Cavia_porcellus Locus RANBP1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RANBP1
Cavia_porcellus
RANBP1
GeneScaffold_6795
SNORA77
6731..6859
8291
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCCTGGAGGAGATGAGGAAGAAC
TTTTTAAAATGTGAGTAGGTTGATGCTGTCCCAGAAATAGGTATCTTTGGTACAAGGTCA
AAATTATTATTAAAGACAAAAAGGGGGGCCTGATTCCCACCCATAATCTTCAAGAAATAA
GCAGGTTTTGTAGGATATGTATCTTAGAGTGAACCTAATTTATGCTCCCTGTTTTTCCTC
AAAGATTGCAGTGTAGAATGCCCAGTTCTGATCACTCTGAGGTGTGATAATGAGCACCTT
AAATTATATAAGCTTTCTTCTTCACTACCTCAAGCCAGCTAGACTGGGAATGGTGTCTTC
TGTTGACCTAACTTAACACAAGCTGCTTGAAGAAAGGGTGTGTGATGACTAAACCCTTTG
GAAATTCGTTTGACTAAACTTTGCTGGGTGCTCCTGATGGTCTTCTTGCCACCTTGCCTC
CAAGAATTCACAATACCCTTCCCTGGGTTGATCAGGGAATCTTAACTGGTTTTGCAACTT
GAATTGTATTTCATTCTGGGTTTTGGTGCTATACCTGGACACCATAGAATGGGTCATATT
AAAGAATAGAAGTGTATATCTTATTCTGGAGAAAGGCTAAAAGCATGATGCAGCCTCTGA
TGTGGCCTTACAATACAGTTTAAAATGACGGAAGGGCCATGGTGAGACAGGGTCAATTAA
TACTAGGTTAGATCTCTTCCTTTTACAAAAGCATTCATGATGTCATGAGGGCCTCTTCCT
CTTGATGATATCTGGTCTTCCTATCTTCTAGAGGTTCCTACTTCCAAATGCATGAATTTG
GGGATAAAGTTTTGTTTGTTTGTTTGTTTGTTTGAGACAGGGTTTCAGTGTAGGCTGGCT
TTGAGTTGTGTAGTTCAGGCTGACCTCAAACTCATGACAATCTAATCCTTCTGCCTTCTA
ATATGTGAACTTCAGGGGGCACATTCAAGCCATGATGGATGACCTTAGCAGTCTCAAGCT
TATGAGTCACCTGTTTAATATCTTTTATGCACAAAATAATGCCTGGAATTACAAGAAAAA
TGAGTGATGACTCAGGTATAAAGGTTCCCCACCTCTTTTTTTGGAGACAGGGTCTTACTA
TGTACTTCAGACTGGCCTTGAACTCACAGCGTGTAGCCCACGCTGGCTTCCCAAGTGCTG
GGATTATAGGTGTGCAGCACCAAGCCCAACTCAAGGTTCCTTTTTATTTTTTTGTTACTG
AGGATTGAACTCATGACTTTGCACTTGCTAGGCAGACACTTACGCTGCTCAGCTAAAATC
TCGGGCTATCAGGGTTCCTTTTTAAAAGTTACTCTACACACACCATTTGAAATCTTCAAT
GGAAAACTTCAGTAGCATGTGTGGTCTTGAGACAAGCCTTCTGCCTTGGGAAATCACAGC
GATTTTGGTCTGTTGCCTACACAGAATTACTGGGAACACTAGTTTAAGTTACACATCAGT
GAAAATAAAGTTGTTTTTCCTAGGAAAACCCCTTCCCTCTTTGAAGCATGTACAAGATTT
CGGGTTATAGTTTGGTGTTCTGAAAGAAGTGGGTTGGAGAGGGAGCCCTAGGCAAGAAAG
ACGAGCTGCAGGTACCTTTGGTCCCAGGGGTTAGTGAGACATTTCTCTGAAAACATTGGA
TCACTAGGTTTCTGTTCCACCTAGCAGATGTCTCAGAAATAGATATCTTTGGTACAAGGT
TGAAATTATTAAAGACAAAAGGTGGGGGGCTTGATTCCCATTCCCAGTCTTCAATAAAGA
AGCGGTCCCTGTGCCCCTCCTCCATCCCCTGCTGAGGGGTTAGTAGCATCCTCCTAGGGT
GACATGGTGTTTGTTTCTTGCATCTCTGCCCACATAGAGTGAAAATATGCTCCTTGGACA
GGAACGGGGTTTTTTTGTTTTGTGTTTTTTGCACCGGGGATCGAACTGATGACTTCACAC
TTGCCAGGCAAGCACTCTGTGCCCCTGAGCTAAATCCCTGGCCCTGGATGGGAACTCTTG
GTATGGGATATGAGGACAGCTGTTTGGGCCCTTGGACCTCCTGTAACAAATCTTGTGAAG
ACATTGTTTCCCTTGACAGAATTGAGTTTGGAGAAATGGATGGAGAGTATTAAGCCGAAG
AGGGATAGTCAGGATTGGGTATGCAGGGAGAAGGTATTGGCCTAGTCTTGAAGACAAGAC
TGTTGGATTCACTAGATTCCTGGTGGGAGTGAAGGCCTGCCTGGTCCCTCTCCATGGCGG
GGGCTGTGGGGAGAACAGGAATAATATCAACGTTGAAGGAAGGTCTGGGCCTGTGGAGAA
TGAGTTGTTTACCATGGCTCTTTATTATATGGGGTGATCTTGCCTGGGGACTGGGTTGTC
CAGTCCACCAAGGGTTTCTTTAGCCACTTTGGGCACATGTCCCTTTTCTATTAGAGGAAA
CTGATGTCTTCCTTTTGGTTGTGAAGTAAAAACAACCTGGAATTTGATGGGCTGTTGTAC
TCATTTGAGTGGTACTTCCCCTATTTTTCAGAGCCTGAAGGAGGGCAAGAGTGTTTGTAG
AGACATGGAGTCCCACAGCGCAGAGTTGTGCTATTTGTTTAATGTGTGAAGGGCAGATGC
TTTTTCTGTTGAAACATTTAGGATGTGCATTCCCCTCTCTGCATTCTAAGCACTCATTTA
ATGGTTTTTCTCACAGGCGAGCAAAGTTGTTCCGATTTGCTTCAGAGAATGATAGCCCAG
AGTGGAAGGAACGTGGCACTGGTGACGTCAAACTCCTAAAGCATAAGGATAAGGGGACCA
TTCGCCTCCTCATGAGGAGGGACAAGACCCTGAAGATCTGCGCCAACCACTATAGTAGGT
TGACTCTGGGGATTGTGTCTGCCCCTGAGCCCTGCACTCTGGGGAGTGATGATACATGCA
TTATGATTTTTGTGCCATGTGTTTTTTACATGTGCCTCTGAACCACCAGCAAACATGTAG
TGGAGTTTATAGTGTGGGAAGTAGTAGCAGCAGTGAGTCCCCTTTGCTGCATTAGTAGCT
GCCAAGTAGGCTGCTGGTGGGTTCTGTATTCACATGTGCATCTTGGACTGTGCCTTGGTG
CCAAGCCTGTTTTCTGAGCAGAATTTGTCCGATGGGGTAGAGACCCTTGTCCTGGGCATG
GAGGTAATTGCAGGCAGGGACTGGAGTTGTTGAGTGTACCTTAAGAATGATATGGAAGAG
GGCATGGATCTGAAGTGGCATGAGAAAGACCTCAGTCCCACCCTATACCAGTTACCTCTT
GCCTCTCCTGGTCCAAACCTGAAAAATGTGTTAGGGAGCTGGCTCCAGTCTTGTTGGGCT
CCTGGATAGTTTCTGTGAGAGCTTTGGGTGTTTGGGCAGAGCTGCTGACATGGTCAGTAG
TGCCTGCTATATATTATGGGCCCTAAGTGGATGAAAAGAATGGTCATGGGTGAAGACCAG
GCCAAGTAGGATGTGGGGAGAGATACGAAATGGTCAGGATGCAAGAACCCCTGTGACAAC
TATGTCAGCCTATGGAACAAGACCCCTGAGCTTTCAGTTTCAGCTGTGATTGTTGAGAGT
GGCCAGCGGGCCATTAGCCCCCTGCTGCCAGGGAGGGAACCCACTGACTAGGCATAGGCA
CGAGAATTGTCTCCACTCAGCTCCCTTGGTATGGGAGCTAAGGGGTTCAGGATAAGTATT
TATTTTGGGCCATAGCTATGTCTTCTGTGACACAAGTATCTGTTGAGGGATAGCTGATGT
CTAATACTTATGTCCTCATTCTCTAGTAGTGTCTCTGAATTAGAGAGAGTTGAGTGGTTG
GGCAGCCTGACCATGTGCCCTCTGGGTGATGCTTCTGCTTCTAAGCTTCTTTCCTTCCAC
TGAAACACCCCCCTCCCCCATTTTTCTCATTGGCCAGCTCCCTAATGGTATTGATGAGTG
TAGATGTACTGACATGTTGAGTGCTTTTAGGATAGGCTGGTCCCTTTGGTTTATACCTTG
ACATTTGACATGGGGCTTTGGGGCTGCACAGCCAGAGTTTGAACCAAGGGGTTGGGATTG
GGCTAGAGTTGCTTTTGTAGAGGTGGGCTTTTTGGACTAAGTGATCAAAAAAGATGTTGG
TTTAGAAGATCTTTACTGAGTGTCCTTATGTTTGGGGGACCAGGCTACCCTGTTCCCACA
TACAGGATAGTTGTGGTTTTTAAGTGAATATTGGGCATTTTCAAAGCGTTTGCATAAAAA
TTCATACCCCATGGGGCTTTGTCTAGGGCTTGGTTTTCAGACCCTAAATTGCCTCTTGCA
TTCCCAGAGGCCCAGTGAGGAGGGCACTCTGATTACAGTGTGACTGAGCCGCCTTAGTGG
CCCTCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNTTGAGCATATGGACCTATGTAAGACCGGGAATAATGATGTTCCCTTGGTCACTGGGCA
GCAGTAATCAGCAGATACCCACAAGCCCCAGAGTGATTCATCTGCTCTGGTTTCTTTCCC
CATCTGGATTGTCAAAAGCTGTGCCCAGCAGATCCTGGAGGAGTTGGTATGTGCTGTAGA
CACTACCCCATTGGCTGACAGAAGGGTGCTGAATGAATCTCACCCTTGCTCTGGGAATGG
GGCTGTCCAGCAGCCCTTCTAATAAGAAGGAAGTACCCCAACTCTTGGTTGCTAAATTAT
TAGACTAATGGAGGTGGTTCAGCACAGCTGTCGGCCTGAGGGGGGACTCAGTGAATGGTC
CATGCAGGTATCAAATGGCTTGACCCTCCCTTGGGCAGGGCAGAGATTGGCATAGGTTAG
GGCCCTTTCTGAATCCTGCCTCTTCAGACCCTCCAGGATATATCCTTTGCATAGTCAGGG
CTCTTAGGAAGTCATTTCTCTTCTTTCCACAGATGCACAAAAATTTAAAACAAAGTTTGA
AGAATGCAGGAAAGAGATTGAAGAGAGAGAAAAAAAAGGTGACCTGGTGCAGGGGGGGTG
GTGGCTTCCTTGCAGACTCACTCTGCACTTGGCTGTAGCCTCCAGGCAGGTGCTTTTTCT
GTCTGCCAGAGAACCATTCCAGGGAGCTGTGACAGCCTTGACCTGTCAGGGGGGCAGTGC
AGCTTCTTGGGGACATAGAATGCTTCTTGGTAGGCCCCCAAGCTGTGCTCATTGTCATTG
GTCTCACATCACTTTAGTGTCCAGGTAGCCAGTTGAGTCATAACTCTCTGGAACCTATGG
TGGACTGAAGATTACAGCGAGGACTTCAGTCTCTTGCTCCTCAGATGGTGACTGCTATAG
CAGGTGACCACATGTCACTGAACCCCTCAGCTGGGAAGAGTGGAGGTTGATGTTTAGAAT
GTGGGGGCTCCTGAACATGGTTTGGAAAGGGGAGATTAGTCTAAGAAGCTAGGCTTTACC
TTTTCTTTTGTTGTGCTTACTTGTGCTTTGTTTTAGCAGGACTGGGCAAAAATGATAATG
CGGAAAAAGTAGCTGAAAAGCTAGAAGCTCTGTCTGTAAAGGAGAATAAGGACCCTGGAA
AAGAGACCGAAGAGAAATCAGAGAAGCAATGAGTCCTCTTAACTTCTCTCTTTTTCTTTT
TCTTTTCTTTTTTAAATTTTGCCCTCCCCTTTCTTTTTGTTTTATTTTTAATTCTGTTTT
GTTTCTACAAGGGACTTTATATAAAGAACTGAATTCCAACATTCAGGCCATTTTTTTGTT
TTGTTTTTCTAAGTTTTTACCCTATTGAAGATGACTTCAGAAAATCCATTCCCCAGTCAT
GAAAATGTACTGTGCTAACTTTCTTTTCCATAGTGGAAACACTTATTTATAGTCATCAAA
AATAGTAAATAAAAAATGCATTTGAAACCTGGACCAGATGGCAGGACTTCGTGTGGGGGG
GCCGCATGGTAAGCACTGATGTCCTCCCGGCTCCTGGGTGTTTGCCTGTGTACCTTCAGT
ACATGTCCAACTCTGTCTGCATTAGTGGCAGCTGGTCTCCACGTCACCATAGCTTGATTT
CCTCGGACATTCTCTCTTTTCTTGCTAAGAGTTGGTGCTCAGGGCTAAGGTGTGCACTGC
CTCCCTGAGCCACTGTTCTGCACTGTGGTGAGTAGAGATAGGCTTTGCAGATGCATGTGC
TGGGAACAAGAGGATCACTAGGATATTTTGGCTTCAGTACAGGAGGTAGAAGCCAGCTGA
ACAGGTCTCTATGTCCTCAGAGATCAGGACTTCTGCATTACTGAGATTATACAGTGTTCC
CAGTAGCATCAAAGACATTTTCAAGGGTGCCATTTGGGAGTTAGAAAACAGGTCTTCGTA
GATATCTTGAGAGTTTCAGTATATGAGAGGTTTTTTATTTTTTATTTATTCTTTGTCTTT
GAGACAGGGTCTCCCTATGCAGTTCAGGCTGTCCTTCAGCTCGCTTTGTAGCCCAGGCTG
ATTTCAAACTTGCCACAATCCTCTTGCCTTAGCCCTCCGAGTGCTGGGATTATAGGTGTG
CACCACCACACCTGGCTTAATGAGAAGCTTTTTGGAGTGTGATCTTGCTGTCATACTGTG
CTGTGGGGTAGC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 3676..3833, 5669..5797, 6632..6697, 7176..7243, 7262..7291
1001..1029, 3676..3833, 5669..5797, 6632..6697, 7176..7243, 7262..7288
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved