Ciona_intestinalis Locus ENSCING00000008014
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000008014
Ciona_intestinalis
ENSCING00000008014
1q
SNORD18, SNORD18
3195..3264, 4665..4734
5958
AGGGGTTTAGTTTGTGGTGTTTTCTTCTGTGCCAACATCGTTGTTAGTAAATCAAGGTT
TTCAAAGTGTTCGCCCTTTTCTTGTTTACACACATGGACAGTATAAGCACCTTTATCAAC
CTCGTATTTGCACGATGAACCAGCTTCCACAATGGTGCCAGGAAGTTCTAATCTGAAAAT
TACATTTTTGTAAAAGTTGTTAAGACATATGCTAACAAACTCACCGAAGGTAATATGGTT
TTGCATGGAAAGCAAAGCAAGTCTCTTCAATGAAAATATCGACTTCCGACACTTTGGTAT
ATGGGGCATGTACGACTATTGTAACGGAAACGTCGTCTTGGTTAATTTGAAATTTGGGCG
TCAACATCGCTCACAATAATCCACAGGGACAGATAGATAAGATAGTGGAACACTTTACAA
ACAAAACGTGAAATGTGCTTTTTCCCGAGGGGAATTCCCCCTGAAAAGCAGTGCTTCAAA
ATTTAGTTGCCGAAAAGAATTTAAAATTTGAAAGACAAATATTTGGTGTTACGAATTAAA
AAATATGTATTTTCCCACGTCGTTTATTTTAATATGTTCATTTTGAACTATTCTTTAAAA
AAAATAAAATGACTACAATTCCGCGTTTGACCGAGTACCTTGTTTCGTGTATCACGACTG
CGTTTTAAATAATTTTATCTAATTTTAATTAGTAATATTATGTGTTTATTTAAAACGCTA
TACTTGTATAAACAATAGTTTTAAACTTTTTATTTATGTAGTATTCTTTTTAATGATTTC
TATAGTAAGTCATTATATTCATCCGCAAAGTTCATATATTATTAAATATGAAAGTATTTT
TTAATTTTACAATCATATATTGAATTTATATGTTTACCAACATATATTAATATGTTTTTG
TATTAAACGCTGCAGATATCTGTATTATTTAGCAAGTTACATACACGAACTATTTTCTCA
CATTTTGGCATATATCCGCCACGTGGTGTCCCTTCTTTCTTTTCTTCAGCGACCGAACTG
GTTTGCTGTTCATAATTGTGGGATAAAATGGTAGGTTTTTTGTTTATTTTATATATATTT
TAACTAACAACAAGTTGTATAACGCTAATATTATATCCGTGTAGTTATAAACTTTAGCGA
TGTTTGGTTATTACAAACAAAAACTGTAGTATTGAGAAGCATGTGTTTCATTTTAACATT
TCACTCTTGTATCTAAAACATACCTTGAGTGATACCTGTATTCGGATGTATAATATAGTG
TATCTTACAAGTTACAACCTTACTCATATGGAATAGTATAAACGAAATGTTGGAAACTGT
TTTATATTGGCTTTGTTTAAAAATGTTTCTGTCCAACATGCATATATTTGTTCTGTGTAT
TATAATTAGAAAGCAAAAAACTAAATGTAGCTAATTTAGAAAATATTTAATTAGTAACAA
AGTTTATATATTCATTATGTTTCAGGCTTGTGCACGGCCATTAGTGTCCGTGTATTCGGA
AAAGGGTGTTGCTTCGGGGTCCATTACATTGCCAGCAGTTTTCAAGGCTCCGATCCGTCC
AGACATTGTTAACTTTGTTCATACAAATATCAGCAAGAACCACAGGCAGGCATATGCTGT
GAAATCTATTGCTGGTGAACAAACAAGTGCAGAGTCATGGGGTACTGGACGAGCTGTTGC
TAGAATTCCAAGAGTGAGGTATGTATGGAACTTATAACATGTTGAGTTTAACTTGGACTA
TTGGTTCATGTTAAATCTGGGTTTCCATGCATTTCGTTGAGGCTATGCAATTTGTATTGC
TAACAAAGTTTATCCAATATTTCCGCCTTCTGTGTCATCCTAAGTAGTTTCCATATCACT
TCAAAAGGGGTAACACTAAAAGAGGGAAAAGGGAAAACAGGGAAAAGAGGGAAATCAACC
CTAAAAGAGGGAAATAGGGAAAAGAGGGAAAAAGGGAAAACTTGCATTCCTAAAAGAGGG
GAAAAGGAAAACAGGGAAAACAGGGAAATGCTGTTTAGTAAAAAAGCGAGATTTTTTTAT
ATTTTATTTTATTTACTTAACTTTGATAATTATAAAAAAGGGAACAGCAGAAAATCAATA
CTAACATGCAAGGGAAAAGATGAAAAATAAAGAAAAGAGGGAAAAAACAGGGAAAAGAGG
GGAAAAGAGGGAAAAGAGGGAAAACAGGCGAAAATAGGGAAAACAACACTAAAAGAGGGA
AATAGGGAAAAGAGGGAAATAGGGAAAAGAGGGATAAACAGGGAAAAGTGGGAAAACAGG
GGAAAGAGGGAAGACAGTTTTCCCCTCTTTTTCCTGTTTCCTTATTTTTCATCTTTTAGA
GGGGAAAACAAGAGGGAAAAAAGGGGAAACTGTCTTCCCTCTTTCCCCTGTCTTCCCTCT
TTTCTCTGTTTTCCCTCTTATCGCCTATTTTCCCTATTTCCCTCTTTTAGTGTTGTTTTC
CCTCTTTTCCCTGTTTTCCCCTGTCTTCCCTCTTTTCCTTGTTTTCCCTCTTTTCCCTGT
TTTCCCTCTTTTCTTTATTTTTCATCTTATCCCTTGCATGTTAGTATTGATTTTCTGCTG
TTCCCTTTTTTATAATTATCAAAGTTAAGTAAATAAAATAAAATATAAAAAAAATCTCGT
TTTTTTACTAAACAGCATTTCCCTGTTTTCCCTCTTTTCCTTTTCCCCTCTTTTAGGAAT
GCAAGTTTTCCCTTTTTCCCTCTTTTCCTTCTTTCCCTCTTTTAGTGTCGATTTCCCTCT
TTTCCCTTTTCCCTCTTTTAGTGTTACCCCTTCAAAAGTAAAATCTGGCATGTATGAGCT
AATGTAAAAAGTTTGGGCAATTAGGTTTAACAGTGAAGTTCTTTGTCATTTTAGGTGATA
GTAGATCTACTTAAGGCAAATGTTTCAATAAGTCTAAAGTTGGTTTTGGAATTTCCATTT
ATTATTATTTTTCATCATACAGGGGTGGTGGTACACACAGATCAGGACAGGCTGCGTTTG
GTAACATGTGTCGTGGTGGTCGCATGTATGCACCAACCAAAACATGGAGACGTTGGCACA
GAAGGTGTAACATCAACCAACGTCGGTTTGCCGTCTGTTCTGCTCTTGCTGCATCTTCTT
TGCCTGCTTTGGTCATGTCTAAAGGTAGATTTATATTACATAGTAAATATTGCATGTAAA
TATTTAAGCATTTTATGGAGATGATGAGCTGTACTTCAGGTCCGTGTTTTTGATACCACT
TGATATCAATTGAAGTTCTGATCAATTTTGTTATACTGTAATACACGATTAGTAGGACTG
TAGAATCAGTAAGTGAGTTTTAATTCTCCAAATAACCACAGGTCACAAGATCGACCAAAC
ACCAGAAATTCCTCTAGTTGTGGAAGACAAAGTCCAACAGTTCAAGAAGACAAAGGATGC
AGTTGTGCTTTTAAAGAAACTGAAGGCTTGGGATGACATCAAAAAGGTCTGGTTTGTTTT
GTGTTGGCGGTATATTTGTCTCTGTTATATGATCATTGGTGGTGTATATACGATAATATC
CGATAAATGGTGCTTGTACCAAATGTGGTAATTATAAAGGTGTTTACATTAAAAGTAAAT
TACCAATCTAGTACATGGAACTAAATAAAGCAAACCCACATTGTACCTTGGACATGCAGT
TTCAGGGTACTCTCTTAAGGTAAAAAATAGAAATGGTAGGGAAATATATATGTAAAAAGT
TTGGTACCAACTATTAACAGTTCCAATTTGCGGAAAAGATGGAAGTATTCAATATAAGGG
TGTCATGTTCGGTTGTTTTACATCAGCGTTCTTACAGGTGATGAAATCACGAAAGATCCG
TGCTGGTAAAGGTAAGATGAGGAATCGTCGTCACACAATGAAGCGTGGTCCTTGTATCAT
CTATGATAAGGATGAAGGAATCTCAAAAGCTTTCAGGAACATCCCAGGTAGTTATTCAAT
TTTTAATGTTTCTATACCTCATTGATTAAACCCTGTTTTCTGCTCTGCTCATGCTTACAA
TGTTCAGATTTCATACACAGGGGATATTATTATTTGTGATTCAGTTATGATACAAAACAC
ATCCAGTTCTGTATTAATTCTGTTGCACAAAACATGTGACTGTTCTTAATTCTCCTAGAT
TTTGGTAAAAGTAGCATTTGAAACGGTACTCATAAAATAGAATATTAAGCTTTATCACTA
TGCTGCATATTTTTCAGGAATCACACTGATCAGTGTTGATCGACTGAATTTGTTGAAGAT
TGCTCCTGGTGGCCACGTTGGACGATTCTTGATCTGGACGCAGAGTGCTCTCAAGTAAAT
AACTATAAAAATAAAGATTTTATGTTCTATTAAATATGATGAACTTATACTGAAAATCTG
AATCTGAAATGAAGTGAAATAAAGTTCTGATAGCTGTATTAGCAAACATGCTTTTAAATT
TAAAACTAGATCATTCTCATGTATTGTGTTTTCTCCTTTAGGCGTTTGGATGGTATCTAT
GGGACTTGGAGAAAGCCTGCTGTCGAAAAGTCTGCATACAATCTCCCAATGCCAAAGATG
ACCTGCACTGACCTGAGCAAGATTCTTCAATCTACTGAAGTCAAATCTGCCCTGCGTGCG
CCCAAGTATGTTGTCCAATTTAGTTATTTTGCTCTATTACTTGATGTGTGATGATGAGGT
AAACTTCAGGTCCGTGTTTTTGAACAACCATGATAACAACTGAAGTTCTGAAACTTAAAA
TAAATAGGAGTTGAAATTTTTACCACACAGTACCACGTACATTAATTTTATTTAACGTTA
ACAGGAAGGGAATTGCAAGGCGCTCTCAGAAGAAGAATCCTCTGAAGAACATTCGCGCAA
TGTTGAAGCTCAACCCTGCAGCTGCTTCTGCCAAGAGGTCCGCTATATTGCTGCAAGAGC
GACGCGTTCGGGAAAAGGCAGAGCTCAAAGCTAAAAAGGCTAAAGCATAAAATTTGTACT
GACTTATTGAATAAAAGTACAGACACAAACCGAGGGCATGTTTAAGCTTTATAAACTATC
AAAGTAAAGGAATTTTGAGGTAATAGTTGTCCCATTGTAGTTCAGTAAAAAGGCAAGTGA
GAAAGAAACGCCATTATGTACTGAGTGTAATAGCGTTTGTGGTTTAAAACACGTGGTGTG
TTTGGTGTAAAAGGTGAATATAAAACCATTGATTTGAAAAGGCAAATCTTAATTTTCTAT
TAGCGGATTACCATTCACATCTGTAATTTTATCGAGTCGCGGTCTGGAACCACATTGTTT
GAAGTAAAGAACATAAGCAAAAGAATTGGTCCCCGTTAATGTAAAAAATATGGAAACACT
ACTGACGTCATCAATTTTAACGCTTGAGTGATTGCGTTGCGTGGAATGTGATTCTGAAGT
TTGTCGTTTGCAATTTTGGAGTAAAGTTTTTTTGTCAAAAATTACAGCTTGTAAGACTTA
ATAAACTGCAAGGTGAGTTTATTGCGATTTAAACTGTATTCGGTTCATTAAAATACTAAT
ATTTTATATGGTTATACTGTCGGTAAGTTTACGTGGTTGCATTTTTATCATTACACTTTC
AAGGTATGAGAACATTAAAAAAGAGTTGGAACGCCAAAGAATCCTCCAAATCCAAGGCTG
AGCGAAGGAAAAGTAACAAAGAAGCATATAACAACTTCTACAAAATAGTTGTACCGTTTT
TGGCCATCCTTATTTCTTTCATTGTGCTGTTTGTATACGTTAGTACTCAGCCAGTGAAAA
ACTGATACAATGATTTTGTGAATTTAGTTTTTAATTCACTTCTTACCATCATGTAGAGTT
GTGTCATGGGGACTACTGCCATTTGGAAGTTTGCAAATGTTAAAACATTGTAAACTTTCT
AAATTACCATTGGATATCAATCAATCATGCTGTTTTTAAATCCTTGTGGCGCTAAAATGT
AATTCATACTTAAAAGTTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 1465..1697, 2962..3143, 3341..3465, 3817..3946, 4217..4314, 4481..4958
1047..1049, 1465..1697, 2962..3143, 3341..3465, 3817..3946, 4217..4314, 4481..4567
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved