Cavia_porcellus Locus DYNC2LI1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus DYNC2LI1
Cavia_porcellus
DYNC2LI1
GeneScaffold_974
SNORA2
7032..7162
36322
TGTCCTTAATGCTGCTTTGTTCAAAGTTGCCTACCAGGCTGGAGGTATAACTGAGTGGT
AGAGTGCTTACCTAGCATGTAGAAGGCCCTGAGTTCAAACCACCCCCAACACACACACAG
CCAATCAGCAGTTTACCACATGATAATAATAAGAATCCATCTTACAATATGCCATATATG
CTTGTTATGTTTCACATAATTTATCTCATTTAAAACTACTAATCATTCTTGCTTCACCAG
ATCAGAAACTAAGGGCTCAGAAACACTAATTGACCAGGTGTGGCAGTATGGACACTTTAG
TGAGTACACTGAGTCAGGAATTGAATGTGTCTAATATCTTAGTCACTTTCCTATCACAGG
CACTTAGCAACCAACATCAACAAAATAAGGGGAGATTTTTTTGGCTCACGGTTTTTGTCC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTAAACTTTAATTAT
ACTCATTTCTGGTGAATTACCGGTGAAAATACTTCCCTGGATTTTTTTTTCTTTATTCCC
AAGTCATGGCTACTGGAAAAGAGAAAAGTAAAAAATGAGAAAAAAAAACCCCAATATATC
AGTGGCCAGGAAAAAAAAAAAACACTTCCAGCTTTGGGGCCCCAAATTTGTAAACACTGT
CTCTTCTCTAATCTTAGGGGTCACTGTCAAAGATGAATCTTAAAAAGAGCACTGAAAACT
ACATTTCCCAGTATGCCATTCTTTTGCACGCAACAGGGTTGCGCCGTCGTTGCCATGGGA
ATCCAGGAGACCTCTTTCCTGGTTTATTTTGCTGCTCTCGCTTCGCAGGTTTCCGAGCAG
TGCCGCACGCCGACCTCTTCGCGTTTGGGGGGCCTGTCACAATGCCCAGGTAGTTCTGCT
ACCCTGCCTGCGCCCAGCCTAACTCGCCTCCAAAACCTCCCCTCTTTCCCACCCCAACCT
GGGAGGCCGCGAGGGACCGAGTGGGGACCGGAAGCCTGCACTGGCCCTGCGGCGGGGAGA
CCCGGCTGTCCTGCTCTGCTAGGGGCCGTGTCTGCATGGGCAGGGGCCGTCGAAACTGCC
GCAGACAGGAAGAAAAGTAAGAGAGTTAGAAAGGTGAACTTCGTCCATTCACCGATTCGA
TTCTCATAAGTTTCTTGAGGGACTGCTGCAGCCGCGGGGGATAGGCGGCGAGATAAACCC
CCAAAGCTCCTCCCGGGGTCCCCACCAGGCGCGAGGTTCAGAAGGACGTAAATGAGGGAG
AACTTGGAAAGCACTGTGGCAAGTTTAACATCACGTTTAAGGAGATAGGAGGGCTCTGAT
TGGAGCTCTTCGTTTCTGTGAGGCCTATTTAAACTGCCCGTACTAGAGATAATATCTGGA
CTTGTCAGAACAATTTAACAGGATGTGGGGGAGAGGGACAGGGAGGCCGTCACAGAGCCG
GGTAAAGCTTTCTCTCGCTTTTTGAATCAATAGATTTCTGTTGAATTTACGAACTTTAGG
GTAGAAAATGTCAGCTTTCCATCACATTGTCATTGATAAAGTTGTAAAGCTATACAAGTA
AAATCTCCACAAGTGGCATGCCTAATTACAGCGCCTTTTCCCTGTCTGCTGCGAACCTGG
ACATCAGATAATCAGGTTCTGAAAGAATGACTTGTAAATGAACAGCAGACAGGCCTGGAC
TGAGTACCCAGAGACTCACTGTGAAATAAAAGGATGAATTTTGGTGCAAACATTTGAATA
CACCTGTTTTTGACTTTTTATATTCCTGTTTTGGCCCTTTCTTTATCCCTGTTTTTTGAC
TAATAACAATTATAAACTGCCAATAATTTTTATAATGTTATAGACCAGCCCCTAAACTAA
TTGACCACATTGTAACAATCACAACAACCCTCTAAATTTTTTATACTTTTTTTTAAATTG
GCATTTTAGAGGTGAAGAAATGGTCTTGACCCTGAGGATAAACATTGGTTTAGTGTTCAA
TAAGTATTTGCTTAATTGATAAATAAATGAAGAATCTAGACAGAGTCTGCATAAATTCAC
ATACATAAAAAGTAGCAGATTCAAGGTAGACCTTGTAGGTCCTTTTAGTTCAATACGGTA
CTCCATTTTCACTTAGATTTATTTTTTAGAAAGATACTGGCTTGTACATAGAGAAATGAA
AAAATGATTTTCAAGATGTTTGTGAAGGGTGATTTTTTTCCCCTTTCGTCTTTATACTTT
CGTATTTTAGAAAAGAAATTTGGGGCCAAAACCTAATTTTAAAAACAAAGTAATGACAAT
CAAAAAAAAAAAAAAAAAACGTTTAAGGGAAGAAAGATTATTTGATATACTGGTTTTGCA
TGATTGCTATCTTTCTAGATGATTTAAGTTGTACATTTCCTAAAGTCCCTGTATGTTCAG
AAACTAACATGTACAACCTTTATCCTTACTGGGAAGCTTCAAAATAGACAACACTCAACC
GTGGTAGTAAAGATTCTCCTTACCAGTTTCAGTATTCTTCAGAGAACTGGTTCAAAGGAA
AACACTCACTAATCACAGCCTGACTAATCACCAGATAATTTGCAAGGTTATTGTTCCCTA
GAATATAATGTTTTATCTTCAAAATTTTACTGAAATAAAACTTCTCTGCCTGATATAAGT
GTTTAAATAAATATGTTTTGCTTTTTTGCATTTTTTTCTGCCTGTCATATAGTGAAACTC
TCTGGGAAATCGCAAAAGCTGAAGTGGAAAAAAGAGGAAGGATCGGCCGCGAAGGCGATG
GAGTTGAGATTGGAGAAAAGTCTGTTTTCTTCATAGGCAGTAAAAATGGGGTAAAGCTTT
CACTTTTTTTTCAATTATTAAGGTGATTTTTTTTTTTTTTTGTCATTTAGTTTTTTATCG
GTACCAGGGATCGAACTCACGACTGCCTGCTTGCAAGGCAGGTGCTTATGCCGCTGAGCT
AAATCCCCAGCCCCTTATTAAGGTGATTTAACAACCACTGGTAAAATTTATTGTAATACT
TTGACAAAAACTTAACATACTTTCAACTCTAACCAGATGACTAGTGTGGTTGACTGTGCC
GAGTATTATTGACCTAGGAAAAGTTGTGGAAGTAAACAAAATCTTTAAAAAAGGTTTTAA
TTGTTGTGTTTTTTATTTTAAAAGTTGAAAATACTTGCATCTTCTACCTCTGTTGAATAC
AAAGGGCTTAAACACCTAACTGTAAATATCTAAGTCAGCATCTAAATCTCATACTTTGGA
TTCAGATATTTTACATTTAGGAATCTAATGGGATAATTGAGTTCTATCAGTGATGTTTAT
CAAAGGGTTTGAAAAATGTGGGGGAAATAAGGCAGCAGTTCTGCTGGACCACGGCTTGGC
AGGAGGGACCCCTCCCCACTCACTGTCAGCTCAGTTGTACTTAGCCAGGAGTACAGAAGA
ATTTTGGAAGTAGCCACACAGCAGTGACAGATGCATCATATCTTCATTCAACTTCACATG
GCACACAGAATTCCTGCCTGGGAGGCAGAACTGCTGCAGACACTGTCTAAAACAGGCCAA
GGCTCTCCACACCCGAGACGCTGAAGTTCATGTAGCATCGTAACATCTTTCTGTCTGGAG
TTCATATTATTGTTCAGTTTTTGTGCTTTGTGTTTCCACTTAAGGGTATTAACAAATAGG
AGGCTTTCAGAACCCAGCACAACTCCTTACTCAGTGGGCAGCATCAATGTTCGGTCACCC
TGAGCAGCTCTTCCTGCGCAACCGGACATACATCGATCGAGTGGGGATACTATGTTAAGA
TTATGTTTATAAGGGGAAATAATTATATAACCACAAAAAAGGGATGAAAGAAAATAATAT
GGATTCAAAAAGTAGGACATAAATGTTATGTAAACTATGATCTGATTTCTATAAATCTGT
GAAGATAAAAAGTAGAAATATGAATAGTAAATTTTTAATCACTGTATTTTTGTTTTGCTT
TTAATTTCTGTACTTTCCAAAGTTTTCATATTGGAGGGGCTGGGGATTTAGCTCAGGGGC
ATAAGTGCCTGCCTTGCAAGCAGGTAGTCATGAGTTCGATCCCTGCTACCAATAAAAATG
AAAAAGACAAAAAAAAAGTTTTCATATTGGTTCATATTGGTTTAATATCTGAACTTTGTT
CTTTAACATAAAAGTATCATAGGGATCATTTATATTTTAAATTTTTAAATGAGTTTTATT
TCATGAGTGTACCATTGTGTGAAGAGTAATTTTTATATTAGATATAATACTTTAAAAATT
TTCTGGGGCTGGAGATTTAGCTCAGTGGCCTAAGCACCTCCCTGAAACAGGAGGTCTTGA
GTTCAATCCCTGGTACCAAAAAAAAATTTTTTTTCTACATTTCCTCCTATTGCAGTATAG
ATGCACATGTGGATTGACATAAATGTGGACAATAATCAGTACTAGTCTTAAGATTCTCTC
CTAATCACTTTCTTTAACAGTTGTTATTGGCTTCTTTACAGTTACGGTTCGTTGTTTGTG
AAACTACTCTTTTCCTAATAGCAATATATGGCATATCCAGGCTTTATTTTATTATTATGA
AATTAAAGCTAATTTTGCTTTTGAAGACTTGAGAATTCCCTTGAAATGTCTGGAACTTTT
GAGGGTATTATTCTTTAAAAAATACTTTATCCAGAGTGCTGATTTATTGTGGATTATAAA
GAGAAGAAATTAATTGATGCTATCGGTTAGCTTGACAGTAACGATTCTTTACCAAAAAAC
TCAGCTACCTTGCTGCTTCCTCCCTCTTTTTTTTTTCTCTCTCTTCTTTTGTATCAGTTA
GTGTTCACGAAAGTAACAACAAATTATGTGTACAATTATATTATAACAGTTAAATTATAT
GTATTTACATTCAGGTGCTTTTAAAATAAATATTGTATGTATTGGGTACTAAATAGGATT
ACAGTAGCCACCTGTGGAATCAGGGTGGAAGAATGCAAAATGGCCATCTGCATGCCCAGT
CAAAGGCCTGGAGCTCACTGCAGAGTCTGGTTTGAGTCAATGTCAGAAAGCTAAAGAGTC
TGTGTCAGAAGCCTGGAGATGAACGCTAAAGAGTCTGTGTTAGGAGCTGGAGGTGAACAT
CCAAAGACAATGGCAAAGACCAGAGCCCTCCTGAAGAAGCAGAGGGGAGGATGTCCCTTT
TTCTTTCCCTTAGTTCCATCCAGGCTCTAAGCTTATTGTTTGGTGCCACTTGAATCTGGG
GTGGATCTTTTTCAGTTTGTGACCTGTGTGTCCACCATCCACAAACACACCCAGAAGTGT
GTTCCACTAACCTGCCCGGCATTTTTTATCCATTCAAATTGGCAGCACCATTATCTGTCA
CACCTTCCAACCTGGCTTTCATACATCATTCAGTAGACATTTATTGAACATCTTTGATGT
GCCAAGTATCTTGCTGGTACCTGTGAAAATAGACATGAAAGACACTTTGGCTACTATGAA
GGAACCTGAGTACCTGTACTTATATACCAGCAATGACAATAGCATGAGATGCTATGCTGA
AAACCAGGAAGGCATGTAACTGCCCAAGAGACTGGAAGACTGGGAAAACCTGTGTAAGAG
AGTGATGTCTAAAGCTTGAAAGGCAAGAAGGGAAAAGAAGCAATGCAAATGGCAAGGGCC
AAGAGAGCATCCTAAAGACAGGATCAAGAGCAACATATTGTATATCCTATAGCAAAAAAT
GGGAGAGGGACTTTGTTAGACAAATGGGGCAAGATTGCTGGTCAACAGTGTGGACTGTGT
TTCGATGATGGGGATTAAGGCAACACTAATCTGCTAAGTGTCTGTGACTTGGTTACCTTC
CTCTCATTGTTGAGACAAAATACTTGATGCCCAAAGTCTAAAGGAAGATTTATTTCTTAC
AGTTCTTAGAGGTTTCAGTCCATACTCGTCTGGCTCCAAGGCAAGGTAGCATGGCGGGGT
CAGTGTTCATGGCCACCACAAACAGCAAGGTCAAACTGTGTAAAAAGAGAAGGACATGTC
TTCTTCTTCTTCTTCCCACTCTTGCACTATATGTCTGCTCTGCTCTGGGCGGGTGCAGCA
CTCACATCACCAGTCCCAGTGCTAGACAATGAACCAATTGCGACCACTGGATTCAGCCGC
ATCCATGATTGCATGAGGCTTGAGGGGGCATCTAAACACAAACCATAACAATTCTATAAT
TCTGTCTCTCTTCCACTCACTTGCATAAGGCTCAGGTGTGGAGGAGGAAGGNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGTTTATTTGGAAATTGTTACATATGTACT
CTACATTTATGGTGAAATTGCAGTAAAAGTATTTAAATCCAATGCTAGGTTATATAAGAA
TTTGAAGAAACTGGATAGATATCTGAAATTCCTTTGCAATTCTAAAACAGTAATTCTGAC
TACTTTGTGTGTAGAATTCATTACCCTTTTGACTTACAACTTTAAAAACATATTTTATAT
GATACATGTTCCAGTGTAGGAAAAATAAAGAAAATCTAGATTTTTCTTCCAAAAAATAAA
ATTACTTGCAAATCTACCAACTAAAAACAGTCATTATTAACATAGTGATATCCCTCTAGA
TCTCTTTTGTGTTTCTGTCAAGAGTGTGTATGCATGTATATGCATGTGTATGTATGTTTC
TACATGTATAAGTAAAGAAAACAGGAAAAGATTTTACTTGGTTTTGGTTGTTTGAGACAG
AGTCTCACTGTGTAATCCACAGTAGCCTTGAATTCATGATCCTCCTGCCTCAGCCTCCAT
GTGCCAGTATTACAAGTCATGTGCCATGATATCCACCAGGAAAATAAACTTTTAAATTGA
AAACAGGGTCCTCTGGCCCTGAATCACAGCCAGCAGCTTCCTGATGCTGTTGGTTTCAAG
CAGGAGCCTAAAGAGATGTCTTTCTTTTCTGTTGACCACTTCAGAACGTAGGCAGTGAAA
TAGTCAATTCATTAGAAACAGCTTGAAGCCACACACACCCCTCCCCATGAGCAGCTGTGA
GCATGGCAGGCTGTGGTGGCCCAGGATGGGAGCCACCAGCATTTACTGGGACCTGCGCCA
TGCCGGGACCTGGAACACCAGGATACCAAGCAACCCCCACTCTCCACACCTGTTTTGTTT
TGTTGAACTCCAATGTACATGAGAGTGTGGACAAGTATTTTGAAGAGAACGAGAGACTCT
ACAACAGCCATTGGTGACTTCCCTATTGTCTGGTTTTGAAGACCTAAATCGCCTTCCTTA
TTCTGTTCAGATCAGTTTTATGCTGTGTTGTTTTGTGTGAATTCTGTGTATGCAAAGACA
TGGACAACTATTTGGAAGGAAACAGACAATTTGATGGACAGTGAAGATCTCAGGTCATCT
AGCTTTGAGATTTATATCTCTTGCATTGCTTTCTTGTGTCCTATTTTGTTCTGTTTTGTT
GTGTTTGATTTTACCCCCTTTAAAATAAAAATTAAAAAAAAAGAAAACAGGGTCATACTA
ATTTATTATAGGTGTTTTATAATGTAAGTATATTTCTATATTGTCATTCCTAATAATTAC
ACATTAGTCTATTACACAGACTACTATAATCGATTTAATTAATTCCCTATAATTTAGGTT
GTAATTTAGGTTGTTTTTAGTTTTTCTTTTTTTATTTTAAAGGAGAAAAAAACCAAAACT
ATAAGGGTACAAGTAATACAGAATTAAAAAAAAAACAGTAAGAAATCACTAGCTAATAGA
TTACATATTGTCATCTTAGAAATAGTTGTTCAAGTTACAGGATTAAAGCATACAAAGTGG
ACATTCAAACAGTGAGACTGCAAACAGTTGTGTTCAATGATCCAACAAAAACTTAGTAAT
ATGGTCATCTATCTTAACACACCTAAACACACCTGCAGTTGTATCCTTTAGAGCACTTTT
TTTTCCCTCTCTTTTTTACAACAACATTACGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNACTAGACGAAGCAAAGGCAGTCCTGGGCAACAAAGATAAGACAGGGGTCATCACAAT
CCCTGAGCTGAAATTATACTATAAAGCTACTGTGACTAAAAGCATGTGATACTGACAAAA
AGAAAAGCAAAAGAAAAAAGACTTGAAGATCAATGGAACAGAAGAGAAGATGCAGAATCA
ACTGCAGACATACTAAGCCTCCATATCTGACAAAGGTGCCAAACACATCTTCTGGAAGAA
AGATGGCCTTTTTAATAAATGATGCTGGAAAAACTGGTTCTATACATGCCAGCGATTAAA
CGTGGACCCATATATTCCACCATGTACCAAACTAAAATCAGAATGGATCAGAGATCTTAA
TATTAAAACAAATACTAAATTTGATAGAAGATAAAGTAGGTAAAACTCTTGAAGACATTG
GTGTAGGAACAACCTCAGTTGCACAGAAACTGTGACAAAGAATCAACAACTGGGATCTCA
CACTTTTGAAAAGCTTTTGCATCAACACAATGAAGAGACAACACACAGTGTGGGAGAAAA
TGTTTGCCAGCTGTTCCTCAGATTACTATCAAGAACATACAAAGAACTCAAAAAATCAGT
CCTCCCAGATTTAAAGATCCCCAAAAATGGGCCTCTGAGATAAATATACACTCAAAGAAA
TATGAACAGCAAATAAATATATGAAAAAATGTTCACCATCACTGGTCATTGGAGAGATGC
CAATTAAAACAACACTGAGATTCCACCTCACCCCAGAGACAATGGCTAGTATCAAGAAAT
CAAGCAATAACAGATGCTGGAGGGGCTGTCGGGGGTAAAGGAACCCTTTTCCACTGTTGG
TGGGAATGCAGACTGGTGCAACCACTGTGGGAATCAGTGTGGAGATTCCTCAGAAAACTA
GGATTGGAGGTCCCGTTCAACCCAGTTATTCCCCTTCTGGGTATCTTGCCAAAAGAGTTA
AGAACATCATGCCACAGTGAATGTGTGCACCCAAGTTTATAGCAGCACAGTTTGTAACAG
CCAAATCTTGGACACAACCTAAATGTCCATTAACTGAGGAATGGATAAAAAAAGATGTGG
TATTTTTATACAATGGAGAGCTACTCAGCCATAAAGAAGGATAAACTGGAGACTTTTATA
GGTAAATGGGTATAACTTGAGGCTACACTTATTAGTGAAATAAACAATTCACACATGCGT
AAACATTGTCTCTTCAGTGTGAGAAGCTGAATCAGCATTATATATGTATATGTATATAAA
AATAGTTACAATAGTTACACTACTGATTTCTCTGAGTTCACACCAAAGAAAAACATTTGT
GCTGGTATTGTTCTGACAGTTGAATGCAGATGTCTTGTCCTCTGATTGATGTGTTTTGAA
ATATTGTTGTAGTTTTTTGTTTTCTTCCTTTTCTTTCTCTTTTTTTTTCTTAAAATAAAA
TGGATTTGGAAAAAAAATCTTTTGCAAGGTAAGAAACCTGGCAGACTGTTTGCAGAACAA
TGTGAGTGTACTCAGTACACTGAGCTGATAGTTGAAAATGGTTAAGATGGTAAATTTTAT
TTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNGTTCAAACTTGCAGTCCTCTGCCTCTGCCTCCCAGGGTGCAGGGATTCACTAAG
ACAGTTTTAAAAAAGCTTATCTCTTATATAAGTTTTTAAAATAATGTTTTACCTCAATGC
TTTTACTCAAGGTAACTTCTAATAAAGTTTTTAAGAGGAAGTAAAAATGAATGGAGTAAG
ATAATAGCACCAGAAACTAATCTCACCTGTTACGGTAATATGATCTGCCCCTTTTTTGTA
CAGGGACGAGCCACCAAAGCCTACCTTAGCTTTGGAATATACGTATGGAAGAAGAGCAAA
AGGCCATAACACGGTGAGTGTTTTCATAAAGACGCTGCAGTGCTGTCGGCTAGGAAATAG
TGATGATGACTTTGTTTTCCGTTTTCCACTTCATCCACAATCGCTAGGCATGTCCCGTTG
TACACTTCAGAGCTCTGTGCTGGTAAGCCTCAAGTGCAGTCCAGCTGATGTGAAGCCAAC
CCAAACTCTGAAAGCATTTCAGCTTTCTCATCTGATACATCTTAAAATGCTGAAATAAGG
TTGCTTTGCAGCTTCATCTTACAGTTCTTGGCTGACTTGCATCGCGTTAATGTGACTTCT
TCTGGTTTTCAAATGAGAATAATATTGTGTTACCATCTGTCTCTCTAAAAATCTGCTAAA
AATGTGGGTTTGACTTTTGAAGTATTTATGAGAATATACTTTTCAAAAATCTAAATTCTT
AGCATTTAAAAAAATACAGCACTGGGATGTAGTTCAGTGATAAAGCACTTGCATAGCAGG
AACAAATCCCTGGACTCCGTCCCTGGTACAAAAACAAAACAAAACAAAACAAAACCCTCT
TGTTAGTACTGAAACCATACACTCTGTTTTCCTATTTTCACTTAGTGTCTCTTTGGAGGA
ATGTTGGAAACTATTCAGAATAGAGGGAGAGCTTATAATAATGTGTGGGGTAGTGGAGGC
AAATTCCTATGTGGATTCTCGGGGAGTCCCGCATGAGAAGGAGTCTTTTCAAGGTTAACT
GTGTGGGAGAGCAGTCCCGAGCCCAGGGACTCACCGCTCCCACAGCACAGGCCAGTGTCC
ATGGATTGATTGGCTTCAGATGTTTGCTCTTTAGACAGTGAATAAAGAAAAGTAAAACTG
CCTGTTATTTCTTGGATCCACCAACAAAAGTTGTCTATTAAAACCATGAAATTAAAAAGA
AATAACTTCATTACATGACTCATTTGAATTTTGACATGAATGATAAGCCTAGAAATGTAA
TTATGCTTTTTGCTGGAAACTGAAGCACCTTTCATAAGCTTAACTTTTGAAAAAAGCTCT
AAAAACTTTTTTCATGAAACTGTGAATCAAGGGAGATTTTCCAGCGTGATGATTTCTTCC
ACAATCAGTAATGATTCAAATGTAATGAAATAATTTTAGAGATTATAAGGTGAGAACTTC
TTCAAAATTTTAAACATTACAATTCACCAAAAACTTGCTTTATGAAATAAGCCAGACTGC
AAGGCAGGTATTCCATGTTTTCTCTCATATGTGGAGTCTAAGGTACAAAAAAAAGGCAGA
AAAAGAAAAGACAACATGAAAGTAGAAGGGAGACTGTTGAAGAAGAGAGGGGAGGTGAGG
GAGGCGATGGGAGAAATAGGATCAGATTGTATGTAATGAAAAATGTCAACAGTGAAACTT
ATTATATAAATAAGCACTTAAAATTAACAAATAAAAATTTTAATTTAAATATTAAAAGGA
AACTTTTTTTCAGCCAAAGGATATTGCTCACTTTTGGGAACTGGGTGGAGGAACCTCGTT
GTTGGACTTAATCAGCATACCGATCACAAGTGACCTTTTGCGGTAAGTGAGCCCAGGTCA
GGAAAGCCGCGAGTACACGGAGCGTCTGCAGGGTGCTGTGTGTGTAGGCTTTGGTGAGTC
ATTAACCTGAGGCGACAGTTTGATGTTGCTGAAGGTCCGTGCCCACTTCCTTTCTGTGCG
CTTAGACTGTAATACTTCCAAAGAGGTTTTTTAAAGAACCAAGGCTGGCATTCCCACTGG
TGTAACATACTTTGCAAGCCCACCAACAAAAAAAAATGTCTAAAAATACTTGGGTGGTGA
ATTCATTTGCAAAAATAAATTTGGGGAGTTAATTCTTGCTACTTTCCATCTCAGTGCAAG
TCAATTCCGCCTGGAGGTTTTTCTTCAGTGGGGTAGTATAAGTCTACCTTTAATTTAATG
AGAATTAACATCCTTGAGTTTCATCTGAAGACTATATATTCAAATAGGAAGAAAGGTTCT
GTTTGCTGACCTTAAAGAGCTGGAACAGAGGGGAAAACCTCAGACCCTTTGGGGTGTTTT
TCTGACAGTGACTCCCACATGTTGGCCAAATCAGATATGGAAAATTGTGACATTTCTCAC
AATGTTCCTGGGAACTCATCTTAGCCAAGAAAAGCAAGAATCTTAAACTCTGAAGGATCT
TATTCTTGTCAGAAATTAGCACAAACCATTGCTGCTGGCTGGACCAGAGACAAAAGGTTT
GGCAAATATTTGTTATATTTCAGGCATTGAGAGCCTTAGTATGTGGAATTATTTCTTGTT
AGCAGAACAGGTGTTTCTCTTGAGCTAGCTGGCTGCAGATAATGTTGGTGTTGTTTGTCC
AGAGATTTTTCTTCTAGTGAAAAAGAATTTATTTTATTTTATTTGAAACCAAACTATCCT
CATAAAGAAAACTTGGAGAATTCTGAAAAATACCAAGACAGCAAGAGCACTCAGAATCAC
ATAAAAAGTAACCATTATTAACATGCCAGGCTATGTCTTTTAGTCTTTTTCGTGGTTATA
AACAGACTTTATATATATCTTGCTATACCACCGTCTCCGTATGGTATTCGTTTTCAGAAA
CATGGACTTTAACAGCAACACAGTTTTCATGTGTCTCTGTGATGGAGACAAGCAGAACGG
GAACTAGGGTGGCTCCAGTGTGGCTGAAGAGAGCTGGGGAGGGTGGGGAGGAGCTGAAGG
GTCCCCAGCAGCCACTTTGCAGGACCAGAGACTGAAAAGATGAAGACGCAGCCTGCTCAG
AACGGGTCCTGGGCTGGCACCACTACTGACCCTGACTTCTGTCCCCTTCTGCAGACCCAG
GACCACCTGGGTCTGCTAGGTTTGTGGGAATTTGGGGCTCTGCAGAAAGCCCCGTCTTTC
CATAGCTTTTTTCCTACTATGTGATGGTCAGCCTTCCTTTCCCTGGAACCATGACAGCTG
GAGCCAGCTGGAGGCCAGAGGAGAAGTCAGACTGAGGGCGACACAGAGAAAGGCAGCCAG
AGACCTGGCCCAAAGTGGCCAAAGAATTCATGGAAAACATTCACTCTTAAAGCAGCTTCT
GGTCTCGGAGCATTTTTTTGGACTGGACTAGTTTGACACATAATTTTCTTATGTTGGACA
AAGCTCCAGTAATTTGAGGAAATAATCCTGTTGTCACATGGGTATTATGATGCTGTCTTT
TGAAAATAACTGTTCATATAATTATATTTGCAATTGAACATTACCACGGACTTTGGATAA
GTTGTATAAAAAAATTCCCTGTGACATGAATTTCTGGATTCGAAAATAAACTTTTTTGGT
TATTATCTGGTCTGGGGTGCATGCCCGTAATCTCACCCTTCAGGGGAGCTAAGGCAGAAA
GAGCACAAATTCAAGCCCAGCCTGGGCAGTTTAGCAGCTTAGTGAGATTTTGCCTCAAAA
CGAAAAAAGACAATAGAAAAAGAACTGGGGAGGCCGCGCATTCAAACACCAGTACTGGAA
AACAAAAGAAAGGTGGTTTTAAAAAAAATTTTTTTATAGTTAAATATAGTATCACCTATT
TTTATAAAAACTTAACTTTGGCAGCATTGTAGGGTTTGGAAGCTGTTACTAATTAATACC
AGTATGGATATTCTTTACAACTTGTCATCCTCAGAGTAGTTGCCTCTACTTTTAGGGTTG
ATACTGACAAGCATACCATTTTCAAATAAAATCAGCCATGGCCAACCCATAGTCTTACGA
TTCAGATTCAATTAAGATCAGTCATAGTAAGACAATGAATGTGTAGGACTGATAACCATG
TTACTGAGCTCTTGTTCGATCATAGAGCAGAAGGGTTTGTAGTGTCACTTTATGAATGTC
ATTCTAAAGGCTTCAATTCCATAACATGAACGGCTACTTCTAAGATGACAATGTGTAACT
TATCAACCAGCAATTTCTTACCGTTTGTTTTTCTGTAAGTTTGTATCATTTCTACCCTTT
TTTAAAATCTCCATGTATTCTTTTGTTTCCTTTTCTTTAAATAAAAAATTAAAAAAAAAA
TTTTTTTAGTTGTCATTTGCTATGAAATAAGTAAAAACTAACACATGTATTTTCAAAGTA
CTGGGAAACAAAAATTTTAACCTTAGAAAATAATTGAATAATCTATTTTTCTTTTTTCTT
AAAACAGAGTTATTTTTCACTTTAAAAAGTGTTTATCATACATATTTTACCACTATAAAA
AAGTTAAATCATAATAGTTTTTTTCAAGTGTAACTATTCTACAACCCTTAAAATAAAGTT
AGTTTCTTTACTACTGAAAATATATCTGTTTCAGCTGACATGGTGGCATGCACCTGTGAT
CTAGCACGCAGCAGAGGGAGACAGGGATCACCATGAGTTCGAGGCCAGCCCGGGTTTTAC
AGTGAGACCCTGTCTCAAAAAATCTCTGTGTTACAATTTGTGGTTAGACTGTTTCTAAGC
TTATTAAAGTGACAGAAATGATTGATTAGACATGTATTACAGTAATTTTATAGAAAAATT
TGATAACTAATTAATGTCTCAGATTACTTACTAAATTTAGACCAACAGTATAGAATGAAG
TTACTGTTCTGCATAAATTACATAAAATAGCATGTTTTCTTGACCTAAGCAAAATAATTA
AATAACATACAATCTCTGGCTGTGTCTGTTAGCAGAATGGTTGCCCTGGTGGTGAAGATG
TTGACCCCTGATTATGCTTCTACACCTTACTATGACCATTTTCCTTCTTTTTTTAACTGT
GTCACTGAGCTATGTCCCTAGCCATCATGACCATTTTCTAAAACACTCTTAGATTTATGT
ACTTGGTTTTTATTGTGGAAAAATATATATAGCATAAAATTTAGTATTATACAACTCAGT
GGAATTAAATATGTATCACATTGTTGTGCAATCATCACTGCCATCTGTCTACAGAACTTT
TTCATCTTCTCAAACTGAGGCTCGTGTTAAACAATAGCTGCTCCCTGTCCCACTCCCCCA
GTTCCTGCAGCCTCATTCTGCTCTCACACTCTGTGAGTTACACCACGCAGGTTCCTCATA
TGCATGAGACCAGACAGTATCCGCCCTTTTGTTACTGGTTTATTTCACTCTGCATAATGT
CTTCAAGGTACATCCAGGTGGTTGCATGTTCGAAATTCCTGCCTTTTTAAGGCTAATATG
TCATTATATGTACACACCACATTTTGTTTATCCACTAATCCATCCGTGGCCAGTTGGGTT
GCTTCTGTGTTTTGCCTGTTCTCAGTAATGTTACTCAGCACATTAGTGTACACGTCTGTT
CAGATCCCAGCTTCTCATTTGGAGTATGGAGANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNACAATAGGCAGCATAATGGGCATGATGAATCTATCTGGTGGGCATAGG
TATGCTTTCGGGGAGACAGTGTGTTATAGAAAGGGAGACGTGTAACTTTAGACCTAAATA
TTAGTTCTACAGCTTATAATTATGTAACTATGTGATCAGTCTTCAGTTCCATAAAATATA
CATCATAACATCTTCTAGAAAGCATTGTTATAAAGAATAAGTAAGTTGGATAGTTTCCTA
ACAAGGCCCATCAGTAAGTCTATTCCCATCCTCTCTTGACTAGGTATGTTGCTGCTACCA
CTTACTAGTATTTTTGCTTACCTTCCTTGGAGCACATGATAAAATTATATGTAAACAAAG
CACTTGTTGGACCCAAATGCTTGCAGTTTGTTCATTTAAATGATTATTTTTAGTTTAAAC
AGAAATTTCAGTACCTCTATTGATTATAATATTGAAATATCACTAGAGAAAAGCATTGGA
ATACATAAGGCTGTAAGTTTTATCTTTTTTAAATAGGATAATGCTGGGTTTTTTTTTATT
CTCATAAGCTATAATGTTGTTATTCTTGGATAAATTTCAGTACACTGGTGTTTTAAAATG
ATCACTATTTTGAGGCTTTGGTGAGGATATTTTTATTTCCTTAGGACATTTTCTATTGTT
CTTGTTCTGGATCTTTCAAAGCCTAATCACCTTTGGCCCACCATGGAAAATCTGTTGCAA
GCCACAAGAAGCCATGTAGATAAAGTGATAATGAAACTGGGAAGGACAAATTCTAAAGCA
GCTTCTGAAATGAGACAGAAGATGTGGAGCACCATGCAGAAGGAACATCCAGTGAGTTAC
TGCTGGGCCTGTTCTTGTGATCTTTAGTCATCCCGCACATAGTTAAGATAACATCACAAA
CAACTTTAGATTTTTATGCATGGCTTGAAATTCACTTGATGTAGATGAACCTGTTCACTG
GAAAATTATAGCAATTTAATAAAACTTCAGTAAGAAAAAAAGATTTTTTTATGTCTTCTT
ATTAGACATCTACTTTGATTGTTATGGCATATTACTCCAGTCAAAAGAAATAGAGTTTTA
AAGTCATAGTTTGATATTGATTTTATAATCTCTGTAAAATGAAGATAAAAAGCCAGTCTG
TACAAAAGTCATCTCGCAAAGACTAGATGAAGCTACGAATTTAGGCAAGGAGTACAGTGT
AACAGCTTTCACTGTCACTCTGTACTTTTTGTTCATTTGGTGTCTGTCACATGGTTGTCA
TCTGACAGATGGTTACAAAGTAGCTGTGATAGTAACACAAATTATTTAAGTATAGTAGTG
AATATTATCCTCTAGAAAACTAAGAGCAGCGTCTTATATTTCCCATGCNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTT
ATTCAGTGCTTTCTTTGAATAAATGTATCAGGTCTGTATATTTACAAAGTACCCACCTTT
GGGTACTGTTCCTGGGAGCCTGTTCTTATTTCAAAATGAAGTTTATATTGTGGAATTGAA
ATTGAATCAGAAAATTGAAATCTTTGCTTTATTTTATATTTCATTTCAGTTTAAGTTCAC
TTTTTTTGCTTCCATACATCTTAGTCATTCTGATTTGGCTCTGAAAACTTAGTATCTTCA
AAAATCAAATCTCAGTGTAGATTATTTGTTGGGTAAACCAGGTGCATGCCTGCAATCTCA
GCAACTGGGGAGGCTAAAGTACAAGTTTAAGCCCAGCCAGGGCAACTTAGCTAGACTTAA
TCTAAAAAAAAAAAAAGGCATGTAGCCTGTGCAAAGGCCCTGAGTTCAGTGTCCTGTACC
CACCCCCACAATTTGTGTGGTGGCCTAAGTTTTGTTAACCTAATGTTAGACCTTAATTAT
TAATAATATTCACCTCCTTTCATTCTAGAAGGGTGTTCTGGTTGTGGTACTTCTAATTAT
CCTCTACAAGTGAGAATATTCAGTAGCTTAATTTTTCAGGCTCTAAAGGTAATTCAAAAG
AAAGAAGTTAAATAATGTTCGTGTCAGTCTTGTTCCAGTCTGCAGGTCCATAGTGACTGC
TTTGAAGACAGCAGTGTGTCCTGGGATGTAAAAGTTATTTTTGATATATGCCTCTTATTT
TCTAGCCAAACCAGTTGTGTTTTAGGAATTGTTCTTTTAAACTATACTAAGTATGTTTAC
ATACATACACATGTACATCATGCGCACATATAGGCCTATATTTTTTTTAAAAACTTTGAT
GATGATTACAATATATGAGTTGCTGAGATGATTTGTGCACAAACAAGTCTGTTCTGCATC
ACGCACCCGTGATGTCTGAAGCATGAGTTAAACTCGCCAGAACTTCTTTTTTCCGGTTTT
GCTTCGTCTGCTTACTCTATTTGTTGTAATTCTTTGTGCAGTCGTACTTGTTCAAGGCCA
GATTTATTTGACCTGTTAGTTGGAAAGCAGAGCATAGAACTGATTCTCCTGACTTTTGTC
TCATTTTATTTTTTATTTTTTTGTAAAGTTTACCAGCAAATCAGAAGCTCTCTTACTAAA
AATACGTGGAGTTATCAACCAGTTGGCATTTGGCATTGATAGAAGGTACTGCTGAAACTT
ACTTTATTTATTTTAATTGCTAATGCGACCTCATCTGATTACTGTCCTCAAATTCTTTTG
TCTCTTGACCTGGAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1008, 2812..2929, 24198..24232, 24843..24912, 26353..26441, 30944..31130, 32780..32848, 32949..33026, 35248..35322
1001..1008, 2812..2929, 24198..24232, 24843..24912, 26353..26441, 30944..31130, 32780..32848, 32949..33026, 35248..35322
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved