGCACAAGTATTAACTTTGTAATGTTCAATATGGTGATGGTGAACAATCTATTCCATGT
TATCTGCTTACCACCAACCTGCTAATAACCCTTACTACCAACTTATCACCATCCCCTGCC
CATAACTAACAACCTCTTAACACTCATCACCAGCCTAATCTGTAACGTACTGGATGATTC
TTCACTAGTGTCCACATAATTGTTAAAATCTGTTCGAAGCCACTACTTCTTTTAAACGAC
TGGTACACACATTTTGTTGAGAGGTTTTGGATAATGTTTATGATTAACATAATATTAAAT
TTCAATACAAAATTCTTTGCCATTCAGGAAAAATACACCGAACTTGAAGAGTTGAACAAA
ACTAAACCATTGTGGACACGAAACCCTGATGATATCTCCCAAGATGAATATGGGGAGTTC
TATAAAAGTTTATCAAATGATTGGGAAGATCATCTTGCTGTGAAGGTAAGGGCTGGACAA
TAAAATTTGGTGTTCTATTTCAAAGTGTAAATAGCTGGTTTTAATGTTCTACGGCTGCTT
TCGCTGTCAAACATTGAGCACTAGTTTTTCAAATATATTATCTGCTTTTAACTAAATCTT
TTTCTCAGCATTTCTCAGTGGAAGGTCAACTAGAGTTCCGAGCCTTGTTGTTCGTACCAA
AGCGTGCTCCATTCGATTTATTCGAGAACCGAAAAATGAAGAATAATATTAAGTTGTACG
TAAGGAGAGTTTTCATCATGGACAACTGTGAGGATCTTATCCCAGAATACTTGAGTAAGT
TTAGGATTGTGTTTATAGGGTTAGGTGTTTGCTTTTTGCTGCTATGATGATGTATTCCAA
CATTCGCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAAACTTGCTGT
ATATTAAGCCAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGTCTGAGCAGT
TTAAAATATACAATAATTAAATAGGTTATTGGGTGAACTCTGGCTTTAATCCCAGATCCC
ATAGCATGTCAAGCCCTGACACCACCCATATAAAATAAAAAAATAGTAATTTTTTTTATA
ACATTTCTATCTCAACTTTGCAGACTTCGTTAAAGGAGTGGTCGACAGTGAAGATCTTCC
CTTGAACATCTCTCGTGAAACTCTCCAACAATCCAAGATCCTCAAGGTGATCAGGAAGAA
CATCGTGAAGAAGTGCGTGGAGTTGATTGGTGAGATTGCCGAGGACAAAGAGCAATACAA
GAAGTTCTACGAGCAATTCGGGAAGAACCTTAAGCTTGGAATCCACGAAGATTCACAAAA
CCGAAAGAAGTTGGCCGGGTTCCTTCAATATCACTCATCACAATCAGGTAAGCTAAAACA
AATATGAAATGTGTGTAGTGAAGTTTAATTCAACAATTTCGAAACAGTTGTCTTAAATAT
GTCTTTTTTCCCAACACTTTTGGAAAATCTTAAGAACAATTCAAACAGTGATGTTTCTGT
AATGTTTGAAGTAGTAGGTGTTTAAATAATGCAAAATCTTTAACAAACAAAGGAAGTCTT
AACAAAGCAAGTCTTGAGTAATAACTATACACCACTTGGGACAATGGTTTTCTTGAAAAA
TGTGACTGCCAAATTTAAACCTGCGCTGTTACCTAGGTGACGAGATGACATCGTTGGAAA
ATTACGTCACTCGTATGAAGGAAAACCAGAAGGATATTTATTATATCACTGGTGAATCAA
GAGACCAGGTTTCTAACTCTGCTTTTGTTGAGAGAGTTACGAAACGTGGGTTCGAAGTCC
TTTATATGGTTGAACCAATTGATGAATACTGTGTACAACAACTTAAGGTAAGAGTTACTA
CTAATGGTAATTATATTGGTTTACTGTTTTCCTTTATCTTTTAAATGCTGCTATGATGAT
GTATTCCAACATTCGCAGTTTCCACCAGACCGAGATAAACTTAATATACAGGAAGGTAAA
ACTTGCTGTATATTAAGCTAACTCTCATTAATGATGGTTTAACGTTCCTTCCTTGGATGT
CTGAGCAGTCAATTAAATTTATTATTATGTGGTAGTGTAAGAGTATATAAAATGCATTCT
TTAATAAAAAGGGTTTTAAAATTTTGATAGTACCAATATCAGCTTGGGTAACATTGTGGA
ATGCATAGGTTTGTAAAGACCACCAGTATAGCATAGGAATCCTAATACATTCAGCTCTTT
GTTGACTATTTAAGATATACCAATAACCTCTTAAATTCAAAAGTTACCAAGTTTTAATTT
TACTCAGGAATTCGATGGCAAGAACTTGGTTTCGATCACAAAGGAAGGTCTTGAACTTCC
TGAAGATGAAGATGACAAGAAGAAGTTCGAAGAAGCAAAGGCAAAGTTCGAAAATCTTTG
CAAAGTCGTCAAGGAAATTCTTGACAAGAAAGTGGAAAAGGTTAATAAATATATAGAATT
CTACTCTTAATCTCTGTTTTGAGTGAAAAAGCACAAAAGATTTAAATCAGTGTTAAAAAT
TGTTTTAACAGGTTGTTATGTGTGTTAAAATAGGTTTTGCAGACCTATAAACCCATTTAA
CTTTTTTTTCCTTTAGTTATTTTACTAAAACTCGCTTATTTTAAAAGGTTGTTGTTTCGA
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACGAAGATCA
CAAAACCGAAAGAAGTTGGCTGGGTTCCTTCAATATCACTCATCACAATCAGGTAAGCTA
AAACAAATATGAAATGTGTGTAGTGAAGTTTAATTCAACAATTTCGAAACAGTTGTCTTA
AATATGTCTTTTTTCCCAACACTTTTGGAAAATCTTAAGAACAAATCAAACAGTGATGTT
TCTGTAATGTTTGAAGTAGTAGGTGTTAAAATAATGCAAAATCTTTAACAAACAAAGGAA
GTCTTCAGTAATAACTATTAGGGGTGTGCTGAAGTTGAAAAAGCTCGGGTTCGCCGAGCG
CCGAGCTTCAACGAAAAGCTCGGCACGAGCCCGAGCATCTATGACGTCATCAAGGAGAAA
GGCGTATGAGAATGCGTTCCTATTAAGCCGAAAAGCGCCGCTAATCAAAATAATACAGAA
CACGTGGTTTGCGGTTAAAGACGCGTCTCGCTTTTCATAATTCCTACTGTTGCAAAATGT
AAAATTCATACAAAAAATATTTAATTAAAAAATTATTTATAACTGTTACAGCCAGTGGCA
CAACTAGCAAGTTTCTACGCATGTTCATCTTGGATAATGTAACGATTATTTACGTCAGAA
TAAACCTTTACGATCGTTACATCACAAACGAGATTGTTGGAAAACAATCGTGTTTTATTC
GCTTCCATACGATCTGTAGTTTGTGTATAAATTTTGTTTCTGATGATTAGTTTAATGCAG
GTAAATCGCGATTATGTGAGTTTTAATTGGTGCAAATATAAGAGCGAGGAGCGACGCTAT
CAGTAAATTGGAACCAACATAAATTGTAATATGATATTACATAGTATCGTCCCGGTCGAG
CTTGGACAGAAGCCAAAAAACATCGTTTGATGGCGCCGCACGANNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGCTTTTTATTTAAAATGTGATACGAAAACATTGGGCGCTCGTGTAATTCGACAC
CTGCTATAATTCGATACGGGCAAATTCGCTGACGTTGCGATTCGTTACTTGCGAGAGAGC
AAATTCACAACGAACGAAAAATAATTAAAGAGAAAGCTACGCTGACTAGTCTCGTTATCT
CTTAGTAGCTTCACTTTTTTCATTTTTAATATTTTTCGCTCTCGCGTGCAACATTATAGC
ATAAGGCTCGGCGCTCGGCCCAGTTTTCAGCCGAGCGTCAAAAAAGGAGACGCTCGGGCA
CGAGCTTTTGAGTTCGGGCTCGGCACATCCCTAATAACTATACACCACTTGGGACAATGG
TTTTCTTGAAAAATGTGACTGCCAAATTTAAACCTGCGCTGTTACCTAGGTGACGAGATG
ACATCGTTGGAAAATTACGTCACTCGTATGAAGGAAAACCAGAAGGATATTTATTATATC
ACTGGTGAATCAAGAGACCAGGTTTCTAACTCTGCTTTTGTTGAAAGAGTTACGAAACGT
GGGTTCGAAGTCCTTTATATGGTTGAACCAATTGATGAATACTGTGTACAACAACTTAAG
GTAAGAATTACTACTAATGGTAATTATATTGGTTTACTGTTTTCCTTTATCTTTTAAATG
CTGCTATGATGATGTATTCCAACATTCGCAGTTTCCACCAGACCGAGATAAACTTAATAT
ACAGGAAGGTAAAACTTGCTGTATATTAAGCTAACTCTCATTAATGATGGTTTAACGTTC
CTTCCTTGGATGTCTGAGCAGTCAATTAAATTTATTATTATGTGGTAGTGTAAGAGTATA
TAAAATGCATTCTTTAATAAAAAGGGTTTTAAAATTTTGATAGTACCAATATCAGCTTGG
GTAACATTGTGGAATGCATAGGTTTGTAAAGGACCACCAGTATAGCATAGGAATTCTAAT
ACATTCATACTCTTTGTTGACTATTTAAGATGTACGAATAACCTCTTAAATTCAAAAAGT
TACCAAGTTTTCATTTTACTCAGGAATTTGACGGCAAGAACTTGGTTTCGATCACGAAGG
AAGGTCTTGAACTTCCCGAAGATGAAGATGACAAGAAGAAGTTCGAAGAAGCAAAAGCAA
AGTTCGAAAATCTTTGCAAAGTCGTCAAGGAAATTCTTGACAAGAAAGTGGAAAAGGTTA
ATAAATATATGGAATTCTGCTCTTAATCTCTGTTTTGAGTGAAAAAGCAAAAGATTTAAA
TCAGTGTTAAAAATTGTTTTAACAGGTTGTTATGTGTGTTACAAATAGGTTTTTATAGAC
CTATATAAACCCATTTAACTTATTTTTTCTTTATTCATTTTACTAAAACTCGCTTATTTT
AAAAGGTTGTTGTTTCGAACCGTCTTGTCCAATCCCCTTGCTGTATTGTGACATCACAAT
ATGGTTGGTCAGCAAACATGGAGAGGATCATGAAGGCTCAAGCACTTCGCGATACATCAA
CCATGGGCTACATGGCAGCGAAGAAACATTTAGAAATCAACCCAGACCATTCTATTATGG
AACAACTCCGACAAAAAGCTGAAGCTGATAAGAATGACAAGTGTGTACCTTTTTCCTGAC
TTTTGGCTTTTTTATGTTTAAAATATTTTGTGGAAAATTTGCTGATTGATTCTCATTTTA
CTACAATTTTTTTTTTAAATTTGCACTTATTTTTCTATATTTCTACAATTTTGATAATTA
AAACAAAACTAATAAATTTCCAGATCTGTGAAAGATCTCGTCATGCTATTGTACGAAACC
TCCCTGCTTGCTTCGGGATTCTCATTGGAAGATCCATCAACACACGCAACTCGTATTCAT
AGAATGATCAAACTTGGTTTGGGTGAGTGGACTCAATTTCCTGATGCTAGTAGTTGGTTA
TAGTAAATATACACCTAAAGATAAAGATTAGAAATAATGCTCTCAATTCCCTGATGCTAG
TACAGGTAGACCAGAAAAATATAGATTGCACTGGCTCCAACCCCCGTTTACAGAATAGGT
TAAAAGTTGTCAGCCATGTAGAAACAGCATAATCAATATTCACCCACAGTGCAGCTGAAT
GAAACAGAACACTGACATGACTGCTGTTGCACCAACATGCGACTTGTTTGCTTGTGAATG
TGGAAACAGCATTAAAAATCAAATTTTAAACTTTCTTTTTTCCAGGCATTGATGAAGTTG
ATGGTGAAGAGACGACAGCTGCCGAGGAAATCGATGACATGCCACCATTAGAGGGCGATG
GAGATGATGATGCATCGAGAATGGAAGAAGTTGATTAAACGATACACTCTCAAAGTTTTT
CAACAAAATTTGCAAAGTGTCGCTTCAGGACTTCAAACTACAACTTGCAACTGAAGTGAA
AGCCAAACGTCATATAATAGTTCAACTTGTAGACAGTAACAAAACTTTAATCCCATTCTT
AATGTTTCTTTTCGTTCTTGCTGTTTCTTGTACACCTGTAGTAATTGGATTGCTTTTTGT
AATAATTGTGACCATTAAAAATAAATTACATTCAATGTATTGTATTGTAGTGTTGTTTGA
AACTTCAGCTTTAAGTTTATATTAGTTTTATTTGTAATGTGCGGTTTCGTAGCACAACGG
TTGGGCAAACTTTAGGAAATTGAATGCTTATTTTTTCAAGAGCATTGCATGTTGTTTTGG
GACTGGTACCATTATGTTTTTTTTTACCTGGCCAAGCTACGAAATTGCTCGAAACACAGT
TGTGTCTTTGATCACAAATTGTCATCCTTTTTGTAAAAAATGCTCCTAAGCCGCCACCGG
CGTATAAAATAGAACACCCGTTTTATAGCGACTCTTTGCCAGTGTATCATACTTTAACGC
CTAAGCCCTAAACAAATGGCTAATACAAAATCTTGCCTGTCAAAATAAGCGCATTGTTTT
TTGCGTAAACAGCCATCAGTAATACGCCAACACAGGCCGACTGTAGAAGAATATTGTTAT
TCCAATACGCCGACTGCCCCGTTTCCGTATACTGTAATTTAAAATACCGCTGAAGCTTAA
TGAAGCTTTATATCGTTTTTATCACCGCATAGTTAACCAGTTGTATTCGTTTGGTTTCGT
AGAATGTCTTTCCTAACTCCTGCGTTTCTCTGCCTTGTCTGCTCATTCGTATTAACCAGC
GCAGAAAGTCGAAAAGTCAGCCTTGGAATATTTCCTGACGTACCTGGGGTAAGAACTAAG
TTCTGAATGCGATAATAATAATTTTTTTATTTTTCTCTTTAAAACGATAGCGAAGATCAA
ATTGTATTTAAAAAAGAAATTAACTGCAAAAAGACAGTCGTTAAAACACTATGGACAAAA
GTAACCGACTATAATTTTTTTATTAAAGTTCAACAGCCACGCTTTTTAACAGATGCTTTT
TTCCACATCTTTTTAATCATAGCCTACTGTCGTTTTTCTGTTATTAATTCTCTTTTCTTC
GCTGTTTCAATAGTATGATGATATTCTCTATCGTTTATGAAGAGATAGATTAATTAATAT
TAGGTTCTAACCTAGTTTTTACATCTTGTCAGCGCAACATGGACAAGATGTTCAGCAAAG
ACGAGTTGGAGGAAATGTTGGAAACTATTGAGCCAGCTGGTTCGAATGAACTTTATGACA
GCATCAAATATTCCACGTTAGTATATCATATTGTTGAATTAATACTAAAATTCCAATATT
ACTAACAAACTATGTTACTTTAGAACCGCAACGTCTCTAAATCTGGCGAAGCAAATAATG
TGTTACCAAGGAAAAAAGTGGAATTTGTGGAATGTCCTCTTGGTCGCTGCGAAATATGGG
AAATATGGTTGCTGGTGTGGCGTCGGTGGTAAAGGAACACCGGTTGATGGAATTGACAGG
TCAATAGGTTTAATAGTTTCTTGACAGCGGTTATTATCCATACTATAGCTACGTATACAG
AAAATGTAATGTGATATTTTAAAGTAGTATAGGAACGTATGTCTAAAGAAAGAAAGAAAC
AATGTGCCAATATGAATAAAGTAGGGTGGGGGAAGACGGGACACCTTTAGCACATACCTA
AATACCCGAATCGTGCTTTAAATAATTAACATCGGTCTATAGAAGTCGTGAAGATACGGT
TTTATAATTCTTTGAGTGTTTTTGTTAACAATCAAATGGGACAAGAAAATAGAATGAGAA
GGTGGCCCTTCTTTTCCTCACCCTATACTGTGTAAATATGCTCTTACAAGTCATTAACAA
TATATTGTAGCTGCTGCAAATCGCACGATCTTTGCTTCAACGCTGCTACGAAAAAGTGGG
CACCAAATTACTCGTCGGTGCAAATCTATTTTCACAAATACAAGATGTCGTGCCATCAAA
AATCAACGGCTTGCTGTAAGTGTTTACTTTGAGTCAAATTTCACCATCACGTTACTGATC
ACCGACCGTAATTTTAGATGGGAGCGGATTGAGTTTAGCATTGTGCGAATGCGACAAGAA
GATTAGCAAGTGTATTCATGCAGCTGGGAACTACTGTAGCGGTTTTGCATTTGGGCAAAC
GAAGAACTGTTAAAAATCAAAATAAACTTCGCAAGAAAACCTCTCTGACTTAGTGAATAA
AAATAGCTCATAAACGAATCTATTATTTCGAAACCAAAACCATTAAGCGAAGCATACTTA
AGGTTATCGAAAGCGAAGGATTGGTAATATTGCTGTCGGAAATTTCAATAGCCAATGACC
CGGAAATTGTCGAATGCAGATACTTATAAAACTATAGGTGAAAGCACAGATTTGGCATTC
TTTCGCAACAGACATTGTAGAAAATGGGTCATGTTTTAGAGTTTGCTGTACTGCTTATCT
TAATAGTTGGTTTAAGTCAAGCGAATGCTAACACAGTTTTCAGTATATTTGAAGATCACC
ACGTCAGTAAAGTTAAGGAAGTAAATTCGACTGATAAAGTAGGTAGATTACTAATATAGT
AGCCTACTGTACGTTTGTTATATGTTTCTGCTTGTTCGCCGTTAAGTTTAAAACCGGCAC
AACACAACTTTATTAAATTCGGTTAACTTTATGCATGTATAGGCTGCATTAAATCTATAT
ATAGGCTGTACTAAATCATAAATATATATGGCTAGCAAAAATCGGCGATTTTAGCACCAA
ACTAAGGTCTAATTAATTTCTGTTCCACTCTATTTTGGTTTCGTTTTTACTTGAATATTT
ACTTAACTAATTGATAGTTTGATTTTCAGTTTTACAATCGCACATCAGTTTCTTTTAACC
GAACTTACGTGCTGAAAAACGAACACCATCGGGGCATCAAAATATCTCGCGGCGTTGCTG
TATACAACTTAGGCTTCCAAATATCATGCTACTACGGTTGGTCATATACTTCGTACACTT
CCGCTACTATAGCGGCTGAGTATGGGCGCTATGGGTGCTGGTGTGGCTATAAAGGGTCGG
GGCAACCGGTAGACGCAACAGACAGGTAATTTGACATATGAACAAAATAGCTACAAATGT
ACGGTTGATATATATAGTTCTGTAGGGTAAGATGCGGTATACCGTTAGCAGCTGAAGCCC
ACATTTCCAGTTCGTTTTTTTGAACAACAGCGCGCTTTTAAAGTTACGGGTCCCCAGT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1145, 12752..12855, 12923..13078, 13450..13574, 13637..13817
1041..1145, 12752..12855, 12923..13078, 13450..13574, 13637..13749
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved