Ciona_intestinalis Locus ENSCING00000011298
snOPY snoRNA Orthological Gene Database
Ciona_intestinalis ENSCING00000011298
Ciona_intestinalis
ENSCING00000011298
12p
SNORD18, SNORD18, SNORD18
2713..2781, 2871..2938, 4205..4272
5834
TTGTGGTTCTCGCAAAAGCTTCCAACGCTGTTGATGATGATGGTGTTGTTTGGAGTCGA
TATAATTGGAGTTGGAAGGGACAAGACGACCAAAAAGGTTGGCTGTTATATTTTCTACTA
GATTAAATTATTGTTGTTAAACCGAATAGTTACAGTTACTTTGGTTTCTGCCGTTATATG
GACACGTTAGGCGGGGCAACGTTAGTCGTTATAACACGGGTGTTCTGTTTCATACACCTC
GTGCCTGCTTACAAGTTACCACATATGTAACTTGTTTATCCTCGCATGACAGGGCAACGA
CAGTCGGTATAACATGGGTGTTTTGTTTCATACACCTCATGTCTGCCTACAAGTTACCAC
GTATGCAACTTACTGAGCAACCATTATTTTGGGACCGGATTTTTTTTTATAACTTTTGGC
TGACAATTTTGGCAAGGGACCGCTGGGTTGTAGAAATATGAATAATGATTACGTTTACGT
TTTTGTTTCAGTCCTAGAAGACGCAAGTTTGGAAGAGTTACACGATGCTCTTGATTTTCT
ATACTCTCAAGAATAGTTAAATACTAATTAGACGATCAAATACGCATAAATGGTTGCCAG
TAAAATAAACCATCTCGGTACAAGCGTGCTTGTGTTATATAGCGTGGAATGTGAGTGGTA
ACTAAGGGGCGAACAAGGGGGAATTTACCCCTCTACAAACTACATTTTACCATATACGTA
TTAAACGGCGGAGTAGAAATATTACTTTGTGATGGTCCAGTTTTACCGCCTATTTTTATT
TGATTGTTTAAGCTTATATACAAATTTGTTCAATCCAGTGGTTCCTTAAAGTTGTTTAAT
ATTAAACTTTCAGCCCCCCCCCCCATAAAATATCAACAAAATTAAATATTAAAATTGGTC
GTTTTGCTTTTTTGACAAAATGAAAACTAGGTTTTTTTACCCCAATAAAAAACGATTTGT
GACGTCACTTAAAACACGCTGCGAACGCAAGTTGGTGCTGTCCACGCGAGGCCGCTGTTC
AATCTGGGGTTTTGTGAAAATTTTCTTCCTTTTTAGAAACCAGGATGGTAAGTGACGTCG
GATTGTATCTGTATTCATCTTATGCTACGTTTAATATCCACAAACAGTTTCTGAACAACT
GTTGAAGTCAGTTATGGAAGTTTAGGGTTAAATAGTTAAGTTACCGGAAAGTTTGGTGTA
AATATTGATATCAGAAGCGAAAGATTTGAACTAGAGATCCGCCATTAGACATGGAACATA
CATTAGTTAACCTCGGTCTAATTCTTTCAGGCGCGTGGACCAAAGAAGCATCTGAAGCGC
TTAAATGCGCCCAAGCATTGGATGTTAGACAAACTGACGGGTGTTTTCGTAAGTAATATT
TTATATTTTTCTAAAACCGAATAATTTTGGGATATACGATATAAAGTAAAAGACAGAATA
TATCAAAATAAGATTATAACTCTCCCTTGGTCAAATGTGTATATAGATAATTTAAACTGT
TGCAACATTAATACAATATATTGAATACCTTTAAAATGTGAAACCTGAAGTTTTAAAAAT
ATTATTTTGTTGTAGCGTTTTTAAACTATCTATTAGTAAAGAACCCTTACCCCCCCCAGT
TGCCCAAAATCTGATCTGTAACTCCCGATACTTCACTTTTACCTCAAAATAATTTGTTTT
AAACTAAATTCAGGCTCCCAGACCATCCACAGGACCCCACAAACTGCGAGAGTGCCTTCC
TCTCTGTATTTTCCTCCGTAATCGTCTGCATTATGCTCTCACTTACGATGAAACGAAGCG
GATCCTCATGCAAAGATTGGTGAAGGTTGACGGTAAAGTTCGAACTGACACAACATATCC
AGCTGGATTTATGGGTTAGTTGTAAAGTTTTCTGCAGTATATAAAAGTTCCTGAACAATT
CCTGTCAATCCAATTGTTTAAAATCTGCCGCCAAAATAAGTATTTTAACAACCGAAGTTC
TAAAATTATTCGGACAGCAAAATAGTCTTGCCCTGATTGCTTTATAATTTATTTGAGACC
GGCTCAATACCTTTCACGCATTTTAACAGGTAAATTAATGTTACTAGTTTTTGAAATTAT
ACGTTGGGTATCACTGAAACTTAACAGAACTTATTTTCACCGATAAAGTTATACCTAGTG
TACAATTTTGATAATTGTATTTATGCTGTCTTTCAACAAAAAAAGTTTTAAATTTGCCAT
TTTATTTTTAGACGTAATCACCATTGACAAGACAGCTGAGTATTTCCGTCTCATCTACGA
CGTGAAAGGACGTTTTGCTGTTCATAGAATTACTTCTGATGAAGCAAAGGTATATGTTTG
ACACTACCAAGTATTGGTGGTGCCTAACATGGGCACACTGTGTATGAATGACCTAGAATA
GCTTAGGTTATGAATCCGTTTATGAAGTATATAAATTTAGGTACACACAGTAATTGGCAA
ACTCATGGTAATGAATCAATTAAATAAAGCAGTAGGGCCTAAAGACACCCCTCATTTTTC
AAAAGTTGGCGCCTATGCTGCCAAGCGTGAGATAAATTCAAAAATATCTGTTGGTAAAAA
GTTTCAATGCCCTGCTAAGATTGCAGAGGTTTAATTTCACTTCTTATTCATGATAAGAAA
TGTTGGTTTAAAAACTGAATTGCCAGTGTGGTTGTTTTAGAAGAAATTTTAAGTTAAAAC
AAACATTGTTGTCGGTTAATGATGAGTCAACTTCAGGTCCGTGTTTTTGAAACTAATTCA
TTACCATGAATTAGTTTAAATCATTTTTTTTTTTTTTTTCAAGTTTAACTATTATTGTGT
TTGATTTTAAAATAAATCATTTAATTTTAAGTTAAAACAAACATTGTTGTCGGTTAATGA
TGAGTCAACTTCAGGTCCGTGTTTTTGAAACTAATGATAACAACTGAAGTTCTGAATATC
GACGTATTGTTATATTTAATACGCTAATGTGAGTGTGGATAATGTAACAGACATAGATCA
AATCCAGTGAATTAAATTTATTTAAAATGATATATAGTTGTCTGAAATAGCATCATCAGT
CTCTTATTTAAATAGAACCACCTAAATTTAAGAAGTTTTACTTTGGTTATTCAAATAAAT
ATGTTTAAGTTCCATTTACTGATGGAATAATAATGCAGAAAAACTCAATTTGGAAATATT
TTAGTACAAGTTGTGCAAGGTGAAGAAGGTTGCCACGGCGCCCAAGGGAGTCCCGTACCT
CGTCACCCACGATGCACGAACCATTCGTTACCCCAACCCCGATATTAAGGTACACGATAC
AGTGGTTGTTGATATCGCGAGTGGAAAGATTACTGGTTTTGTGCATTTGGACAGCGGTGA
GTGATTCAAACATTTCTCTAGTAATGCATAGTCTCTTGTGTGGAAATTATTAAAAGTTGT
ATTTTGCAGCTGTAGTGAATATTTTATTATGCGATTAGTTGGACTTGATTTTTGTCAGTT
ATGTTTTTGTAGCACCAGATCCCTATAATATTTTTTAGGTTTTATGCTTGTTTGGTTTGA
AACAAATCACAGTACATTTATTACTGCATGTTTATCTGTAACAAACTTATAGCACCCAAG
TGTGTTCAAGTCTGTGATCATGGAGGGAAAAATAGCCTTTTGCATATTTGGTAACTTGTT
AGGCATGAACAAGGTGTAATAAACAGTCAAGTCACCATTGGAACTATTATGGGAGCTGGC
CCACCACGTGGAATATATGATTATATAATAAAACCCATGTAGGTAACATGTGCATGATCA
CTGGAGGTCACAACTTGGGGCGAGTAGGAACAGTTATGCATAGAGAGAGACATCCAGGAT
CATTTGACATCATCCACGTAAAAGATGCGCTCGGCCACACCTTTGCTACCCGTCTATCGA
ATGTTTTCATCATAGGCCAGGTTAAACATGCTTGCTAACCAAATTTGATAATATAGTTTT
AATTTTTTTAATGTTTACCTGGGTTATTGAACAGTTTTATTTTACTGGCTCCCAGATTTT
AGATATGTTCTGCCACAGTAAATACCAAACTTATTGTGAACTAGATTAAGTAGCATACTG
AAGCTTATTTCTTGTATGAAAAATACAGTTTGAGAAGTGATGGTTAAAATGTCTAGCAAT
ATTACCTACATTATCAATCTGACAATTCTTCACCCAAGCAAACTCATTCACAATATTTTG
TTGTCGGTTAATGATGAGTCAACTTCAGGTCCGTGTTTTTGAAACCAATGATAACAACTG
AAGTTCTGAATACCGACGTATTGTTATATTTTACTCGTACACAATTGTGGAAGTTTTATT
TGAATTGAACATTCAAATACATATATTTTGCCAGCTTGTATAAGAATACTGAGATACAGT
TTATTGAAATAACTTCATTAACATTTGATGTGGAGGGGTAAAAGTTACACCAGCTATAGC
CTACCTACCTACTACTAAATTCGTTCATACTTAACAACTAAACTTTTACTGCAAGAAATA
TTAACACAATCATATTTTTAACAGGCCAACAAACCAATGGTTTCCCTTCCACGAGGAAAA
GGAATCAAACTGACGATCGCTGAAGAGAGAGACCGTCGGTTGGCAACAAAGTAAATGCCA
TTGAATTGAGCATTTCAATAAATATTGAAATCGGATTTAGTTTTGTTTCTTTATTGTGTA
TAGCCTCAGATTGCGTAAGTTCTAAAAGCAGGCAATGCAGCCTATATAGTATGCTGGGAA
CAGACTTAATTTTATCCCAGCACAGCATAAAACTCTAGTTTGTATTCTTACTTTGGCAAT
TGAATCTGAATTACGAGATTTTAAAATCAAACCCTGCTTTTTCTGGTTGGAAAAAAATGT
CAAGTGTTTACACTTATGTAGGCTGTTGGGGATCGGGTTTTATTTCTAGAGAAAGTTTTA
AAAGGCAAGGCTGGCTGTTGTTGAATGTTTATTACAATTTTAATATGACTTTAATTAGTA
AGTGAGCTACTCTGCCAACTGAGACTTCATATGTTCAGTAGAATAAACACAATAATAGTT
AAACTTGTTTCAATGTTAATTATTCATAAACATGGAATACACAATAGACAGTATTGGTTT
ACAACTTTACAGTTATTGCACCAAATTGCAAAGGTTTTCGGAACAAATCAAAGACACAAA
GAAATTACTTACAATAATAAACCCAAAATGCACCTAATTTTACCACAAATAAAAACACAC
ATTATCGTAACATCATAGGCGTCCTACACAACGGGCAAGTGGATTGATTACTTGTGTCAA
ACCACTTGTACAAGCATTCTGCATGGTATTTTTTCTTGCATGTCTTGCATTGTAGTTTCG
GTAAGGACTGTGAGTTGGAGCCGTGCACTACAGAGAAACATATCATGCATTCCTCAAGCC
CATGGAGCCGTTTGTCAACTTTTTCCTTCCACAAATACAAAGCATCCAGTATTTGGCCGT
TCTGGTGTCGTAATAACATTGTCATCTGTAGAATCCAATATCTCCATTGAGTTGCTTTCA
CCCCTGCTTTTCTAACCGTGTTTACTTGTACAGGGCTCAGAGGGTAATTTGTTGGTAGTT
GTATTGAAATAACAAACTCTGCGTCAGTGATTTGATATGTCGCAACAACTTCTTTCGAAG
CTGGACGTGCAACAACATCAAAGTCATCTTGATTCTGCGATACACAAATCGACTTTAGTT
CTTTGTTACAAATGACACCGCTGATATGTTTTGTTGTGTATTCATTCACTGCTGACTTTG
TTACTTTCCCGAGGTCGTTATACCAAGCACGCATCAATACAGGTAGATTAGTGAGCAGGT
CCTTGAAAAGTGAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1066, 1290..1367, 1693..1873, 2231..2328, 3184..3355, 3762..3919, 4524..4834
1064..1066, 1290..1367, 1693..1873, 2231..2328, 3184..3355, 3762..3919, 4524..4610
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved