Cavia_porcellus Locus TSR1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus TSR1
Cavia_porcellus
TSR1
GeneScaffold_5716
SNORD91, SNORD91
6488..6583, 7110..7200
9659
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNGCCTTTCTTCTTTTGCTTACAGCACTTGCTGTCCAAGGGCGCT
CTCTCTTTGCCTCCCACCGAAGAAGCAGGTAGATTCCAGAAAGAAGCTAAGTAAAGTAGT
GGAGAAGCGCTTTCCTGATGATAAACTTTTTCTGTTAGACACTCAGCAAGAGGCACAGTT
GCTGCTTAGACAGTTGGCTAACCAAAAACAAAGACATCTTGCTTTTCGAGATCGTCGGGC
CTACTTGTTTGCACATGCTGCTGATTTTGTGCCTGGTGAACAGAATAAATTGGTGGGCAC
CTTGAAAATTTCAGGCTATGTTCGTGGGCAGAATTTGAATGTAAATAGCTTGCTGCATAT
TGTTGGACATGGTGATTTTCAGATGAAACAGATTGATGCCCCTATGGACCCTTTCCCTTT
AAATCCTAGAGTGATTAAATCTCTGAAGGATCCAGGCATGGTGATGGAGGTAAGATTAAT
GTTTTGTTTTGAGATACACTCTTGCTATGTTGTCCAGGCTGGTCTTGAATTTCTGGGCCT
ACGTATTTGTCTCATATCTCATTCTTTTCATATAGCTGGGACTACAGGTGCATACCACCT
TGCAATTCAGAATTGATGTTTTTTGTTGTTTTTGAGATGATACCATTATATAGTCCAGAG
AGGTCTCCAATTTGTAATCCCAGCTCAGCCTCTTAAGTGCTAGGATTGCAGGGGTTAGTG
GATCATGTGGTACTTTATGTTGACTTTTGAGAAGGATACTCAGGATTGAACCCAAAAGTA
TGTACATGTTTAGGGCCTAGCAGCAGCTCATCACACTTTCCCAACACATGCAAAGGCCCG
GATTTGATCCCCAGTGCTGCTTTTAAAAAAGAATAAAAAAATCATGTAGAGTCATAAGAA
GGTTGGTGTAGGATGCAATGTTATTTTTTGGCAGTACTACAAATTGGAACCAGGGTTTCT
GCACTGTTAATTCCTAGTCCCACCTCAGTTTTACTTGCTTAATTCTTGAGACAGGGTCTC
ACTAAGTTGTCCATGCTGGGCTTGAACTTGTGATCCTTTTGCCTCAGATTCTCAAGAGTG
CAGGAACTGAAGGTATATACCACCAAGCCCAGTGAGATAGAAATTTAAATTCAGTGAAAG
TAGTCTGTGCACTTTGAAGAAACCACTAGTTCAAAATAAGGCAGTAGTCAGTTACAAGTA
TATTAATAAATTATATTTACTCACCATAACTGGCTCTGAGTTTATAGAAGAAACACAAAT
GTGGTTACTTTTGTCAAGGAACTTACTTAAATCAAAAACATGGCAAGCACCAGTGTCTTG
GTTATTTTTCTCTGGTTGCTGACACAAAAGATTTGACACCCAAAGTTAAAGGACACAGTT
TGTAGGATAGCACATGGCAGAGGGGCAACTCTTCATGATGGCAGAAGAGCAAAAGCAACA
AGGTGGAGCTTACGTTGTATGTGGGCTACCCGCCCTAAGGTGCATGTAGCACTCATGCCC
TTAACCAGACTATGACAGATCAAGTGGTGGAATGATTTATCGTACACCTTTAATCCCAGC
AGCATGCACTAGATTCAGCCACCTCTGAAAAAGCCCCACATGAGGCTTTGGGGAACATCT
AGACAAACTATAACAACCTGTGAAATAAAGGTTAAGATAGGCCATGGTTAAAGTACAGAC
TTGCTGTGGAAATGGAGAAAGTTCTATAGTGGCGATTAGAGTTAAGTCTGGTGCTGAGAA
GGATGAGTTAGGGATTTATGAGTTGAGCAAAAGTGAAAGTGGATGTTTAAAGATTGAGAT
AATATGAAATCTGGCACAGTGATGTAGGAATTTCTTAGAATTTTGAAGAAAGCAGCTTAT
GAGGAGAAATACAATAAGCAGATTGTGAAAGGCCTCAAGAGCCAAGCAGGGGTACAGAGT
TAAAATGTTAAGAACTGGCCATTTGCAAAATTTTAACAGGTTTTGACTATTTTATGCATC
TATATGATGACAGATATTTCTGGATGTTTCTGGTTGCTGTGTTAGATTTTTGGTTAATAC
TTGACTGGCTAATACCTCCTCTGGTTTTCAGGTTTGTACTACAGATGCTGTAGCTGATAT
GGAAGACCTTAAGGTTCTAATGAAGGCAGACCCTAGCAGACAGGAGTCTTTGCAAACAGA
GGTTATCCCAGATCCGATGGATGGGGAGCAAACCTGGCCTACTGAAGAGGAGCTGAGTGA
GGCAAAGGGTTGGTAGTGACAAATTTGTTACTCATTTGACCTGAAATTGGAGTTTTCATC
TGGCTGTTCATAGCTGTTTGCACACATAGAGGAGGTCATGAGTCTCCTTTATCAAATGCT
GTATGATTACACTAAGCAAACACAGGACACAGCTTTATTTCTCAAATATCTGTCACTGTT
TTATAGTGAACAAATAAACAACTTCAGCTCCATTGCAACATTTATTTAAATGTGCATTGC
TACTTATGAGACAGCTAAATTAAATTGGGGAGTATTGTGTCCTGTTTATGACATCTGCTA
CTTTCCTATGGTGGCAGCAATTTCTAGTAACTTGCTAGGAGAGAAAACTGAGTGATGGGA
GTAAGGAGATACAAAACTTACTTATTTGTGCTTTTATAGACTTGTTGAAGGAAAGTTCCA
AGGTGGTAAAGAAGGTTCCCAAAGGAACGTCCAGTTACCAAGCTGAATGGATTTTGGATG
AGGGTGGTGAAAGTGATGGGGAAGGAGAGGACTATGATGATATAAAACATGAGGATTTTA
TGGAAGAGGACTCTCAGGTAAGGCCCTTAGGCTACTTTCTTTTTTTTTTTTTTTTTTTTT
TAGGCCACTTTCATATATAGCTCTAAACAGAAGACAAAATGCAATCCTTACCTTTATTTT
TTGTTGTTGTTGTTGTCTTGGGGATTAAAGCCAGGTCCTTCTTGCTGAGCTGCTTCCCCA
GACCTTTTTCAATTTTTATTTAGACAGGGTCTCACTGAGTTGCTAAATTGCCCAGGTTAG
ACTCAAATTCAAAGTCTTGTCTTTTCTTCTTTTTTTTTTTTTTTTGGTACCAGGGATCAA
ATTTACAACCATCTGCTTGCAAGGCATGCGCTTATGCCGCTGAGCCAAATCCCCAGCTTC
TCTTTTCTGAAATGGGGATTGAACTCACGACCTTGCACTTGCCAGCCAAGTACTTGCACT
GCTGAACCAAATATCCTAGCCTCAGCCTCCCATGAGTGCTAAGATTATAGGCATAAACCA
TCATGCAGTCCTGACCTTTAAAGATATATCTGGTCAGCTTCTTAGGAATGACTATTGTTA
CTAGGGGAAAAGTTTTGTTTTGATATCTGGAGATAGGATCTCACTGTATAATGTAGCTTG
ACCTCAGATTTGGGGCAGTCTTCTTGCTTCAGCCTCTCAAGTGCTGGAATTACAGGCATG
CACCATCAATCATGCCTAGCTAAGAGTTTTATTGTATGACTTTTCATTAGAATTTATATT
GGTTGGGACTGGATGTTTAGTAAAATTATTTTATTCTTAGCTTAATGGTCTTTAGGGTAG
AGATAGGTTGTTTTATTTCTGAGGTAATTACAGTATTGTCCATTGTTTTACAGTATGAGA
GTAGTGAAGAAGAAGAAGTGGAGGAATGTGAAACTATGACAATAGGGGAGTCTGTGCATG
ATGATTTGTATGATGAAAAAATGGATGAGGAGGCTGAGGAAAAAATGTTGGAGAAATATA
AACAAGAAAGAATGGAAGAGATGTTTCCAGATGAAATAGACACACCTCGTGATGTGCCTG
CTAGAATTCGGTTAGTCAACTAGTTTAAATTCAAACAAGCTTTTATTTAAAATTTATATA
AGTCAGAACTATGTCAAGGTGATAGAAAAGAAAACACATTGTCCTTGCTCCTGAAGGCTA
ACATTCTACATGGGAAGGTGACGTGCCTTATATGTACCATGCTCTAGACTGCAGTATAGA
CTAATGTTATAGGACTGTAATGAAGGAGAACTACTAGGGTTCATTTAGCAAATACTTCCT
ACAGGAGCTAATATTCAGTTAAATGTAATGTTTGAAGACTTTTGGGGAATTTTAGTATAA
AAGCAAAAATAAAAGTATGAAGATGTAGATGATTGTGTTTGCTCTGAAAGAGAATCTGAG
TAAAGCCAGAGAAGTTAAACCATATATATATATATATGTATATATATATATATATATGGT
TTATTAGAGTGGTAAAACTATTAACAAGACTCTTGTTTGTTATGTTAAAGAGCAATTCCT
TGATACATGAGGGAGCCACTGTAATTTTGTCTTTAATTAGTGCAACACTTTAGTATGGTT
GTGAAATAACTTGTTAAAAGCTGTTTTAGTATGTGATCTTGATTTAAGATTTTAGGGTAT
TTTGAGATAATGACTAGAGTTCTTTTAAGCTACGGTAGTAGTTTAGAGGTGGTATGAGCC
TTGCATAGCACCATATAAACTCTTAGTTTCTTTAAAATCTCCTGTATCTTTTTATTTTAT
TTTATTTAAGAGGAAAAAGAGAAAAACACAAAACAAAACAAAACAAAGCAGTGTAAGATT
ACACATAATACAGAACTACAAAAAAAAAAAACATAACAGTAAGAAATCACCTGTTAATAG
ATTACATATTATCATCTTGGAAATAGTTGCTCAAATCACAGTATCAAAGAATACAAAGTA
GACATTCAAACAGAGAGACTGCAAACAGCTGTGTTCAATGATCCAAAAACATTAATATAG
TCAGCTATTTAACACCCCTAAACATACTTGCTGTTATATCCGTTAGAGCTCTTTTTTTTT
TTTTTCCTCCCTCTCTTTTTTACAACAAAATCTCCTTTATCTTAGATTTCAGAAATACAG
AGGCCTCAAGAGCTTTCGGACATCTCCATGGGATCCTAAGGAAAACCTTCCTCGAGATTA
TGCTCGTATCTTTCAGTTTCAGAGCTTTGCTAATACTAGGAAATGCATCTTTAAAGAGAT
TGAGGAAAAAGAGGCTGAAGGGGCTGAGGTATTTGCCTTTATTTATCCATCCTATAATTG
GTTACCACATCACTGCGCTTTACTCTTCTTGGCATGAATGCTTAGTTTTGTATTGTTCAT
AATTAAATTTGGGAACCACTAAGTCATAGATAAAAGTGATACTATGAACAAAGGGGCATC
AGAGCTGTAAACTGAAGAAACTAAGGTATCTGTGTGAAGCAATCTTGAAGAGTCAGGCTG
ATTTTAGGGTAGTTTGAGAAACTTAATGGATTTGGAGAAATGTTTCATCATTATTAGACG
TTAGGGGAATACTGATTGTTTTCTATGTCTGGCAGGTTGGCTGGTATGTCACACTTCATG
TCTCTGAAGTCCCTGTCTCAGTGGTTGAGGACTTCAGGCGAGGAGCACCCTTGATTGCAT
TTTCTTTGCTACTTCATGAACAGAAGGTAAATCAGGTGTTGTGGGAATGAGGAGTTAAGA
AACTTTCCAATCCCTTCATGACATTTGATCACTGGGATGCAGAATGTGCCATTATGATCA
AAGAACAAAAGAGGAGTCAATGATGGTTATAACCCACAATGTCTGAACCTATCTGAAGCA
TCTTTGTGATGTAGTCATTCTGTCATTCTGAGACTTCTTTAAGATGATTTGAAGGCTGAT
GATTTTATGGCAGGTGTTGACCTTTTTCATGTTAGATGCAGGAAGGTAAGCCAATTTAAA
AGAGTTCATGAAAACTCTGATGAACTGATGTTCAACCCTAAGGATAGTTGTTGCTAGAGG
ATAAATATGTATCCTATCATTTACCATCTGCTATTAATTATCATTGTCAGATCTGTTTAT
CTTACTTCAGGTTAGGTTACTGTATTCCTACTTCAGGTTAGGTTATTGTATTCCTAGACT
ATAAATTTTTTTCTTATTTTGTCCTCAGATGTCAGTATTGAACATGGTGGTGAGCCGGAA
CCCTGGAAACACTGAACCCGTGAAAGCCAAAGAGGAACTGATTTTCCATTGTGGATTCAG
ACGTTTCCGAGCCTCACCTTTATTCTCTCAGCACACTGCAGGTTAGAAGAGGGGAAGTGT
CTCGGTTCTGGTCCATTTTAATATCTTTTAGGAAACTGACTATTTGGGAAGTGCGTGGGA
AAGTGCAGAATACACAGTTGAGTACTCTGACTTAGGAGCCAGTGATGTTTTTATTCATAA
TGTCTGAACCTATCTGAAGCATCGCCATGATGCAACATCTGTTACTGAGGCTTCTTTGGC
ATGAGTATTTGTTCAGTAGGTTTTGAATCAGAGTCAGCAGCTTTATGAAAAAGAATGTGT
CACCGTGTGGGAAGTTGGTTTCTAGTGTGCCAGTGCCATTGTGAAGTAATAGAGGTAGGG
TGTGGCCCAGAATTAGGTAAAGTGTGAATTTCAAGGTGTTGCGACTAGATGAGAATTTGG
AAAGGCATAGCCAGGGACATTTGTGTGGCACAAATGATTGTGCTCCTACATATTAGGAGT
AGCAAGATATGTTGTCCACTAATTCAGTAGCCTTTGAAGATAACCTTAGCTTTTTCAGCC
CTTAGCAATGGTAGAAAAGATGAAAACAAATTGATGGTGCTCTGGAAAAGTTGTATTATC
TGGCTCTTTCCAATAAATGTTTTCCAGTCCCTGCTCAAGATTAAGGGCTGATGATTTAGC
AGAGGGAGTCTCAAAGCACTGATTTTCAAATGAGGTAGGAGTGATAGGCATCAGAATCAC
CTGGAGAACTTTTTGAAACCCAAGTATAGTTTGGTCCCCAAGATATCTGTCCCTAGTTGA
AAAATGACAGGACTGAGTTACATTTTTTTTAGTAGTACTGAGACAGGAAAAATTACTAAG
AATTAGTGGGGCAAAGAGCCCAGGCTGCTTTCAGTTTGAGTTGCAGTTTGGCATTTGGGC
TGGAGGTATAGCTGAGTGCTTGGCTAGCATGTGTGAGGCCGTGGGTTCAATCACCAATAC
TGGGGGAAAAAAGTGCTGTGATAAAGTTTTTCCTTATGGTTTCTCACAATGTTTTTGGTT
TAACCTTTATCATGGCAGCGGATAAACACAAATTTCAGAGGTTTCTGACTGCTGATGCAG
CCTTGGTGGCAACAGTATATGCACCAATTACTTTTCCTCCTGCATCTGTGCTTCTTTTCA
AGCAGAAAAGCAACGGTGAGTTGAGTTCATAGGAGTGAATAGCCTTACCTGTCCTTAATA
TGATTATTATATCTTTGTATTTTGATTTGGAGCCAAACAGTATAGAAAAAGTAATTATTT
TCAGTCTTGGCCTCCCAGTGGTTATAAGTCAGGGATGATAAACTTTGTTTTCTGCTGTTT
GCAACTCTTAGCTAATCAGTAGAGGTTGTTTAGAGTGCTATATTTAGGATAGGTTTGAGC
ACAGACTCAGTAGGAATATCATTTAGTGAACTTTGCCAGTGGGCAAAGTGGGGGGATCAT
AGTGCATATTAATTCTAAGATTTCTCCAAGAAAATCTTACCTATGAACTATCTTTAAATG
GATGGACTAGATAATTACATGAGACTGTAGACCCTGAATAACTTTTCCTTTCCCCTTTAG
GAATGCACAGCCTTGTTGCTACAGGACATCTGTTGTCAGTGGATCCAGACAGAATGGTCA
TCAAGAGAGTTGTTCTGAGTGGTCATCCCTTCAAAATTTTTACTAAGATGGCAGTAGTGC
GATACATGTTCTTCAATAGAGGTAGGTAGGTATGAAGGAGGATGGGATCTGATTGCCTTT
TTGTGATGTGATGGTTGGGCTTACATTTATGAGTATATTTATCTTGGTCTTCTCTGTGTN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1021, 1027..1428, 3031..3187, 3579..3736, 4553..4749, 5805..5967, 6275..6385, 6868..7000, 7998..8114, 8520..8659
1001..1021, 1027..1428, 3031..3187, 3579..3736, 4553..4749, 5805..5967, 6275..6385, 6868..7000, 7998..8114, 8520..8659
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved