Ciona_intestinalis Locus ENSCING00000003982
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000003982
Ciona_intestinalis
ENSCING00000003982
12q
SNORD111, SNORD111, SNORD111
1174..1251, 2286..2367, 4626..4707
5978
TCACATATCGAACAACATCAGCGATTGATTGGCTGATCAAAACAATTGCAATGTCTTTG
CGTGAAAGAAACAACCTGAAATACGAGCATTATTGTGAGCTTTGAAAGTGGGCGAACCCT
GGCATTAAGCATAGGGCCCAATGGTGTGACTTGCCGTGGGACCACACTCATATAAATTAA
CAAAAAAACACTGTTTTTAGTTCTTATTTTGTCTCACAATTGAACTTTAAGGTTAAATAT
ACAAAGCAACAGAGCATAGATAACATATTGGCTACCCAGCGCAAAAATCATACACATTAA
AAGGGATAATAATGCTGTACATTAATTGCAGCCTTTAAATTTTAAAATGGAACAGTGTTA
AGGTATATTATGCGATAACTTCTTACCTTAATTGTTCTTCAATATCGCCCGTTGGTGTAT
CTTTCTCAACGACCATGAAATTCGGTTGTCTGTGCTTATTTAATTCACCAATCCCACCCA
AAAGAAATCCAGTACAAGTATCTTCGTCGCCAATAACTGCCAACAACTTTCCTGCTCTTG
ATGCGGCCATTTTATTGTTTTATTAAAGAAAATATCAACAAAGTTTGTCTTGAAGGATTT
TCAATACAATTTTTGCTGACTGTCATATGATAATGAGTCAGCATTATTCGTTTGGAATAG
AAATACAATTAATAAAATTATTTAGTAAAATTGATACAATTTTTCTACTATATATGTAAA
TAAATTTTAAAAATGTAAAAATGATGGTGCAATACGTGAAAATATGTACAAAGTATGGTG
AAATCCAAGTATGACGCACTAAAAAATATGCGTTGTCACGATCATCCGGGTTTGTTTAAC
GAAAACCGCTTAGTCATTCTCTTTCAACCGACGAGGTACGTGGTGTGTTGCGTTAATTCT
TTGCAATATTATCCGCTTTAATCTGTAAAGTTAGGACATATATTCGCCAGATATTGCTAA
ATTATATTCAGTAAACAGGATTTGTATTTATTTCAGGCAAAATGGGGCGTCGTCCGGCTC
GGTGGTGAGTTAATATCTGTTATTTTACCTTGCATTTAATATTGACCAAATATACCCTTT
GTATACCCCTGTAACTAGTTGTACTTGTAATTTTTACTGAAATGTAACTTAAGTTAGGTA
TATATGATTTATTAGTGTTCCGTTAAATGTTTACTTGATCACAATGATGAAACATTTCAT
GTCTCTTCTCTGATAAAGAATGAAAGATATTTTTATTATTCTGAGTGATCTAGTTAGAGT
TAAGTTAATTGGTATACTAATGTAAAATTCATTTATAACAGCATTTAAAAATTTGTAAAA
CCTCAAAAATTAAAAGAAATGTAGGAGGGTAGGACCTAATGATTGGCATATAATGTATCG
GGTGGATTTTTAATACTTTGAGTCAACCTTTAAATAATACAATGCTGCATTTTAACGAAT
AAAACATTAATTGATTGAATATTTTCTCTCCAGTTATCGGTATTGTAAAAACAAGCCGTA
CCCAAAATCTCGTTTCTGTCGTGGTGTTCCCGATCCAAAAATCCGTATCTTTGACCTTGG
AAGAAAAAGGGCGGATGTCCGGGACTTCCCACTATGCATGCATATGGTGTCCGATGAACT
TGAACAACTGAGTTCCGAAGCTTTGGAGGCCGCGCGTATCTGTGCCAACAAGTAAGTTCG
AGGTTGGAATAATTGTGTTTTTTTCTTTGTATAGTAGGTTGGTGGTGTAATACTGCCGCT
GGTGACCAGTGAAAATTTTGGTCTCAAAATGTTCCTTACGTCTCCCTGTTACCTGCTGTA
TAATTTTTTTTAAAAAAAAACTTGGGCGTTCGTGTCGAAAATAAACTTTGAAAACGTGCT
GTTACACAATCTGCAACATAGAAATCCAACAGAGTAATTCGCATTCTATGACGTAATAAT
CTAACCTTTAACGGCTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGCACGTGCTCATGCTATTGAAGCTCTACGTAGAGCTAAGTTTAAGTTTCCTGG
GCGTCAGAAGGTTGGTTGATGTTATGTACTATTATCCACATGGTTGATGGCATTGTGTAT
TGAGGTCTACATTGGCCAAACCTCCGGTTGTTTCTGAGATTTGTAGACTCAAATCTCTGT
GCCTCCCTTGCTATTCTGTATTAGCCAAACATTCACTAGTTTATTAGCTTATATATATAT
AAGATTTCTTAGTGTGTTTATTAGCTTATATATATATAAGATTTCTTAGTTGTATTTCAT
TTGTTTTCGATCACAATGATGAAACATTTCATGTCTCTTCTCTGATTAAGAATGAAAGAT
ATTTTTATTATTCTGAGTGATCAATTGTTAGTCTACCTTAACATTAAGAATGAGGTATAT
ACACTTCTGCTTTGTGTTTAAAGTATAAAGATTATATTTCCATTTTGTAGAATGATTTTC
GCTAACTGCCACCTATTGTTTCCACCCAGATCTACGATTCACCAAAGTGGGGATTCACCA
AATGGAACCGGGAAGATTACGAGCGTATGTTAGCTGAAGGCCTTCTCATCCCTGATGGTG
TCTCATGTCAATACAAACCTAACAAGGGAAAACTTGATCTGTGGAAAAAACGACAGTAAC
CGTTCTTCGCTGTTAATAAAATATCACAGATTTCATTTTTAGCCTTTCATTCTATATGGT
TGAGAGCCTAAAGCGAGGCACGCCAGGGAAGCTTGAATACAAGGTCACTGCACATTTTGA
GCAGTCACTTTGCGATTAATGATACCTTTTTGTATCATGACGAGTGTNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCATGGAGACTTAAGGAACATTT
TGAGACCAAAATTTTCACTGGTCACCAGCAGCAGTATTACCACAACTCCTATAGACCGTT
GTTAATTGTTTGAAACACAATTATAATGTTTATATATTATGTGCTAAAGGTGTTCCATCT
TACCCCACGGTACTATATACTAACCCCTTTGTATATGCACTAACCCATAAAGTTAATACT
TTTGACATGGTCATCTTAGACTGTTATTGCAGACAAATTGGCCACTAACGTAAAAGCAGA
AACATCTCGGGATTTTTCTCGTTATATTCTTCGTACCAATTGCCTTCACAAAAGAATGTT
ACAATGATGATATTTTTTTCTTCTGATTATTTGTGAAGAGAAAACTCTCTCTTTCTGAGT
AACATTTATATAATACATGTTGGTTATAGTATGTCGGGGGTTTACACAGTTTCTGGGTTT
TTTCTCATACTTAAATTTCACACTCAAGCTCTTTATAATATGTGAAAATCATACGAAACA
CGACTTAATGTCAGTTTTAGTGTATTTGCTTTAGCATTCGCCATTCATGGTACATTATCT
TTTAGCTGTGATTTTGTCAAAGTATGGGTGCTGAATCCCTATTTGGTACTGATTGTCCCA
AATTTCAAATGACATGGTCTGTAATCTATTCCCCTTTAACCCTACTCTTCCCATTTATTG
TACAACATTATAGGACATGTGTTTGAAATGACATTTATTGTATATTCCTACTTCCCTAGG
TACATGGTTAAATACTGTGGTAAAGATTCTTTCCATCTTCGTGTGCGAGTCCATCCTTTC
ATGTGGTTCGTATCAACAAGATGTTGTCATGTGCCGGTGCTGATAGGTTTGTTGCAAACA
TTTCTATTCTATAATATGTATAAATATATTATTTTTACTTTGAAACTAATTTGCACCAAA
TATTAACCAAGTATATATTAAAGAGTTGCACACTATTACCTCAATTTTTATTGAAAGTAG
TTTATTTAATGTTACTTATTTCGAGTCACAGGTTTTTAAATTTTATCAAAGTTAAAATGT
CAAATAAAAATTGTTGTGATAGTTGTTGTTACAAAAAGAATGTTACAATGATGATATATT
TTATTCTTCTGATTATTTGTGAAGATAAAACTCTCTCTTTCTGAGTAACATTCTTAATAA
CCAAGAAGTGCTTGACCACGCTCGTACTATAGATTTTGAATTTAACTTTTGTGGCTAAAA
AACGGAATTGTTAGGATATAAATTGGTGTAAGTGTGTTGTGTAAAAGCTGGTGTTAATTG
AAAGAATACGCTCAACAAACTTACAAATTATTGTTAGTGTTAGTTAGCTGTATCTACAAT
TGGGCTTAGTAGTTTTGTCCCCCACTTCATATGTATTTGGTAACTTTACTTAAATCCTCA
GATTGCAGACCGGAATGAGAGGAGCTTACGGTAAACCACAAGGGTTGGTTGCTCGTGTTA
AGATTGGTCAACCAATCATGTCTATGCGATGCAAGGACAGTGCACGTGCTCATGCTATTG
AAGCGCTACGTAGAGCTAAGTTTAAGTTTCCTGGGCGTCAGAAGGTTGGTTGATGTTATG
TACTATTATCCACATGGTTGATGGCATTGTGTATTGAGGTCTACATTGGCCAAACCTCCG
GTTGTTTCTGAGATTTGTAGACTCAAATCTCTGTGCCTCCCTTGCTATTCTGTATTAGCC
AAACATTCACTAGTTTATTAGCCTATATATATATAAGATTTCTTAGTTGTCTTATTTCAT
TTGTTTTCGATCACAATGATGAAACATTTCATGTCTCTTCTCTGATTAAGAATGAAAGAT
ATTTTTATTATTCTGAGTGATCAATTGTTAGTCTACCTAAACATTAAGAATGAGGTATAT
ACACTTCTGCTTTGTGTTTAAAGTATAAAGATTATATTTCCATTTTGTAGAATGATTTTC
GCTAACTGCCACCTATTGTTTCCACCCAGATCTACGATTCACCAAAGTGGGGATTCACCA
AATGGAACCGGGAAGATTACGAGCGTATGTTAGCTGAAGGCCTTCTCATCCCTGATGGTG
TCTCATGTCAATACAAACCTAACAAGGGAAAACTTGATCTGTGGAAAAAACGACAGTAAC
CGTTCTTCGCTGTTAATAAAATATCACAGATTTCATTTTTAGCCTTTCATTCTATATGGT
TGAGAGCCTAAAGCGAGGCACGCCAGGGAAGCTTGAATACAAGGTCACTGCACATTTTGA
GCAGTCACTTTGCGATTAATGATACCTTTTTGTATCATGACGAGTGTTTTAATGCCTTTT
TAAAGGTTGTTGTTCACCACTTTTTTTGGCTGTATTTTTTAGCCCAAATTGTGGGCTTGG
TTTTTGTCCTTTGATATAAGTTGAGGTTGACATTGCAGAAGTATTTTGTCAGCTTTCATT
GCAGTTCTGATCTGCTTTGTTGGCTGTTGCACCTTCCAAGTTTTGGGTGGAATTCTGAGT
GATCATTTCAATTTTGTTCACTTAGAATAAACAAGTTTTTCAGTTTTGTTTTCAGAATTT
GATCTTAAAACACTGTTTTTTAAGTGAAGAGGGTTCAACATAAAACAGTGGATTCATTTT
TCACTGTTTTTGGAGAATATTACTCAATGTCGTACTAATGTAACTATTGGTACAACATGT
TATACTCCATCGTTTGTGTATGGTCTCAAACTCGCGTGTGGACAAAACGCAGTTGAACTG
GTTGTACCATAGTTTAATTAAGCCGGTTTATTAAACTATGGTGGTTAGTAGTGTGGAGGA
AGATGGGACACCTTTAACACATAATACCCAAATATCCTGAACGTGTTTTAAGCAATTAAC
AACGGTCTATGGAAGTCGTGAGGTTGCGGTTTCATTTTTATTTAAATGTTCTTTGTTTAC
TTCCAAATGGAGCCAGAAATCTTCTCCCATCCTACTAAACATGTATGGCTGGTAAACGAC
GTACTTCGTGGCATGGCAGCGTGCGGTATCGTATAAGTTGTACTAGAAATCAATGTTCGG
GACAAAACGATTGTAAACGTAAATCGGATTATACGCGTGTGTTGCGATCGTGTTCGTACG
AACTATGGTCTCCACCAGTACGTTTGGGGGCAAGGCTAT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1473..1670, 3599..3656, 3659..3705, 4261..4423, 4829..4978
1001..1023, 1473..1670, 3599..3656, 3659..3705, 4261..4423, 4829..4975
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved