Ciona_intestinalis Locus ENSCING00000009395
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000009395
Ciona_intestinalis
ENSCING00000009395
3p
SNORD24
3280..3346
4685
CAGAAGTATGTTCGAACGATTGTGTATTGTTTTGCCATATTAGGTCGACCTATCTGATC
ATTGGTAAGACACTAAACGGCAATTTCTTCAACCGTGTGATCCATTGCAGGCTGCTTGAA
TTGTCGGTCATATAGTAGGTTGGGGGAAGATGTGACACCTTTTCATTCTATTTTCTCGTC
TAATTTGGTAGTAAACAAAGAAAATGCAAAGAATTATAAAAGCGTATCCTCACGACTCCC
CTAGATCGTTGTTAATTGTTTAAAAAACGATCAGGATATTTGGATATCATGTGCTAAAGG
TGTCTCATCTCCCCCCGCCCCACTGTATATTACAAACAATAAAAAACTCAAAAAAGTATT
TACCGATACAGTTGCATATACATGTGGAAATTTGTAAGCAGGCACGAGATGTACGTCCGT
GTTAACCGTCGTTGTCGGCTCTTTAGAGATAAATAAGTTGGTACTATGGCGTAAGTTGGG
ATATATATATAGGTTAACAAAAAATATCCCACGTTTCCTGATCGGATTATAAACAACTAA
CAACTGCATATAGTCGTAAAGCTACGATTATATAATTCATTAAATGTTTCTTGTTTTCCC
TCAATTGAAACGAAAAAGAGATTTGAAACGTCTCATCTTACCCCAATCTGTCAACGTTTG
TTTATTTATTTTGTTTTGTGCTAAAATGAAGCAAAAAATATATGTTTAACTGTTATCGTT
TTTATATTTATTGGTAATAAATATCTATAGCTATTAAAGCCCATTAAATAACTTTCAATA
CATGCGACAAAAACGTATCTGCTCCCCATCTAAAATGTAAAAACGTGTTCCATTACGGTT
CATTGATTATTGACGAAGGCGAAACTTCCCACAAACCAACTCAGTCTTTTGGATTAAGAA
GTCGTCGAGCATGGTAGGTTTATATTTGTTGGCAATATCTGGCCTAATCGTCGCCTGTAT
TGTATAAAATGACGATAATTTGTAGTTGACTTGTACCTAATGAATGTTTTGTTCAGCCGA
AGGGAAAGAAATCTCGTGGAAAGCGTGTAGCGCCAGCGCCGCTTCTTGCTAAACGTGCAG
CCGCCAAAAAGGTGGTGAATCCCTTGTTCGAGAAGAGACCTAAGAATTTCGGAATCGGTA
AGCATAACTATATTTTTGTTCAAGTTTAATTTTGAGTAAACAAATAGTTTGGTTTATGCC
CAGATTTTCTCTCAAAAATATATATTTCTTCCCCTTCGCGCCGTTTTTTGTGTTTACTGT
TAGGAATGTTTACGACAGTATTGATGCAAACGACCTATGGCTGGACTTAATTGCGAATTT
TAAAAATGTATGAATTTTGGGAAAAAGGACAATCTTGATATAATTTGTTAAACCATGACC
AACACTAACCTGATCTGTCACAAAGTTTTAAATAGTGCCTTTTTTTTTAAATAAAATATT
CCAGGTCAGGACATTCAACCCAAGCGAGATCTTACTCACTTTGTTCGATGGCCCAAATAC
ATTCGGCTACAACGTCAGAAGGTTGTGCTGCAGAAGAGACTGAAGATCCCTCCAGCGATT
AACCAGTTCACCAACACATTGGACCGACAAACTGGTATAAATTCATTATCTTAAATAATT
TTGATTATTTTAAGCGTAATTTATATTAAAAAAACAATTAAAATTGAAACAGTTCATACT
CAACATGTTTGTTGATCTCCCATTCAATTGGGTAAAGAAGTAGATTTGTTTTGTTTTAAG
CTGTTTGCTACTTTTAAATTGGAAAGTATAAAAGTTCAAAGCATCAATGATGTCAAAATA
ATTCTGCCATTATTATGCAGTGTAGTAGGTGCAAATGATATGAATTACCGTTATTATTCT
GAGGTGCTTTTGACAACCATTCTGACAGGCATTGCTAGTTGGACTGTGTTCATGAAATAA
CCTTGTTTCCATTGAAAATCTAGGTCTAAAAAAAATTGCTGTCCCTTGCAAGGCATTCAC
GTGCCTTGCAAGTTATCTGTACTTTATGTACGGAATACCCACTTCAATGATATTGTTGTT
AATTTTGGGACACTGGTTCCTTGTTAACAAATCAATTGAATTGTCGTGTGGTCTATGACT
TCTGCAGCTACTTCCTGTTCCGATTGGCAAAGAAGTATCAGCCGGAATCAAAACTGGAGA
AAAGGGAGCGCTTGAGACAGCGTGCTCAAGAAAGGTTTAAATTATATTTGTTTTTAACTT
AGTTATATTTTCACTAGCACCTATGATGTCAAAATAATTCTGCCATTATTATGCAGTGTA
GTAGGTGCAAATGATATGAATTACCGTTTATTATTCTGAGGTGACATAGTTTTAATTATT
TACTTACAAGATATCTGCCATTGAGTTAGTTCTAACAGTTACCATTTACAGAGCTGCTGG
CAAACCAGACACCCCAACCAGGCGTCCATTGGTTGTATCTTCAGGTGTGAACACGGTCAC
CAACCTCATTGAAAGGAAGAAGGCTCAACTTGTTGTGATTGCTCATGATGTTGAACCAGT
CGAGGTGCGTCATTATCAATTGTGTATTCATTAGACCAGTGGTTACAGGTTCAAAGCTTG
ATGCTGCATACATTTTAGGCCTAATAAGTTTGTTTTTTTGTAAAATTGAGTGACATTGGT
ATAAAAATGTTACGCTCATAGTTGTTAAACATAGGGAACCTCAATGATTAATGAGGCAAA
CATGGAATATTGGCTCTTGCATGTTTGTATAGAAACCTAACTACAGGGTAAAATCTATTA
TGTAATGCCAATCTGGTTTCTTAAAGAAGTCGCTCCTAAATGTTAGACTAATGATTGTAA
TGTAACCAATTGGATTGATAAGGTTTACTTAAAAGTCTTCAAGTGTTTTAAAAATAAAAG
TTCTGGTAAAATCTGTCAAAGCATCAATGATGTCAAAATAATTCTGCCATTATTATGCAG
TGTAGTAGGTGCAAATGATATGAATTACCGTTATTATTCTGAGATGCTTTAGACAGCTAT
TGGTTTATTGCTCTGTATTTTGGGGAACAGCCCATGTTATAATTATTGTTGTTGCCCAGC
AATGCAAGGATTGATAATTTGCATTCATATCCATAAATTTGTTTTCTCCAGATTGTGGTT
TACCTTCCAGCTCTGTGCCGTAAGATGAATGTTCCTTACTGCATCGTGAAGGGCAAGTCC
AGACTTGGTCGTTTGGTGCATAGAAAAACATGCACCTGCGTTGCTATCACTGATGTCAAT
AAGTAAGTATACAAATTGCTCAATGGGTGTTCAGTGGTATAGACTATGATGTTACATATA
TTTGCTATCTGAATCAATGTGGACAACCCACCAAGATCGCTGAGTCTAATGTAAAACAGA
TAAGACATAGTATTAAGTTTGCTCTACATTTGTTAATTGAATCCAAATAACAGCGAGGAC
AAAGGAGCTCTCAGCAAATTGGTTGAAAGTGTTCGAACCAACTACAATGAGAGATTCGAT
GAGGTGAGGAAAAGTTTTAATTGTTCAATTTACATCATTGCTTATTCACAAATGTGCTTG
CAGATTCGAAGACACTGGGGTGGCGGTATTATGGGCAACAAGTCCTTGGCCAGGATCGCT
AAGATTGAAAAACTGAGAGCAAAGGATGCTGCCCAGAAAGCCAGTTTGGCATAATAAACA
ATACGAATAAAATATTCAATGTAAAATTCTGTTTGCTTGATTTCAGTTTAGGAAAGCTTA
AAAGTTTTTGGTGGAGTGAGAATGAAAAGGAGCCCAAATCATACGCATGTTTGAACTTTT
AGTAGTATAAACTGTGATGGGGTTGTATCAATGGTTGGCTGCTAAAACATAATTCAGTAT
ACATTGCAGCACTGCCCAAAGAACTGCAGAAATTGAAGTAACATAAAACATTTGCTATAC
AACAAAACCACACGCAACACATTAACAACCAGTGTCTGATTTTTACAGAAACCAAGCATT
CTAAATTCACTGCATTACAATTAATTCAATTGGTGCTTTATCTCGCAGACTTACGTCTAA
GTTACTAAATGTTCGCAGCAAATGTAATTTATGACAAAAAACCTTTGGTCAATAGACAAA
TTTTGACGAAGCACGTGTACTTGTTCACACAAACAATATTACTATCACATTTTAGATAAA
ATGACAAGACTAAGTATTTCGTATTGAAAAACATACACACAGGCACACATACATTACATT
TTCATTCACTTTGCTCGCTCATACGTGGCAGACAGACTGTATGTTTCGCAGAATCATTCA
ACAATAGTCATCGTCCAGAAAAGTAATCCATAACAACAGATTGAAATGGGTTTTGCCAGA
AACATCAATCTATGCGTTATGCAAAACCATCCTAAATACATCATTGACAATGAAAAATGA
CGCTTCAAAACCACGTAGAATGAAAGTTTGACAGAAACTATGCGGTGGGTCCTCATCAGT
CTGTGAAGAATAATTGGATAAATTACTCACTTCATACGGAATATATAGGTTATAATTATA
TCATAGATTTGAACTAGTATGCCTTAAGACCTAAAGTACGTCATGGCAGTGTAAACTGAG
CTACTAGTCTACCACTTTTTCTGTTTAAATGTTTGACCAAAATAAATGTCAACAGATGCA
TAAAATTTTGACAGCAAATGAAACTAGTCATTAGTTAATCTCAACAGAATAATAAAACAC
AGTTAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1136, 1444..1593, 1717..1726, 2107..2193, 2391..2523, 3111..3241, 3413..3482, 3543..3685
1001..1136, 1444..1593, 1717..1726, 2107..2193, 2391..2523, 3111..3241, 3413..3482, 3543..3644
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved