Cavia_porcellus Locus EIF3A
snOPY snoRNA Orthological Gene Database
Cavia_porcellus EIF3A
Cavia_porcellus
EIF3A
scaffold_1
SNORA19, SNORA19
19740..19868, 21121..21252
32430
TTATGCTTTCCGCTCCAGAGCTTTTGTCCTAGGCCAGCTTGCTCTGGTCTCATTTGCTT
TCTTTTCTTTTCTTTTTTTTTTTTTTTTTTTTGGTTTTGAGACAAGATCTTGCTACGTGG
TTCAGGATGGCCTAGAACTTACTATTATAGCCCAGGCTGGCCTCAAACCCGTGGCGATCC
TCCTGCCTCAGCCTCCCAAATGCTAAGATTACAGGTATTCACCACCAAGCCCAGCTCATT
CGCTGAGAGCTTCTGTTTTCAGGGCAGGTCACCAGTATTTCCCAGTGGTGAACGGTACTG
GCCTAACTGTACTTGCTCAGTATGTTTCTGTTAAACAATCCACCATTTCACATAGACAAT
ACAGGCCATTCCGTCTCTGGACGCGATTTTATTGCACATGGCATGTCTTGGTACAAATCC
TGTTGAAACTGACTATGTGCAGAGACTAGCCTTTTCACATCTCTTTTTTTGGGGGGGCAC
CGGGGATCGAACTCACAACCTCGCACTTACCAAGCAAGCGCTTGAGCCGCTGAGCTAAAT
CCCTGGCCCGAGACTAGCCCTTTGTACTAGTACTAGCTTCGATTCTAAACTCAAGTTTCC
CACTCTGGTTACTGGTGAAGGAGTGAAGGTCTAAGAAGCTCGGTCCTAGCTTCTCTCTGG
AGCCTCAAGACAGCACCAAGCATGGTTCCGCCCTCAGCGCTCCCAGACGCCGCCGCCGCC
ACCGCCACGTCAGCCGGCGCCCGTGACGCCATCGCGCCTGCGTGCCCTGGGGGCGGACCT
AGCGCACAAGCCCGCCCCTACATCCGGGGCCTGGACGGCGGTGGCGGCGGTGCCGCCGCG
CTGAGGTCACGTGACTCTTTCCTTTCCGTCGCTGGCCGGCTGGGCGCGGGTGACTGCTGG
CGAAGCGCGTGGAACCTCGCGCTGGTTCCCCTTCGTCCATTCTCCCGGCTCGGGCCAGTA
GGGAGTTAGCTGACGCTGGGTGAACTGAGCCTGCTGCCAAGATGCCGGCCTACTTCCAGA
GGCCGGAAAATGCCCTCAAACGCGCCAACGGTGAGTAGGGATGGCGGCGCCCTGGAGTGG
GGCGCCTGAGGTCTCAGAGGTCGAGGGCCCTGGCCTTCTGCCTGGCGCCCGAGCTGCGGC
CCGAGCGGAGGGCGGTGCGGCCTGCCCGCCACAGGCCTAGCCGGGGTTGGGCGCGGTTTC
CCTTTTCACTCAAGCAAACTGCTGGTGGGAGGTGCGGATAGGAGCGGTCCCCGAGGCCTT
CCTTCCGCCCGCTGCCTTCTGCTGCGCCGCGGGGACGCGGCCTGGAGCCACGCTTGCCCT
GTTGGGAACTCCTTTCTCTCGCCTGGCCCCCACAGACCCTCTGGACCAGCGTGTTTTGGT
CTTAGAATTCAAGCACCCAGTCGCTTTCTGGGAGTGCCGGGGAGGAGGAAACATGGCTCC
CTCCCGGGGACAATGCACGCGAGAACCTCGACTCCACCTCCCTCCGGGGCCCGGTGCCTG
GCGGGCCAATCCCCCCCCCCTCGCCCCGAGGCACCTCTGCTCCCAGTGGGCCGGCGTGGT
GCTTTACAGGGTCAGGGGCCACTTGGTCTCGCTCAGCCACTTTGTGTGCACTTCTGGATC
TCTGACCCAGTTAACCTGTTCCTTCGTGTTGGTTTATTTTTCTCCTCTGGTATTGATAGG
GACAGTCTGAAAGCCTATTCCTAATCACGGGAAGTTGGAATAGAGTTAAATGTTACGAAT
GGACTTTAGATCTCTCTAGATGAAGGACTAGAGAGAGGTTTTTTTACCCAAGGTCACTGT
GAGAGTTGGTGAGTCAGGAAACTTAAAAGCAAGGTCTTTTTGACATCCTGATTAATCTTT
TTTGTTTGTTTCTTTCGCCACAGCACTGTTGCCTGCTGTTTCTGTTTCCATGTACTTTAG
CCTTGGGCACCTGCAGGAAAAGCTTGCGTGTTCTGATCTGTTTAAGAGGCATTTTTACAC
TGACATGGGGATACAGATGTTTTATGCATATCTTAGGTCTTTAAAAACTGTCTTACTTAG
GGTTTTTAAAAAATTTAACCCAATATTTAAGTTTTCTAAACTTCTGGAATTCTTACTTTC
ATCTTCTGACAGAAGTTTTGGGTTTGAGCCGCGTAGTAGTTTTATATTGTATCATGTGTT
ATAGTTTTGTGTTTGGAGAACGTTAGTCTTCAATTTTTTTTTTTTTTTTTTTTTTTTGTC
TTTCTCCTTTTTATCGGTACCGGGGATCGAACTCAACGACTGCCTGCTTGCAAGGCAGGC
GCTTATGCCGCTGAGCTAAACTTCCAGCCCCTCAAATTTTATTCTATCAAAAGATCAGTT
TGTATCATTACGTACAGTTGATACTATTACTGGTAAGCTGCTAGTGCCGAAGATGTGTTG
ATAACATTTAAATAAGCTAAAAGTAAGTTTATTTGGGATGGAAATAATCTGAAATAAAAT
AGTTTGACATTTTATGGAGTGAAGTTTATTGATTAAAACCCTTTTACAATCACAAGATAG
ACCCGGTCCCTATTGTGAACTGTAATCTAATGGTTAGAATAGGCAAGTTTAAAGACTTTA
TAGAAGAGAAAATTGCAGTAGAAATTTATCACTATAAACTCGCAAAATTAGGGCTTTTTT
TGAGGCTTTGAAATTTAAAATTATGGTATACAGAATGATTTGTGTAAAATTACTGTCCTC
TTGCAGGCATTTATGTGCTTCCCCAACACTTTTTTTGCGTGCTAATAGGCTGAATCACTG
TAGTCTCCGAGACCTAAATACTGGTTTACATTTGGTGTGTTAATGATTTGTTTCCTTCAT
CCCTTCTGTTTGGAATCTTCATAGGGACTTTTTTTAAGTAATTTCTTATATTGGCAAACA
TCCTCCCCCCCCCCCCCCCGCCTTTTCTAAGTTGAAGTAGACTTGATTTCTGCAGGGCAA
ACTGGCAGAGGGTGTAAACTGTATTATTTGCTTTGTGTGTTGATTCTTTTCTGCAACCCT
GTTAAGTTTTAGGGTGGCAGTTTCTGTGGTAGGAGACATTACACTTCCAAGTGGTAACTT
CTATACCTTTGATCTGAGGATGGGGAATCCTTCTTAAAATGTCATAGGTGAGAGCAGATT
GTGCATGGAATATACCGAGTTTACAATTAAGTTGGCTGATAAAAGCATTTTACTTAAAAT
GGAAATCTCATCTTATCCAAATGTTTCTATCTGTCATATTTGTAACCCAAAATATTAAGA
CCTAATTACTGTGTTGTTTTAATAAAAATAAGTAAATTTAAGTAGGCTAGTTCTTCAAAG
CATTTAAAGCCTGCATATCAGCAATACTTTTGGAAAAAGTATAGTCATCATTAAGGAAGA
TGAGAATTTAGTCTAGCAGTTACAAGGAAGAAATTTACATCATGTAAATCATAGGGAGAA
ATACTTTTCTAGGTTAGAGTGGTAGTAGTAAACTATTTTCCTGACCCCATAATGTCCTGA
GAAGTTTATACTCCACAACCAGTGCCTTTAAGAAATAAACTTAATTAAACCCACAAATTA
TTCAACATTACAGTTTATCTAGTTGACCTTTTGCAGAAATTAATAAAAATGAAGGGCTGA
TCTAAATTAGTCATTTGTCTGAAACACATTCTAAATATTCAACCAGAAGAGTCATAATTC
TGGGTTTTAATTTTACTTTCTAGAATATTAATCTTGAAATCAGCTTTTTTTTTTTTTTTT
TTTTTTGTATTTTTGAGACAGGATCTCACCATGCAGTTTAGTTTGGACTTGAACTAAATT
TGTAACTCAGGCTGGCCACAGTTTCACCAGTCCTCCTGCCTCAGCCTTCTGAGTGCTAGG
AATACAGGTGTCCATGCCTGGCTGAAATCAACCATTTCTTTACCCATTGAAATGGGGCCT
TTAAAAAAAAGTGTAGATAGTTTTTTCCAGCCTTAACTGCTTCCTTTACCCAATTCAGAA
AAAAACAGGATAAAGAAAAATAGGATAAAAAAATAGGATAATCAGAGATTATCATGAAAA
ATGTGTTGCATTCATGCTGGGTTTAACAATGTGTGCCTGATCTATGTTACAAGCATATCA
CTTATGCTTATGTCTACTATATAATAAAGATTTAAAATCAAATTAAAGATTGGAAGTTGG
CCATTTAATAGGTCATTTTAGTGTTCCTGCTGTGGTTTTGTTAGTGTAAAGGATGTTAGA
TTAAAGTAATTAATTTTCCAAATTTTGGTCAATAGACTTGGTTAAAGAACTTTGAAAAAT
ACATAGAATACGAGTGGATTTTAGAAAATAACCTTATGTACACTCTAGGAGAGAGTAGAT
CGCTCTTCCCTTAAAACAGGAAAGACTTTGTTCTAACAAAATATGTAATTGTACTTGTTT
CATTTAGTAAGGTTTTTTTTTTTTCCTACTAGTAAGACCTAATTGAAGATGGACCTCCAA
CATTGCTGATTTTGTGCTTATAAGCATGTGAAGAATGTTTTTTGGTATAAGGGATGTGAC
AGGATATTAGGTTATTTCTTGGTATGTCGTATGATTTGTCCAGTTGCAAACGTTAGTATA
TTGGAACATTGAGAGTAATGTTTGTAGTTTCACTGCAGAAAGGAATGTTGGGAAACATTG
TTCCTGGAAGATGTGCTAGTTAAAGGAAAAGTGGTAGAGAATTACTGAATCTAGTAAAAC
TTCCAGATAAAGACTCTTTTTTCTTTCTTTCTTTCTTTCTTTCTTTCTCTCTTTCTCTCT
TTCTCTTTTTTTCTTTCTCTCTTTCTCTCCTTCCTTCCTTCCTTCCTTCCTTCCTTCCTT
CCTTCCTGCTTGTATAACACAAAAGTTACTTGGTAGATAATACTGATTTAGTTAGCCTAA
CCTTTTTCCTTTGGTGCTGGGATATGAACCCAGCATGCTTGCTCTAAAACTAAGCTCTGC
CTCCTGTCAGGTTAATGCTTAACTCTTTCTGTCACTCTGTCTCATGTTTCTCTGTCTCAT
TTATTTATTATTTTTTTTGAGACAAGGTATGTCACTTTGTAGTGCAAGCTGGCCTTGAAC
TCATTTTTGAATCCCAGGCTGGCCCTTGAACTAAATGGGGTGATCTTCCTGCCTCTACCT
TCTGAGTGCTGGGATTACAGGTGTACAGTGATTATAGTTGTGCAGTACCACATTTGGCCA
GGTTAAATCTTACAGAATAAGAACTCTCCAAGATTTTTCCCTTAATCCTAAACAATGATT
TTTAGGAAGAGAAATGTATTGTTTTTGAAGGCATTTGATAGTGTAGTCTTCTAGTTTCAA
ATTACTTTCCAAATGTGCAGTTGAAAGGTTTTTGTTTGTGCATGTGAGAGGTGTACAATT
TTAAGCTGGATTTACTAACCAGTTAAATTCTTTCAGTCTGTTGTTCATGGGAAAGAAAAC
AAAGCATGGGAAAAATTTTGACTGAGAATCATATCTTTGGGCTGAATTGAGAAAGCCCAA
TTGTATGTAAAACTTAAGGTTGGAACTTGATTTTGTAATGTTGTTACATAAAAGAATGCC
TTTAGAGTTAGGGAATAGTAAATTTAGTAGAATTTTGTTGTACATTCCAAAAATTTTCAA
GTTACTTTGTCTTGTATTTTTTCATTTTTAAAAATAAGTGTTTCGTGAGTTTGATCCCTG
GTACTGATAAAAACGAAAAAGACAAAAAAAAAAAAAGTGTTTAGTTTTAGAACAGTTTGA
TACTTCCAGATAGTATAGAGCTCCAATTTATACCATACCCATTTGCTATTAATGAGCAGT
TTATCAAAGTATATTTGTCCCAACTAATGAACTAATATTTGACATAATAAATCCACATTG
TTTTCAGATTTCAACTTCTTTTTGTCCCTTTCTCTACTGGGGATCCCACCCACAATATTA
CATAGTGGGTAGTTGTCATGTTACCTTCGCTTGTTTGTGACAATTTCTCAGACTTTCCTT
GTTTTTTCATGACTTGCCAATTTTGGGATGCACTGGTCAGATATTTTGTCTTAATCCATT
TATGCTGCTATAACAAAATGCCAAATTATGGGTACTTTATCCAAAACAGGAATTTGTTTC
TCTCATTTCCTGAGACTGAGATCAAGATGGCCAACGGTTTTGGTGTATGGTGAAGGTTGG
CTGTATGCTTCCAGGGCAGTGAGTGCCTCATTGTTGCTTCTTCTGAAAAAGATGGCTCAC
TTCTCTAAAAGCCACTGATGCATTTATGAGGGTGAACCTGTTGTAACCTAATCACCTCTT
GAAGATCTTTCCTTTTAATATTGTTGTATTAGGGATTAAATATCAATGTCAATTTTTGAG
GGACACATTACATTTAAATCTTAGCATCTTTTAGTTAGGATTTTTTTTTTTTTAATGGTA
CCAGGGATAGAACTCACTATCACTACCTCATGCTCGCAAAGCAGCTGCTTATGCTGCTGA
GCTAAATCCCCAGCCCTATTAGTTGGGGTTTTATTTATCCTGTGTTTAGACTGGAGTAAA
CAAATTGAGAGAGAGAGAGCTATGTTTGGGGACTCAATATTGCTACCAATTCTTTAAGCT
CTATAAATTTAGTGTAATCCCATTCAAAAATCATAATAAGTTATATTGTGTATACCTACA
AACTTGATTGAAAAATTTTGTATGGAAATGGACTCTAGCCCTTATAATACTAAAGGAAAA
AGTTAGAGCACTTACTACCTGATTTTTTTTTTTTTTTGCTGGTATCTGGAATTGAACTCA
GGACCTTGCCAGGCAGGCACTGTGCCACTGTGCTATATCCCCAAGTATGAAGGTTGCATT
AACGGAGACAATGTGATATTGGCAAAGACTATATATATTGATTAATAGAAAATGAATAAA
ATAGAAACCCAGAAATAGACTCACTAAAATATAGCCAGCTAAATCGGGCATAGTGGCACA
TGACTGTAATCCCAGCATTCTGGGAAACTGAGACAAGAGGATTGCAAGATTTTTCTTTTC
TTTCTTTTTTTTTCTTTTTGTCTTTTTCATTTTTATCGGTACCAGGGGTCGAACTCATGA
CCGCTTGCTTGAAGATTTTTTTTTTCCTGAGTCTATTTTATTTCAAAGAGAAGAAAAGTA
AAAACAATTTCAAAACCTGTCATTCAGGGCACAACAATAGTACATACATTGCACATTGTC
ATCCCCAAGTCTTGCACCCAGAGCACAAGATGTTTGCATTTAACTGTCCAAACAATACCA
GCACAAATCTTTTTCTTTAATGGGAAATCAGTGATGTAACTATTTTAACTTTTTTTATAT
ACACACATATGCATATATACATACACATACATTTCTTTCAGCTTCTCAACAATAGTGAGA
CAATGTTTACATGTGTGTCCAATTTATTTCCCTGAGTATGGTTTCAAGCTGCAGCCATTT
ATCTATGTCTCCAGTTTATCCTTCTTGATGGCTGAATGTAGTATTGCATTGTATAAAAAT
GCCATATCTTTTTTATCCATTCGTCTGTTGATAGGCATTTAGGTTGTTTCCAAGATCTAG
GTATTACAAATTGTGCTGCTCTAAACATGGGTGTACGTACACATATCACTGTGATATGAT
GTTTTTAATTCTTTTGGGAAGATACCCAGAAGAGGAGTAGCTGGGTGGAACGCGGCTGGT
AGTTCTAGTTTTTTGAGGAATCTCTACACTGATTTCCACGGATTGCAAGGTTGAACGCAG
TCTGGGCAATTTAGCAACTTAGTGAGATCCTGTTTTAAAGTATAAAAGTGGTCTGGGATT
GTAGCTCTGTGAAATGGTTCTGTGTTTGAGCTCCAGTGTTACCTAACTTAATCTTTCTTT
TTAATTAAGTTTATTGGTACATTTTAGGTTTACATAATGATTACACTCATTACAGTCAAT
TTGTGCCTGTACGTGATACAACTTTTTTTTCCATTCACCCACTCTCTACTTGAATTTCCT
TCTGCTCCTCAAATCTTTTTTTGTCTTTTTGAGACAGGGTCTTGCTGTGCTGTTCACAAT
GGCTTTGGACTCATGTTGTAGCCCAGTCTTTTTTTTTTTTTTTTGTCTTTTTCTTTTTAT
CGGTACCAGGGATCGATCTCATGACCACACACTTGCAAGGCAGGTGCTTATGCTGCTGAG
CTAAATCCTTAGCCTCTGTAGCCCAGTCTTAAACTTACAACAATCCTCTTACCTCAGCCT
CCCAAGTGATTAAATTAATCGTAAAGTAGTAAATGTAGTGTTTTTCTGCCTTAAGTTGTG
TAAACATTTCATCAGCCAGGTAAATGTGACTGTGAAGTAATACTTAAACATTTTGATGTT
GCTAAGGTAGTGTTTTTCTTTATAATTTAAGTTTCTGTGGTTTTTTTGTTCTGTTTTTCT
GAGACAGGGTCTCACTATTAAGTTTAGACTGGCCTTGAGCTTACTTTGTAGCCCAGGCTG
GTCTCCAACTCTGCCTTAGTCTCTTGAGTACTGTGATTATAGGTTAGAGCCACTATGCCC
AGCTACCTTTGGATAATTATAGTTTTTAAAACGGACACATAAATGTGATCTAAAAAGTTG
ATGAGTTAAGAAATTAAAGCAGCCAGTTAAAAAAGGCAAGTTTCTACACTTATGTATTAT
ACATAAATTATTTTAATTTGCCTGAATTGTTTTTTTTTTTTTTTTCAGAGTTTCTTGAGG
TTGGCAAAAAGCAGCCTGCCCTAGATGTTCTTTATGATGTTATGAAAAGTAAGAAACATA
GAACATGGCAGAAGATACATGAGCCAATTATGTTGAAATACTTGGAGCTTTGTGTGGATC
TTCGTAAGAGCCACCTGGCTAAGGAAGGATTATACCAGTATAAGAACATTTGTCAACAGG
TACAAACAGCTTGGTTTTATATTTTGAAAATGAGTAGTAATTTTTGAAAGAGTGTACTTC
TCACAGATAATGCATCTTACGTGAAAATTTTCTGTTTGAACATTTTTAGGTCATTGGAAA
TAATAGTTCCTTTTTCTTCCTGCTTAGGTGAATATTAAATCTTTAGAGGATGTCGTTAGG
TCATATTTGAAACTGGCAGAAGAAAAAACTGAAGCTGCCAAAGAAGAATCCCAACAGATG
GTATTAGATATAGAAGATCTGGATAATATTCAAACTCCTGAGAGGTATGTGAGTTCAACA
TTTAATATTGTAAGTACTTTGTTGGTTAGATCAATATTTTTCTGAGTAATGAAATAATGT
TTGAAGTACTGTTTTTCAGAAAGAATGCTTTGAAGTTTTAAATATGTAGTACCCCTAGAG
AGTTGTATAAGATAGATTGGTAATCAAGTGTTGATTGTGATATTTTACAGTATATGCAGA
GTTGGAAGAATTGATACTGTCTCACGATGATCATTGTTTTGTTAAACCATGTTACAAAGT
GGGAAATAAGGTCTAAAATTATTTCTAATGCTTTTTTTCCCCCCCTGTCATTGTAGTGTT
CTCCTAAGTGCTGTAAGTGGGGAAGACACACAGGATCGTACTGATAGGTTACTTTTAACT
CCCTGGGTTAAGTTCCTGTGGGAGTCATACAGACAGTGTTTGGACCTTCTTCGAAACAAT
TCTCGAGTAGAACGCCTCTACCATGATATTGCCCAGCAAGGTAAAAATGTCAATAGGAAA
TCTAAGTAAACTGATTTGAAAAGTGAACTTTAAGATGTTGCCAGGGTCTCACTAAGCTGT
TAAATTGCCCAGGCTGAGCTAGAACTTGAATTCTTTCTATGTCAGCGTCTCAGAATGCTG
GGATGACAAGTGTCTTGCTATCATGTCCTGATCTGTTTGTTCTTTTTAAACAGTATTATT
GAATATAGAAGTAGACTTTTTTGATGCCTGAGGGTCATCATACTATCCAGTTGTGTTTTC
CTAAATACAGTTAATGTGTAGAGGAGTGTCTGACAGTATATCACCTCTCTTCCCTACTGT
CACTTGTTCTTTTTGTGCTAAATGCTGCCCCCATCCCCAATACGGTGGTTTTGAACCCAA
GGCCTTAGAGCTGAGCTACACCTCCTGCCCTTTGTTATTTTTATTTGTATTTATTTACTT
TTTTGGTGCTGGGGATTGAACTCACGATCTTGCACTTCCCAGGCAGGCATGTGTACTGGT
AAGCTAAATTCCCAGCCCTACTTATTTTTGAGACAGTATCTCACTAAGTTGCTAAGCTGC
CTATGCTATCTTCTGTTTTACCCTTATGTACTTTGTAAGTTTAGTTCTGTAGGGATGATT
GGCATTTCTTGATTCAAATGTTTGACTTTACAACTAAGGTTGTTTTACTGAGAGTTTTGG
AACTTCATTTAATGACTAATGTGAATTTTCACTTTCTACAAGTAAACTTGTGCTTTTTGA
TAACCATTGAAAGTAAATTGAGTGGGCTCAGCGGCATAAGCACCTGCCTTGCAAGCAGGC
AGTAGTGAGTTCGATCCCCGGTACCGATAAAAAGTTTAAAAAAAAAAAAAAAAAAAAAAG
TAAATTGAGTGAGGATAAGCCTGTTGAAATAGTAGTATTGTATTTTTTATTAAGTTTATT
GGGCCATTTTTAGGTATGTGTAACGATCACATTCATCATAGGAATTTATATGTGTATGTG
ATATAACTTAATTCTTTTTATTTTTTATTTTCCTGTCTTCCTTTTAACTCTTCTTTCTCT
CCTTATTTACAAAAGTTTTATTTCTAGTTTTTCCTTCTTTTTTTCTTTTCCCTATTTCCC
TCCCCACCCCACTCTACCCCCATAATATTGTATTTTTTAAAAGCAAAGTAGTTGCCAGGC
AGGGTGGCACATGTCTGTAATCACAGCACTCAGGAGGGTAAGGCAGGAGGTCAGACTGCA
CTACATGGCAAGACACTGTCTCTAAAAACAAAAAACAGAAAACAAAACCAGCAGAGGAGT
TGTGGAAAGTGACAACAGCAAAAGAGTATGGTGTATTTCAATGACGGATCAAGTAGTTCA
CCTGAGTATCTGTATATAGAGTTGGAGTTAGGATATTATACATTTCCAGTTTGTAATGCA
TAGTTTAATTAATATGAAAGCATATTGCATTCTGTGTAAATTAACTATTGTATTTCTGCC
TAGCAGTTTTTACTCTTAGGATTTGAAGTGATAGGTCATTGAAGGGTAGATCTTCTCAAA
ATCTATTATCTATAAATTCTAATTACTTTCTATTCATAAATTTCCAGAACCATATTTTGG
TCTTAATCTAGGACTGAGGATCATGTCTTTAGTTCTGTTAGGGTTCTGAACGCTAGTCAG
AGTACATGGAATGGGTGAGGTTATGACATTCTACAACACGTTCAAAGATTAATGGTGAGT
TTAGTGAATCTTGTTAAAATAACTGATACTAATATGTGAAAATCTGAAATATTTGACAGT
GGAAAGCACTTAATATATTTGACAATTACCTCTGCAGCTTTTAAATTCTGCCTCCAATAT
ACCCGTAAGGCTGAGTTCCGTAAACTGTGTGACAATTTGAGAATGCACTTGTCCCAAATT
CAGCGCCATCATAACCAAAGCACAGCAATCAATCTCAATAATCCAGAGAGCCAATCCATG
CATTTGGAAACGAGACTTGTTCAGTTGGATAGTGCCATCAGCATGGAACTTTGGCAGGTA
TGTAGTGAATTATTAACTTTTCTTGTATTAGACCTGTCCTTAAGATGAATATGGTGGCAT
ACTACTGTAATCCTACTGCTGGAGGCTGAGGCAAGAGGATTCCTATAAGGTGGAGGCCAG
CCTGGAATATATATAGGGAGATCCTGTCTCTAAAACAAAAAACAAAAAAACCAGTTCTTT
CCCTTAATGAATGTCTCATCTTGTTATGGTTGGTTAATTTTGACAGGTAAGATTTAAGGA
ATTTAAGATTATTTGATGGGCTAGGAAGTCTCAGAAAATTTTGGCTCTAATTATCCTGTG
AAATTTGGGTCAAATGTAGTCTTTCAGATTCAGTTTCTTTGCATATAACACAGTACATTG
TCACTGTTGCTGTAAGTTTTCATGAGTGGTGTTCGTATGGACTGTTTCAAGTCTGTGATA
AAGCAGGAATTTGTAAAGTAATTTTTTGGGGGAGTGGGAGTCCTCAGAATTGAGCCCAGA
GTCTTGTGGATACGAAATGCATGCTCCCCACTCTTTGTGCCCAGTCTTTTTTTTTTTTTT
TTAAGCGGTACTGGCAACACATCTAAGATCTCTCTCCAAATAAATTGCATACCCTAGGGC
TTGGTGCATGTCTGTAATTCTCAGCCCTTGGTTTTTTTTTCCCCCCCCTTTAAATTTCAA
GATGGAGTCTAAGGTGCTGATGGTAGGCTTAAACTTGATGATCCTTCCGTCTTAAACTCC
CAGACAGGTAGGTTTACAGGTATATGCCACTATGCTCAGCTTACAGGTTTTTTTTGTTTT
GTTTTTAATAGCAATTTGATCATAATTTTGTACCTGTTTTTGGGCTTGCTATGTGGTTCA
GGCTGGCCTGGGACTCACAGTGTAGCTTTGGCAGGTCTTTAACTTAGGTTCCCACTGCTT
CAGCCTCCCAAGTGTTGGGATTACAGATGTGTGCCACTACACTCAGTTTGCCTGTTTAAT
CTGATAATATTTGACTTTTGTTTATTTGTAGTAGCTTCAAATGTAAGTGTTGTGTTGGTA
CTAGTGTGTTGAAAATTAAAAATCATATACTTTCTTTTACTGCAGCTGGAGGAGTGATGA
TCTGGAATATTTCCTTAGCAATGGTTTGGTTTAGGTAGCATGCGTGGTAAATACCACACT
TAACCAGTATTGGTTCTGGGAAGTTTATCCTCTTCCTGGCTTTTTTTCTCTTAGAATCCT
GCAAAGACATTTTCACTTCGGTTTTGTTTTGCTTTGTGACAAGGTCTCACTCTGTAAATC
AGGTTGACTTTGAATTCTCTGGATGTTGCCTCAGCTTTCTGGGTCCTGGGATTACTGGCC
TGCACCACCACACCTGGGTTTTCATTGATTTTGTAACCATGTAACTTGAGGGCTTTTTCT
TCTTCTTTTTTTGGTCTTTTTGAGACAGGATCCCAATGCAGTTCAGGTTGGCCTTGAGCT
GACTTTATAGCCCAGGCTAGTCTCTTGAATTTGCAATGATCCTCCTGCCTCAGCCTCCCA
AGTGGTGGGATTATAGGCATGTGCCACCATACCCAGCTGAGGGCTTTTTTCTATATTGGA
CCAAAAGTAGAGTTACAGAGAAAAATCCTAAAATTTTCAGCCAAGTAAAAAAGTGATTTG
ATTTCTCATTCTTTCACTTAGTATTTTCCTATTTTTTATAGGGATACTTATTTTAAAGTA
CTAACTAAACGACAAGTTAAAAACATGCTCTATGGGGCTGGGGATTTAGCTCAGCGGCAT
AAGCGTAGTTGTGAGTTCGATCCCTGGTACCGATAAAAAGGAAAAAGACAAAAACAACAA
CAACAACAACAAAAAACATGCTCTATAAGAAAAGTAGATAAGCTGGCCTCAGTGGTGCAC
ACGTGTAATCCCAGCACTCTGGGAGGCTGAGGCAGGAGAATCGTTGTGAGTTCAAGACCA
GCCTGGGCTACAAAGTGAACGCAAGTCCAGCCTGAACTATATAGTGAGACCCTGCCTCAA
AAAGACAAAAAAAACCCCAAAAAACAACAACAAAAAAAACCAACCAAAGGAAAGAAAGAA
AAATGGTTAAGCTAAAAGAATAAATGTTCATCCATTGTTTCATTACCTAGATCACCTGTA
TTCTGTTTTACATCCTTCTAGGTTTTTTCTTTATGTTGATATTGCCTGAAGTAGTATGAT
AATACTATGCAGATATTTTCTTTTTAGCCTGCTCTACTTCATAGTATAAAAGAGTTAAAT
GTTTTTGTATTTAGGACAATTTTCTCAAATATGTAGATATTGTAGGTAACTAAAAAGAAA
TGCATATTAAGGCATTTTATATACTGTTTGTATGTGTTCTTTGTCTCACGCTTCATAGAG
AGGTTTCAATTAGCTTTTTGTTTCTGTTTCATTTAATAATGTAATAATTTATTTACATCC
TGTTTTAGGAAGCATTCAAAGCTGTAGAAGATATTCATGGCCTATTTTCCTTGTCTAAAA
AACCACCTAAGCCTCAATTGATGGCAAATTACTATAACAAAGTCTCAACTGTATTTTGGA
AATCTGGAAATGCTCTTTTTCATGCATCTACACTACATCGTCTTTACCATCTGTCTAGAG
AAATGAGAAAAAATCTCACCCAAGATGAAATGCAAAGGTAGGAATGTTATAGTTGGATAA
TACTGAAAACATGAAATAAATACCTAACACTAAATGACATGACAGTGTGGTCTTAGTCAG
GCTTTCTCAAAATTTCTGCTTGGTTGAACCTAGGACTTTTACATGGAACTACACCCCAAT
CCTAAAGTTTGTATTGCCCAGGCTGGGTTTGAACTTGGAATCCTTCTGACTCAGTCTCTT
AGAACACTGTGATTTTAGGCATGCACCACTGTATCTGGCTTGGATTGGGTAGTTTTTTGT
TATTAGGTCTGTTCTGTGAGCATTCTAGGATGTTCCTGTTGCCATTTTTTCTGGATTTAA
AATATTAGGTGTTGAATGCATATGCCCCTTAACTTACACTGGAATTATATCCCAGTATAT
CTGTTTTAAATTGAAAATGTGTACTGAGGGCTGTAGTGGTGAACCTATCTATGGCTTGCA
TTCTGCAGTCAGTTGTACCATTGAAAGCTCTAAAAGATTTGCCACCACTGCATAGGTTAT
CACTTGTTTACTGATTGCATGGCTGACTGGGAGCTGTTGCTGTCTGCCTCAGTTTGCCAT
TTTGAGAGTTGGAACTTCCGTAATTAGCATGATGGGAAAATATCGAAATTCAAAGTATTA
TTTCTATTAACTTTCACACCATGGAAATTCCAGTTTTATGTTGAACCATCAAAATTTTGT
ACTCATCTATACTAGGAAAATAAACATCTCAACATATGCACAGATATTCATGAATATCAA
AGGATATTCAGCAGACCCCTTTAAAATATATGTATTTGTTTTCTTTCACATGTGAGTTTT
TTTTGTTTTTTGTGGATCTGGGATTAAGCCTACATGTTTACTTTCTAGCCAAGTGCTTTG
TCACTGAGCTATATTTTCAGTTCCTCAGTTGCCTTTTTAAAATGCATTTCAGTTGGATTA
TGACAGTTCACATACTACTTTTTTGTGTTGTTAGACCATGTTATTTGGCTTTTGGTAGAG
TTATGTACATCATGTTACAGTTTTTTTCTTCCTCCAATCAGATTGTATTGTACATTTTAG
ATATACATAATCACATTCATCATAGAGATTTGTATTTTTCAGTTTTATAGCTGTACATGG
AACTAACTAAATGAATTCTGCGAGCTGGTTTCTTTGAAACTTTTGAGGGCAGCATCCATC
ATGTTATTCACTATTATTACACTGTCCACATTAGTTTAAACTTGTTTTTATTAAAGATAT
TTAATGAAATGTAATCAAATGCATTGTAAGTATTTGGAGTTTAGAAGATGGTTGATGTGC
TGGTGTATGCCTATAATCTCAGCCCTCAAGAGGCTGAGGCAGGAGGATCACAGTGAGTTT
GAAGATAGCCTGAACTGCATAGCAAGACCCTGTCTCAAAAATAAAGACAAGCAAAAAAAG
TTTAGAAAGTGTATTACTGTAAAAGCCATTGTCATTAGTCCCCTCAAAGTATTTTCCCTT
GCTTGTTAACATTGGTTTTGGCACTTTTTTGTTTTGGGATTTGACATAAACTTTCATTTT
GTATTTCAGGCTGGCTAGCCTTAAACTCATGTAGCCAAGGTTGGCCTCAAACTTAAACCC
TGTTGCCTTAGTCTCCTCAATGCTAGGATTACAGGCATGAGCTACCAAGCCTGGCTTTTT
CTTTTTACCGCTTTCTCAGTTCTGGAAGGCTTGTTTCATGTATTTAGGAGTTGTAATAAA
AAACTTGGCAAGTGCCATCTAATAGAAAGGTAAAAAAAATTAGGTGTCCTCACCCATCTT
TTTCACTAGATCTGCACCCCTGCAATGTGGCTCATCCTCAGAGTCAAAATGGCCATGAGG
GTAAATGTGTTATGAATTGGATCAGATCAGGACAGAGAGAGGCTGCACTACTAAAAAGGA
CTCTCTGAACTATATCAGAAAGTAGTTCAGATGATGGGGAACTTGTGCTCAAAGTGAGGG
GCGGTGTTTTGAGGGGGAGTCATGGTAATACTTCTTTGACTGTAGTGCATTTTTGAAATT
TAAATATTAACTACATTTTGCATCACACCTTGTGTAGTGTTTCCATAGTAAGTACTCTTT
TAATAGGCACAATCAGATGATTTAATCTGTTTTTTGGTTTAACTTTCATAATGTCCTTTA
TTTTCAGAAAATTCAGTATCTTGCCTAAAGTCACTGAAATAGTGAAGCTAAAATTGCAAT
GCCTGACTCTTGGGCTTCAGAGCTCACAGTGTTTAGTGTTCCTTAGTGCTTAAATTTAAC
ACATTCACAATAGGACTGTGATTGTCTTTTTAATTTTTTTATTTATTTTTAATTTTTATT
TATGTATTTATTTTTTTATTGGTACCGGCGATTGAACGCATGACTGCCTGCTTGCAAGGC
AGGTGCTTATGCTGCTGAAATCCCCAGCCCCAATTTTTTTTTTTTTAATAGTACCAGGGA
TTGAACTCACAACCTCGTACTTGCCAGGCAGACACTTAGGCCACTGAGCTAAATCTTTGG
CTATATAATTCTCTTTTTTGAGAGACAGGGTTTCGACTCTCAGTAACAATTCTGCCTCAG
CCTCCTGAGTGCTAGGGTTACAGGTGTGCGACACCATGCTCAGCCATGGCTGTAATTTCA
TGTATTTTGGCTGCCAGGCAGCTCTGATTTGATGCTGATCGTTCCTGCTAGTTTGAGCCA
CATTGATACATACATGACTGTCCCAGTGGGTTGCTCACACTGCTGCTCAGGGGGCCTTTA
ATTATAACAATGTAAGAAGAGAGTTGATTATAGTCTTTTAAGGGAAATGTTAAAATGGTA
TAAAAAAATTAATATAGCTAAGTTGTGGTACAGCTCTTAATGTTAAAATTTAGAGAATTA
TTGATAAATGATTCAGACATTTCTTTTAATAGAATTGTTAGCTTATAATAATTTAAAATT
GGTATGAGTGGTATTTTTATATTTGGGCAGTAATTATCCATATTCAGACAACTAACTAGA
TAGGGTCCCTTATAAACTATTAATTTTATTAGTGAAAGACTGATATAAATGATGAGTTGT
TTGTACTGCCGGTGATGCAGGCTGCCTGATAACAGTCATCATGCATATACCACCTATGAT
TTAGTTGCTAAGAATGTGAACCTGGCCTTCTTGAGTTTGAGAGAAGTAAAAATTAAGCTT
TTGGCTCTCTCTCCTCATGTGGTTACTGTACCTGTTCACTTATAGTCCTTACATTTTTTT
GTCCTTATTGCCATGTATTTGCTTAGTTTTTAAAGTTGCCTTAGTAACTGCTTTTTCTAC
CATTTAATGACAGTCTTGTTTAGAAAAGGATAATAGTGAGTAGGTTGAACTTTGATTCTA
TGAGTATTTATTTAAGCAAAGTCTACTTTTAACTAATCCCATGCTGTGTTGAAATAGTAT
AAATATGATTAACCATGGTGTGATATATATAGTTTACTAGCATGTCACATAGATTACTAA
AGAGAACGGTCAGTGATGTTCTGCTTTTTTTGCTTATTGAACAACATTTACAAACTTAAT
GGGCTTTGTTCACTATAGAATGTCTACGAGAGTCCTTTTGGCTACTCTGTCCATCCCTAT
TACTCCTGAACGAACAGATATTGCTCGACTTCTGGATATGGATGGCATTATAGTTGAAAA
ACAACGTCGTCTTGCAACACTGCTGGGTCTTCAAGCCCCACCAACGCGAATTGGCCTTAT
TAATGATATGGTTAGTAGATGTTTGAGCATTTATACTTTGGACAGAAAACTTTGGGAAGA
TTTAGTATTTCATGGTTAAATACTGGGAATTCTGAGTCATTGTCAGGGGATATAAACGGG
CACTCTGTTCAGTTGAGGGAGTTTCTGTCCCAGTGGAATCTAGGATTAAATTGGTGAGAG
CTTTGATGTAGCAGGATGTAGACTAGTACTGTTGGACAGTCAGACTGAGGAGAAGTAACA
CTGAGCAAGAAGGACTGTGGATTATAGAAGGTTCCTAACTTAAGAACAAGTTTTGTTCTA
GGAGAATTGCTTAGAAGTCAGATTCATTTGTATCCAACAAAATGAATCTTATAATAAAAT
ATACTTGTGAAAGTTCACAGCTCAGATGTTCATAAGTTAGGGACTTAACTGTATTTTATA
GTTATAGGAAACTAATCAAGCAGACATATACATTTGAGAGATGAAGATGAAACCAGCAGA
GAAGATAAGCCAACTTTAGACCTGATTCTGTACACATGTGGTATATTTCTAGCTTCTTTC
CCTTTCAGACATTCATTTTATTTTAAAGCAGTGGTTCTTAATGAGGATCATGCAGTGAAA
CTGCTTTTTAGCTGCTATATGAACTGCTGCTACCTGAGCATATGCCCCAGGTTGTCCTTA
ATTGCAGAGCATGTTTCAGAATAGATAAGAACATCAGTTGATGGTCATGTCTTTGGTTAT
TGTAGAAACTCTTAGAGTCGTCAAAGACAGTTCCCACTGGTGTATCTTGCAGTCAGTCGT
GTCATCCCTTGGTGATGGATAAATTCCAGGTTAATTGTGGATAGCCAAATTCAGAGATGG
ACAAGTCCTTTAACTAAAATGGCATGTGATTTGCATATAATCTACACATAACTTGCTATA
AATAGAAAATAATATTTGGATTAATTACAATATCTGATAAAAAATAAGTACTGTGCATAT
AGTTATACTTTATTGTTGAGAGCAAGGTTAAAAAATTTTGAGTGCTAATTCGTGTTTAGT
ACAGATGGGAATTTTTTCCCCTGAATATATTTTTCCTCTTAGATTGATTGACTCTACATG
TGGAATCTGAGGACAGAGGGTGGGCTAACTATTAAGTGAGCAAACACTATGCTGTTGACG
GATATTTGAGTTTTCTCTGTTTAGGCTCATTAAGAATGGTGCTGCTGTGATGTTTGTGTG
ATTATTTACCTAAAAGTAAATGATTTATAAGGTGTGACATTTTACTTGTATGTTGGTAAT
AAGACAGTCTGGGTTTGCCAAATACTTAATCTTTATTTTTTTTATTTTTTATTTTTTGGT
CTTTTTCCTTTTTATTGGTACCAGGGATCGAACTCACGACTGCCTGCTTGCAAGGCAGGC
ACTTATGCCGCTGAGCTAAATCCCCAGCCCCGAAAATATTTTTATTACGTTGATTTTACT
TTCTTTTTACATTCTTAGGGGCTTTTTACTATAGGAAGATACATAATGTGGGTCAAAAAA
ATCAATAGTAGTTTGGACTGTATTTTAGTAAATTTAAAGGGGAGTTGAGGGTAGGCAGTC
TTACAATTATTTTTCAGATTTCTAGTCCCATACTTTATACCCAGTTTTATTTCAGTTTAT
ACTTAGTTTATCACAGTTGGACATTTTCCTACAGTAAATTTTTTTTGTTTTGGTTTTTTG
CTTATTGTAGGTCAGATTTAATGTGCTACAGTATGTTGTTCCAGAGGTGAAAGACCTTTA
TAACTGGTTGGAGGTAGAATTTAACCCACTAAAACTCTGTGAGAGAGTCACAAAGGTAAG
CCATTGTCTTAAGTTTTGTCAGTGCCACTGTTTTGCTGGTATTGCAGCATGGTTGAAACA
GTGCACATTTCATTGTCTTTTTTCATCTATATTGAGAGAAAAGATATTTCTGATGTGCTA
GACAACCTTTGAAGGTAAATTAGCAGCATGACTAACTTAGCCATTGCTGTCAGTCACCTT
CAGACAAGAATGAATAGCTTTATGATAAAGTTTGAACTTATCATTTGCCTGTGATTTTTT
TATATTATTAAAAAATGAAAGAATTTCTGATGTTTTAGTATCTGTTACATAGTAACATTC
TTTCTCAAATTAATGTATTTAAAAAAAAATTAATGTATTTTATAGGTTCTAAATTGGGTT
AGAGAACAACCTGAAAAGGAGCCAGAGTTACAGCAGTATGTGCCACAACTGCAGAACAAC
ACCATACTTCGCCTCTTGCAGCAGGTAAAGATGCAAATGAATGTTTATGAAGGAATTAGA
CCATAACCTCCCCCCCCCCCCGCCTCCAGCATGATAGGCACGTTACATCCCCATGTCATT
GGATATATGTTTTTTTTTTTTTTTTTTAATCGGTACCGGGGATCGAACTCACAACTGCCT
GCTTCCAAAGGCAGGCGCTTATGCTGCTGAGCTAAATCCCCAGCCCCTTCATTGGATATA
TGTTTTGATCACAAAATTAAAAGCTGAACAAACTTAGGATTGTCAAATGAAAGCCTGTTC
AAATTAGTGCTATTATATTATCATTTTGAAAACAGTTACATTTAACTGCTTTTTTCTTAT
TTTGCTGAATACTGTATTTGTGTGTGTGGGTTTTTTTTTTTTTTTTGTCTTTTTCATTTA
TTGGTACCGGGGATGGAACTCACGACCGCCTGCTTGCAAGGCAGGTGCTTATGCCGCTGA
GCTAAATCCCCAGCCCCTTGTGTGTGTTTCTTGTTAATGATGTGGTGCTACCTTTATTTC
TTTCAGTACTCACAGTGGTTTTTTTTTTTCATAGTAATAACAAACCTTGTAGAAGTTTCA
GTGAATAAAGCCTGTTGGGGCATGAGTACCATAGGTTTGCCACCACTGGTATAGTGTATT
TAATGCAGAATATATTAACAAAAACCTGGATTTTGAGATTTTTACCCATGTTAGAAAGTA
CTACTACACTTTGAATATTTTGCCTAAGTTTGTCATTCAATACAGAAGGACTTTGTAGCA
TGAGAAGTGGAATTAGTTACATAGTTTACACAGTTAAATCTTCAGCTGCTTCCTCAAGTC
TTAATAGAGTCCCACAAATAATGAATAAGACATATTTTGTCTTCTGCTAACAGTAGGTAT
TAGTATCTTCTAATGTTGTATTCCACCTTGGAGTAAGTTTAAATGTTATGGTTTATAATG
GCTTCCGTGTTCCTGGTTTTGTTTTACTTGGGAGGAGAGTTTATTATGTTCACTTAAGTA
TATGCACATTTCATTGACCTGCTTTCTTTCATATATGTGAGCAGTGTTATTTCTTATGTG
CTATACAAATATTTGAAGGTTAATTAGCAGAATAACTATAAATAGTAATGCTGCCAGTCT
CCTTCAGACAGAAATTTAATGAAGTGTTTAAAGATTAGACTAGTAGCATCTTTATCTACA
AATATATGACTTTTAATTTTGTTTTACAGAAATATGACTTCAAAAGTAACTAGTATAATG
TGATGGGTCATAGCATAGAATTTGTAGTTGATAGTCTGTGACTGAATTTCAGCTTCAGTG
TCCTGTTAAGTGTCTGAGTTTTTATATGTTTAATTGTCTGAGCTTTAAATTTTTTTTTTC
TCTGAACAGTGAGTAAAATTTCCCAAGGCTATCATGAGATTCTACATGAAAAGTACTGAA
TGAGTAGCAGCTATTATTATTAACTCTGTGTTTTTTATGCAGGTGGCACAGATTTATCAG
AGCATTGAATTTTCTCGTTTGACTTCTCTGGTTCCTTTTGTTGACGCTTTCCAACTGGAA
CGGGCCATAGTAGATGCAGCTAGGCACTGTGACCTGCAGGTATGTATACTGCCTTGACCT
TAGCTAAAAGGCCGAGAAGCGATTTATAGGTTCATACTGTAAGGGCAGGGGATATTGGGG
AGGGCAGAAAGGTTTTGAGAAGTAGAAAGACATGCTGCTTTTCCTACAATGGCACTTTTC
TAAAGTTTTACTGAGTAAATTTCATAGCTTTGATACTTAACATTTTCTGCATTTCTTTCT
GAAATTCAGCTGAAAAATTTTAATCAAGCCATTGGTAAAACTGGGTGTGGTGGTGCAGGC
CTGTAATCCAGCACTCGGGAGCCTGAGGCAGGGAGGTCACTGTAAGTTCAAGGTCAGCCT
GGGCTACATAGTGAGAGTCCCTGCATTACAGAGTGAAGACCTTGTGTCAAAAAAATAAAA
AAACAAAGCAAAAAGCCAGTTGTAGAATGACTTAATGTTAACACATTGTTTTAACTGTTA
TTTACTGTGTTTTCAAAGGTTCGTATTGACCACACTTCTCGAACCTTGAGTTTTGGATCT
GATTTGAATTATGCTACTCGAGAAGATGCCCCAATTGGTCCTCACCTTCAGAGCATGCCT
TCAGAGCAGATAAGAAATCAGCTTACAGCCATGTCGTCAGTACTTGCAAAAGCACTTGAA
GTTATCAAGCCCTCTCACATATTGGTATGCATCTTCAAGGAAATGGTTCACAAATGTTTT
GAAGGGACTTAGATACCATGTCTTTCAACAGTTTGATCTGAGAGAAGGACTTACTTGTAC
TAGGTAGTTTTGTTATTTTATGAAATATCTTTAGCAGATATTTAAATTGTTGAACTTTCT
GTGGCATAAAATAGTACACAGCACAAGCAGGGTAGTAATAATGGGTAGTGTTGTGTAAAC
TAACACACTGCACACACCATGGCCCTCAGAATAGTGAATTGGGCTTTTTCTTAAAGTATT
AGTGTGTTCTCCTAATATTTTGTCTTAAATGCTTAGGGTTGATTTGGTGCAGAGATGTTG
GCTCAGCACATAAAGGTGGTTCTTTAGCTATGTCATTGTTAGTTAAAGGCTTAATAAAAA
TAGTGCGTTAGTATTTAGTACTAGAAAGGAATAATTTGGATAATACTATTCTTGGTATAA
AATGCAGATATGTTGGAGAAGAGCAGATCATGATTATTTTATAATGTCTTTAATATCTAA
TACCAAGGTATATTGCTTTCAGTGTCTTGTTTGTTTTTGTTTTTGGTACCTGAAATCTAA
CTCAGGACCTTGCACTCGCCAGGCAGGCACTTGTGCTGCTGAGCTATATCCCTGGTTCTT
CAGTTGTTTAAAATGTGTTTATTTTTGAAGCAAGAGAAAGAAGAACAGCATCAGTTGGCA
GTTACCGCGTATCTTAAAAATTCGCGAAAAGAGCACCAGCGTATCCTGGCTCGCCGTCAG
ACAATTGAGGAAAGGAAAGAACGGCTTGAAAGCCTAAATATTCAACGTGAGAAAGAAGAA
TTGGAGCAGAGGGAAGCTGAGCTCCAGAAAGTACGGAAGGCTGAAGAAGAGAGGCTGCGC
CAGGAGGCAAAGGAGCGAGAAAAAGAGAGGATCTTACAGGAACATGAACAAATCAAAAAG
AAAACTGTTCGTGAGCGTTTGGAGCAGATTAAAAAAACAGAGCTGGGTGCAAAAGCATTC
AAAGATATTGACATCGAGGTATGTAGTTTATCGCCCAGTAAGATCTGAATTTTATCCAGG
TCTTTTTAGAACATAAGAATCTTTTATTCAGTTGTTTGGTTATTTCATACATTTCGTTAC
TGCCAGCTTTATTAACTCAATCTAAAAGCATTTAGTTTTAATTGCTCTGTACCTTTTAAC
CACTAATCTTACAGTGGTAGAGTTTGACTGTAAACTGTACGAGTCAGAAATAGAAACAAG
GTTATTAAGTATGGGTGTGTTGGTGCACACCTGTAATCCTAGCACTTGGGGCAGCTGAGT
CAAAATTGTTGTGAGTTCAAGCCCAACATAAGCTACGTAGCAAAAAAAACCCCCTGTACT
ATTGTATAGTAGCTTTGTATTTCCTAAATTGGCACCAAAAGAACACACCCCCAAAAGAAG
CACTTGTGAAACAGCAATTTAGCAATTTTGATTCTAGAGTGCAGTCAGATTTGTTGACTG
CTAAGTGTGTTACTAAGGAGGAGGACATACTTGTATTTTCTTTTAGGACCTTGAAGAATT
GGATCCAGATTTCATCATGGCTAAACAAGTTGAACAGCTGGAAAAAGAAAAGAAAGAACT
TCAAGAACGCTTAAAGAATCAAGAAAAGAAGGTAAATGGAAAGAAAAGATCAATGAACTA
ATGTGTTATAAAGATGAGTTAAAAAGAGATCCTTTTAAAAATGCCATATGCTTTGATGTC
ACTCAGATTGACTATTTTGAAAGAGCTAAACGTTTAGAAGAGATTCCTTTGATAAAGAGT
GCTTACGAGGAACAAAGGATTAAGGATATGGATTTGTGGGAACAACAAGAAGAAGAAAGA
GTAAGTTGTTTTATTTGACTGTATTTTAGATTTTGTTTTTTGTCTTTTTCTTTTTTATTG
GTACCGGGGATCAAACTCACGGCTGCCTGCTTGCAAGGCAGGTGCTTGTGCCGCTGAGCT
AAATCCCCAGCCCCTGTATTTTAGATTTTAAACTTTAAATCCTCTGCCATTAATGAAACC
AGGGTTTCAAAATTGATCGTTGAAAATGGTGTTTTAATGACTGCTTAGTAACAGATTGGT
GGAAAAATAGAAAATTTCACAAGGGATTAATATACTAAAACACAACTAGAAAGCTTATTT
AAAAATATTTTTAAATGGGTTAATTATATGGCATGGGTATATAATTCATAGTTTTTGCTT
GAACTGTACAACAGTCACCACAATCTTAATTCCAGAATACACCCCAAAAATCCTATACCT
TTTAGCAGTAATTTTTAGTCTCCATTTCCTTCTTACCACCTTAGCGTTAGGGAACTACTA
GTCCACTTTTTGTCTTTAGATTTACTGTTCTGGGTATTTCCTATAAATGATGTAGTCTTT
GTGACTAGATACCTCACTGTGTAGTATTGTTGGTCTACATAATACTGATCTTCTGGTATA
AAAACAGGGTTTACCACAGTGCTTGCCTGGCAAATGTGAGATTCTGAGTTTCATTCCCAG
CCCCTCCACAAAATAAAAATGGTTTGTAAATGCTTATAGTGGCCAAAAATGTAGAACAGA
TTACACTGATAGTAGTTTTAAAAGTAACCTTAGCAAGAGTTAACAAAAACCTGTGGGGAT
CTTGGGGTGGCAATCAGTCTTGTAATTCTGTGTCATCTGATGGTTGCCATTGAGACAGTG
TTATTCTTTCTTTAAGTTTTTAATGGAAAAGAGAATTTTTGTGGTGATTCTCAATATATA
ATATAAAGCTAAATAGAAATAGAAGAGTGCTACAGATCAGCTAACATGCATACAACGATC
TGGGGCTTTTTTTTTTTTTTTGAGATAGGGTCTTTGAAGTAGTTCAGGCTAACCTTGAAC
TTGTAGCATTCTGCCCTACTTTTTTGGTGGTGGTGGTGAGGTGTTACTGGGGATCAAACT
CACAGCCTCATGCTTGCCAGGCAGGTACTTAAACCATTCAGCTAAACCCCCACCCTCTTT
TAATATATGTATCTTCAGCTTCTAGCTGTTTTCAGAGAACATGACTTTAAAAACTAAACC
ACTGTGCTTATTAAAACACATGATACTTATTTCATTTTACTGTATATATTTCTTTTCATA
AAAATTTTAGATATCTTTGGGTTAAATAAAAGCTGTCTGTAGATGCTCCAGGCTTGCTTT
CATTTGTCTTTTGTCTCTAATTGCCATCGTAGGAAACTGCTGTTGTATGACAAGATGGAA
AGTGGGAAAGAGTGGCTTCTAATTTTTAAAGAATATCTGCTAGTAATTGGGGATAAACAG
AACATGCTTTGAAATTTAACTGTATGTTACGTACTTGCAGATTACCACTATGCAGCTAGA
ACGGGAAAAGGCTCTTGAACATAAAAATAGAATGTCACGAATGCTTGAAGACAGAGATTT
ATTTGTGATGCGACTCAAAGCTGCCCGGCAGTCTGTATATGAGGTGAGGATACTGGTTTT
AGAGAAAGTTTGTGAACTTTTACCTTAAGTAGTCTCTTTTCAAAATAGTAAATCCTGCTT
TGAATTACATGTCTAATTATTAGTCAAATTATATTGTAATAGCATTTCAGGGGGAATATT
TTATAAGGAAAAATAGTCAACCAGATGAACAAAGGTGACAGTTGCCTACCTTAGTTTCCT
TTGGTAACAAGCTTTTGTTTACTGTTTAAATCAGGAATGAAAAACCTAGATACAAGTATG
TTGGTGTTAAAATTCTAGTTTGTTTAAAGAGATGGCCACTGAGTTAGATAATATCGACAA
TCTTAAATGTCTTCCCTTTACCCAGAAGTATTGGGGATTGAATCCAAGAAGTGCTGCGTC
ACATCTCTATCCCTTGTTATTTTTGAGACAGGGTCTTGGTAGGTGCCCTGGATGGGCATG
AACTTGCCTTGTGAGCAGTGTATATCATTTCACCCAACTCTGACATCTAAATTTTTTATA
TTTTGACATACTCATTTGGGAATTGAGGGTTTTTAAGTTGGAAGTTCCTTTCTGTGGTTC
CAAGAGACTGAGTCTTTTTTTTTTTTTTTTTAATTGATACCAGGGATTGAACTCATGACT
GCCTGTTTGCAAGGCAGGCCCTTATGCTGCTGAGCTAAATCCCGAGCAATTGTGAGTCTT
TTGAGTAATTTTTTTTTTCTTTGTGACTGTTCAACTGCAGGAAAAACTTAAACAGTTTGA
AGAGCGATTATCAGAAGAAAGGCATAATCGCTTGGAGGAACGTAAGAGGCAACGTAAAGA
AGAACGCAGAGTAACTTACTATAGAGAAAAAGAAGAGGAAGAGCAGAGGAGGGCAGAAGA
ACAAATGATAAAAGGTAATCATATAGGCTGAAATGGGAGAAGAAGAGTGCAGTTAATACT
GGCAGTCTTAGCAAATATAAGAACACAGATGACTGGCCTTTTAGCAATAGTTAACTGGGT
TCTTTGAACTAGTTTGTTATATATGTGAAGATACTGCATCTGTGAACTTGTTTTTATACA
TTTGATGTTATTTTAAATATGTAAATTTTCAGTTTTTATTACTGTATTTTTTGTAGGTGT
TAGCATTTATTGAGTAATGGTTGACAGATGAAGGTGTCAGGTGGTCTTGTATCTGGAGTC
CCAGCTGTGCAAGAACGGAAAGAGGGTTTCTAGCCTCCTGACTGTTAGAAAACTTGAGCA
GCATACTTGCTTTTCTTAGTATTGTCCACCATTAGCTGATTACCAGCTATTTTAAAATTC
TTAAAATTTACTTCTAGTCTGTGATTCTTGTTTAGTGCCAGAAAAGTGGACTGGCATTAC
AGAAAAGGTGCTAGTGTAAGGCACGCTTAGTAACCAAATATATTTTACAGAGCGAGAAGA
GAGAGAACGTGCTGAACGAGCAAAACGTGAGGAAGAGCTTCGAGAATATCAGGAGCGGGT
CAAGAAACTAGAAGAAGTGGAAAGGAAAAAACGCCAAAGGGAGTTGGAAATTGAAGAACG
AGAGCGTCGTAGAGAGGAAGAGAGAAGACTTGGCGATGATTCACTTTCTAGGAAGGTGAG
TGTAGAAATAATTGCTTTACTACTACTTAAGAGGTTGACACTGGTTCTGTTTCGTGAGCT
AGCCACGTAAGCACCCCTAGACGTGTGTTGGCAGATTCCCAGCCCACTAAAGCTTCTGAC
TCCACCTGCAGGTTAACTCTACTCCTAGATGGTAGAGAATTTACTTCTAATATGCATGAG
AACGGTATATTCTGTTACAGCTCTTGAATTTTGTGTCCTAATTCATGATTTGTTACCTAC
ATATCACAGGACTTTACATTTTTGCCTTATTGCAGATTTTTCTATTGTTTCCTGGTCCCC
TTGTTAGTCTCCACAGTCACCCCCCCGCCACGTGTTCTCTACATCATTGACGTGGTTGAT
GTTTTTTCAAAATGTGGTATCTTCATGGCTTTATAGATGTCTTACTGCAACAAGCTGGAA
GTTTTTGTATCAAGATCATTATATGATTCTACATGGAGCTCTTTGGTGCTTGCTTTATGT
TTTATAGTCATTTTAGCAAACATTTAGGCCCAAATATGTTTGTACTATGTCATGTTTTTC
TCTTTGCAGATGTTTCTGTTGTCTATATCTCAGTTATATCCAGTTTTTTTTTTTTTCCAT
GTGTGCCTCAAAAGGATTTCTTTCTCATAGTTGAACCATGGTTTTGTTTGGCTAGTTTAA
AATCATCTTAGAAACATGAAGATCTTTACTTTGTTTCTTTTTGTATACAATATCATAGAG
ACTAAGGTTTTGTTAGTGGTCTTGTTACTTCTGTAGATTGTTTTAGTCTGTGGAAACTTC
TAGGTTTCTAGTTTCATGTGTTTTTTTTTGGTCTTTTTGAGACATGGTCTCGCTATGCAG
TTCAAGCTGCCCTTCAACTCTCAGTAATCCTCCGGCCTCAGCCTCCCCTGGAATTTTCTT
TATCTTTACCATGAAAGAAATTTAGTAATTTCACCTAAGACTATGTTTAGGCTTATTCTG
TACAATATTCCCCCCCCCCCTTTTATTTTTTCATTTTCATCCTTTGAATTTAGTTTCTTT
AGAGAAGACAAAATTTCTTTCAGGAAGGGGCCAGGGTTTTAGCTTGCTATAAGCACCTGT
GTGAAAAGCACTAGGTCGTGAGTTCCATCCCCAGTACCAAAAGAAAATTTCTTTAAGGAA
ATGTTTCTCCTTTTTCTGGTTTTGCTCTAAATCGTCTTCATTATATCTTTTTTCTTTTTC
TTTTTTTGTCTTTTTCTTTTTTATCGGTACCAGGGATCGAACTCACAACTGCCTGCTTGC
AAGGCAGGCGCTTATGCTGCTGAGCTAAATCCCCAGCCCTATTCATTATATCTTTTAATG
TTTTACTCTTGTCATTTTTTTTTTTTTGTGGGAGGGGGTGCCAGGTTGCCTGAATCTGGT
TCAGTTTATATTTTACCAGTAAACCACATTCTGATCTCTTGGCCTTAAAAAACTTGGTAA
TGTTGGGGGCTGGAGATTTAGCTCGGCGGCATAAGCACCTGCCTTGCAGGCAGGCAGTCG
TGAGTTCGATCCCTGGTACCGATAAAAAGGAAAAAGACAAAAAACAAAACAAACAAACAA
ACAAAAAACTTGGTAATGTTAATTCTTTACAGCTACTGTAGCATCCTTAAAAACCTTGTG
TGAGGTTCTGACATTTTTATTATATCCTCTAATCACTGACTTCTTTGTTAAGTCCTACTG
ACAGGTGGATGTGAGGGTGGTAGTAACATGGTCTTCTGGATATGGACGTTTCCCCATAGT
AGTGACAGTTACATTGACTGTATGTTGGTATTTTCTCTCTGTGGCTACTTTAGAAAATTT
CTTAGGATACCCTTCATCTTAAGATACAGTCCAGAGCTGGATGTGATGGCAAGGGACAGA
CTTTTTACCTGGCCCTGTTTGTGTCCCTCAGCTTCTCATCTGTGATTTTTAGAGGGTTTC
ATTGTCAGGGTACTTAAGGGTCTCTTACTCAGGAAATGTACTTGTGATTGAGGATCACTC
CTAGCTTGTAGGTTTTTATTTTAATCTGTCCACTGTACTGCCAAGTCTTGTTTTAAAATA
TCAACCAGAAAGTTCTACTTGCCTGATTGTAACCTTTGATTGCCTTTATTGGAACAGTAT
AATTGCATCAGAAGGTGTTTCTGAGCAGTGTTTACATTCATCCATAAGAAGTGAGACCAC
ATTTGCACTTTAACTATTAGGGATGCTGAGTATATTTGTTATTTCCAGTTTTTTTTCCTT
GGCTTTTTGATACAGGGTTTTGCTTATGTAGGGTACACTACAGTCATGCCAGCCTCACTG
TCTTGGGTGGTGAGGTTATAGATGTGTGCTACCACATTGGCTCTTCCTGAATTTTTTAAT
CGCAGCCCAATGCTTTGAGAAAATACTAGTTAAAAAACTATTCCATTAGACATTGCATTT
AGTCTACTTTTTTATGCTTTGATTAGGTGTTTCATCTTGTTTATAAAGCTGTCCACAGTG
TATGAGAATAATAGTTTTGCTGTGCTGTCGGTCTGATTTCAGATTTAGAAAGGATATTTT
TAAAATATATGCTTGCATTTAAACATTTGGAAGTTAAGTTTGAAAATATTTGGTGATTCT
AGTGCTAATAATAAACCATTGTCACTGTGGTGCCTCTTGCCCTGTTTGCTATTGCAGGAC
TCTCGTTGGGGAGATAGAGACTCAGAAGGCACGTGGAGAAAGGGACCTGAAGCTGACTCT
GAGTGGAGGAGAGGCCCACCCGAGAAGTAAGTGAAGCTGTGAAAATATATATTCTCCTAG
TCATACATCTTGTGGTTTTTAACAAAATCTGATTGATTTTGTAGTGATGAAGAAAGGAGA
GCCATGAATAATTACATACTTGTCTTTTAACTGTTACTGGACATTTATAATATATTTAAA
CATTATCATGATGACTGACATAAATATCTTGAAAAGTAACTACTTTCCCCCTCTTTTTTG
TTGCCTGATCTAACAGTTTAGGTGGTAAGAATGAACAGTTCCATAACATTTTTCCTCTAG
ATTTGTAAGTACATTGAACCATCCTTTAAAATAAGGACTGTTGTAGGCAAGAATGTAAGC
TTTAATGTCCATTCAGAAACTGGGTTTAGGCAGATTGTTGTAAAAGATTTAGCAGCTGCC
AGCATGTTTTTGGGGAAGCACGAATGGCAATAGCCAGCTTTTAGGCTATTGCTGTTTTGG
TTTATGTGTTTGTGTAGGATACCAGGTCTTTTATTTAACTTAGTAAAGATTCTTTTAAGA
ATCAGGATTAATGAATTTATTAGACTGGTGATTTTTTTTTTTTTTTTTTTTTGTTAAGAG
TCAAACAGTTTCCCCAAATATATCAATATATCAATTGGCTTTTTGAAAAAAACTTTAAAA
ATGTGTTGCTTGTTCCTCTGTAGGGAGTGGAGACGTGGAGAAGGACGAGATGATGAGAGG
CTTCATAGAAGAGATGAAGATCGCCCACGGCGCTTGGGAGATGATGATGAGAGAGAGCCT
TCTCATAGACCAGATGATGATCGGGTACCCAGGCGCGGCATGGATGATGATAGAGGACCC
AGACGTGGTCCTGATGAAGATCGCTTTTCTCGTCGTGGAACAGATGATGACCGACCTTCT
TGGCGTAACGCAGATGATGACAGGCCTCCCAGGCGAATTGGCGATGACGACAGGCCTGCC
AGGCGAATTGGCGATGACGACAGGCCTCCCAGGAGAATTGGCGATGACGATAGGGGAAGC
TGGCGTCACGCAGATGACGACAGACCACTTAGACGAGGACTGGATGATGACAGAGGAAGC
TGGCGAACAGCTGATGAGGACAGAGGACCAAGACGTGGGATGGATGAGGACCGGGTGCTG
AGGAGGGGAGGTGCTGATGATGAACGATCATCCTGGCGGAATGCTGATGATGACCGGGGT
CCTAGACGGGGCCTGGATGATGACCGGGGTCCCAGGCGAGGGTTGGATGATGACCGAGGA
CCTTGGAGGAATGTTGATGATGATAGGATCTCCAGGCGAGGTACAGATGATGACAGGGGG
TCTTGGAGAAATATGGATGATGATCGGATTTCCCGACCTGGTCCATGGAGACCATATGTT
AAGCCAGGTAAAATTCTTGTATTTAGTTCAGATGCTTTATGGAATCGATTTGATGTGTTC
ACATGTAGGGAATGAAATTTTAATGAATACTGACAGATTGGGCTATCTGGTCACTTTTAG
TATAAGTGGGTCTTTTTCCTTACGTGCTTTCAGCAGTGACTGGAGTACCACACTCCAAGA
TAAATACTTTTCCTGTCTTTAGTGATAGTCTTTTTTTCCTTCTGTCCTTCAACTGCTGCT
TTGGAGGGTCTTTTTGCACCCATCCATTAAGTTCTTTCAGGACCTACCTCCTCTTAAAAA
TAACTAGAAGTCAAAAATACCCTATTTAAGTATTTGTTCATACACTGCCCACATACTATT
ATACATGGAAGGTTTTATTTTGTTACTTTCTTAGTCCTGAGTCTGCTTATGTTTTTACAG
TTTATTAACTTTGATAAATTGTGTATCTGTCTATGACACATTTCTGTTAACATCTTTTGA
TTACTGCATGCAGATGACAAGTACATATTGTATGTACAGCTCAACTTCAGTTACAAGCCT
ATTGACACTTTATACTCAACCTTTGCAAAATGGTATTCATTGCCTTCCCAAAAAACACAC
ACCTGCTTTTCTCTTTAGGGGGTACCACTCTGAGAATTCCCTTTTACTCTAGGTTTTGTT
TCATTCTTTACATGAAATCTGATTTTTGCCTTTTTTTTTCTTTTTCGTGTTTATCGGTAC
CAGGGATCGAACTCACGACTGCCTGCTTGCAAGGCAGGCGCTTATGCTGCTGAGCTAAAT
CCCCAGCCCCGATTTTTGCCTTTTTAAAAGATTTCTTAAATCCACCTACTTATGCATTAA
CCCTATTTGAGCTTTGGCCACTATCATCATTTCTTTGAGCTTCTGCTGCTGCTGCTGCTT
CTGCTTCTCCTCCTGATTTCCTTCTTTGTCTTTCCCCCTCCCCACTTCTTTTTTCCTTTG
TTTTGGTCCTTTGAGATAAGGTCCACTATGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1049, 8628..8818, 8967..9103, 9416..9579, 11377..11576, 13988..14196, 17718..17889, 19570..19674, 20025..20123, 21582..21698, 22158..22343, 23010..23357, 23866..23970, 24066..24179, 25660..25782, 26500..26653, 27170..27354, 29997..30085, 30743..30991, 31052..31430
1001..1049, 8628..8818, 8967..9103, 9416..9579, 11377..11576, 13988..14196, 17718..17889, 19570..19674, 20025..20123, 21582..21698, 22158..22343, 23010..23357, 23866..23970, 24066..24179, 25660..25782, 26500..26653, 27170..27354, 29997..30085, 30743..30991, 31052..31430
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved