Cavia_porcellus Locus PABPC4
snOPY snoRNA Orthological Gene Database
Cavia_porcellus PABPC4
Cavia_porcellus
PABPC4
GeneScaffold_1017
SNORA55
19012..19144
26612
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTTGTATAGGAAATCTGGTGGAATGCAGGGA
TAAGCATCAGAAAAATCTGGTAATGGGTTTTTGATCACTAGCTAACTACATAGCATAGCC
CACCGTGAATGTAACTATTCTATTTTATTAAAGATGGAGTTTCAGCTGTCCCACCTGAGT
AGTCACTGCAGAATCTCTAGCTTAATCAAAAGTGAGGTATTATCTTGTTTTGGCGCCATG
AAGGTTTCCCACCACTTGCCCATCCTGGGGATTGAACTCAGAGCTTTCACACAGAGCTAT
GCCCTAGCCCTGTTCTTTTTTTATTCTGAGACAATATCTTGCTAAGTTTCTCAGACTGGG
CTTGAACTTGTGATCCTCAGGCCTTAGCCTCCCAAAATGCTGGGTTTACAGGCATGCCAC
TACACTTGGGGAAGGCCTGTTTTAGTAGAATTGCCTTTTATCAGTGACTACCTGGAAATT
TGTGGAGTAGTCCGTGTGTCTCCCAGATAATGGCAGTCACCTATGCTCTCATGAGTTGAT
GTTTTACATCCTGGATTGAATTGTGTTTGTTTCTTACAGCTGAGCGGGCCTTGGACACCA
TGAACTTTGATGTGATTAAAGGAAAGCCAATCCGTATCATGTGGTCTCAGAGGGATCCCT
CTTTGAGAAAATCTGGTGTGGGAAACGTCTTCATCAAGAACCTGGACAAATCTATAGATA
ACAAGGCACTTTATGATACCTTCTCTGCTTTTGGAAACATTCTGTCCTGCAAGGTAAACA
CAGATTAAGTGAATTCAGCAGATTTCTTTTTTAAGTTTTATTAGTGTATGTTTGGAATTC
ACACAGTTTAGTCGTTTTGGGGAGTGACTGTATGTACATATTATAGTTCGGTGGGGTTTT
TTTTCCTAATCCCCTCTACTTGTGTTCCCCATCACGTTTTTTGTACTTGTTAATACTGTT
CACCTTAGCTCACATTAATGGTGTATAATGTGCAGACCAGTTGGAGTTACTTGGACCTTG
TATAGTGTATCAGTTCCTCTCATTTCCCCTTCCCCACCTCCTACCGCCTCTCCTTGTTCC
TTTGAACCACTTTGCTGTTGGATGGGAAACAGAATAATTACGAATCTTGTTTGTTTGTTT
GTTTTGAGACAGGATTTCACCATGAGTTTTTAGCCAGCCTAGAACTCATGAGAGTCCTCT
TGCTTCAGCCTGCTGAGTGCTAGGATGACAGGCATGTGCCACCATTCTTGGCAGTTACTG
AATCCTGAGATAAAATAAATACTAGGTGGGGAGCTTATCCCACTAGGGATAGCAAGTTAT
GGTAATTTTCAAAATGCTGGAAGTGGAATCTCAAAAGTTCCCATAGGATATTGTCAGAGC
CACGACCCAGCATAGCTAGCAGGTGCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCCAGTGGTTCCTTAAG
GTCATCGAGCCTTTTCTTTGAACAGGTGAGTGTGTGATGAAGAATGGCTCTAAGAGTTAT
GCCTTTGTCCCACTTCGAGACCCAAGAGGCCTGCCGACAAGGCCATCGAGAAGATGAATG
GGCATGCTCCTCAATGACCGCAAAGTGTGAGTGTCCCAGTCCGGAGCATCAAACCATCGC
ATGAGCCAGCTGTGGCCCCACTTCGGTATTAACTGGCACACACAAGGCGGCTACTGGTTC
TCTCGGCCCAAGTGTGGCCTGCTCCTACCTCTCCACTCCAGGGCTGGTGAGTCTCCCTGC
CCGAGCTGTGGCAGCCCTTTTGACTCGCCAAGGTGGGCTCCCTGCCCATGCCATGGCCTG
CCTGCTGCCTCTCCCTTAAAGGCATCCGTCCATGGGTTTGTGAGCACCAGCAGCTGGGGT
TGCTGGAGGCAGCTCTAAGCCCACTTTGAGCAGGGGTCTTGGCCAGCGACAGAGTGGAGA
GGGCCCTGGGCTCACCAGGCACCGTATATTAGCTCTGTGCCCTTGACTTCTTTGACTCAG
GTCTGTCCATAGATCTCACTGGTTGTTGATACCTAATTGTCCCTCCTATTCTCCATTCTT
TAACCTGTGGCTCAGAAACCAGTATAAGACTTGCTCCACAATAATATTGGTTACAGTGAA
AACCCCACCCTCTGAAAGAGAGGGTTTATAGCAGATCTCATTGCTCTGGTGCAGTTGTGA
CTGTGGAGTGGAGAGGGTTGTGAAGGGGGTAAAGTACTGCATATGTGTCTTCATTATTTT
AAGCGAAAGTCGTGTCTGTCCATGGTATTGAGGGAGTCAGAGGATGCATTGTACTTAGAA
CATCTGTGTGCCCAGTGGTGACTAATCACAAGAAATGGAGAAATGGTCAGTGTACAGAGA
CATTTTTCCCATCAGATATACTAAGGTGAATACAGTAAAATAGCAAAGGTTATCTCTCCA
CTTGCAGCAACTTCAAACCTACGACTGACTAACCACTGTTAACAGTTTGGTTTGCATTCT
TCCAGACCTTTACTGTACATCATTTACATAGGCACAGATATGAACATTGTTTTTTTTTTT
TTTTAAACATGGTCATTAGGTTTCTTATGAAGGCAGTGTGATGTGACAGGAGTAGCCCTG
GTCTGAGCCAGGAGCCCTGGGCTGGTCCTTGCAGGATAGTCCTGCCTCTTCTCTTTCTGT
TGGGTACTTGGGGTATCTCTGAGACTCCTCCTGGATAGGTGGGGACTTAGTGTATTTTAA
CTTGCCTGCCTTGCGGCCCCTGGAAATTCATGTTTTAATATCTACTAGGTGATAACTTAT
TTCATGGTTTCTTTATACGATTTGTAGGCAGATTCAAGTCTCGCAAAGAGCGAGAAGGCT
GGAGCTTGGATCCAATGCCTAGTGTTCATCAATTGTTTATATCAGGAACTTTTGGACAGG
AGGTGTACGATGACATCCTGAAAGAGCTGTTTAGCCAGTTTGGTAAGTTGATGTCCTGAG
TTCACATATTCCCTTTTATAGTCTAGCAGCCCTGGAGTACCACCTGTTACTTAAAGAGAC
GCATGCCTTCCGACCCAGAAATAAAGTACCTTATGTGACACAGGTCACAAGGTGTACAGA
TAGGCTTCAGGCCTTGGCTTGGTTTCATCCTACCTCCTTTCACCCCTAAGGCCATCTCAG
CTGCTTAGTGAGAATTAGAAGACCAGACATGGCACCTCTTTTTCTGTCTCGTATCTGTCG
ATTCTGCCAGAGATTTGCTTCAGTTGGGTTTCTAGAGAGAATCCCTCTGTGTGCGGTATG
GTAGAGATGGTGTCACTAATAGTTCTGTCCTTTGATAATAGGTAAGACCCTCAGTGTCAA
GGTGATGAGAGATCCCAGTGGAAAATCCAAAGGCTTTGGCTTTGTGAGTTATGAAAAACA
CGAGGATGCCAATAAGGTGAGCAAGCCTCTTTTGAGGGTTGGGAAGCCTCTATAGGCGGC
TCGCGTGTGTGGGCAGACCCTTGCTTAGCGCAGAGCACAGTTGAGCGGAGCTGAAGTGGT
GTGAGTGGTGGTAGATGCATTCTCTGCAGAGCTGTGTTCCTCGGGGGTATGTCAATCACT
GTGGTGGTTAACTGTGGTTTTTTGTTTTTGTATTGTTTTGATTTTAGAGGCAGAGTCTAG
CTCTGTAGTTCAGGCTGAGCTCAAACTCAACATGGATTCTTCTGTCTCAGCCAATGTGTC
CAGCTACTTAACTTATTTAACTGTTTTAAAGCACTTCCCGTACCTGTCGCTGTCAGCTGT
TGAATGGATGACAGATGTTTGTTCTCATTTATAGGCAAAAGAACTAAAGTCCAGAGAGTT
GACCTGATTATAGCACAGCTGCTACTTTTCAGCAAAATAGTGAGCTAGGCTCTCAGCATG
TATCACTTAATATTCACAAAGGAACCTGAGATATTTAGTGATAGCCACATTCAAATTAGG
GTACTGTTTATTTTTTGTTCATTTTGGTTTTGGTTGAACTCAAGGTCTCCTGCTTCAGTC
TCCTAAGTGCTAGAATTCCAAGCATGTACCTCTGTGCCTAGATCCCATTTAGTATTAACC
CCAGTTTACAGATAGAGGAATTTTAAATGTTTGGCAGACTAGAAAGATGAAATAAAATTA
ATATTAGCCTGTATAAAAGATTTTCTCAGAACACTTAGTTGAGCTTACAGTGCTCCCAAT
AGGGCTAGTGTCTCTGTGATTCATGTTTGTTTTAAAAGACATGCGTTTCCTCTCTAGGCC
GTGGAAGAGATGAATGGAAAAGAAATCAATGGGAAAATCATATTTGTAGGCCGTGCACAG
AAGAAAGTAGAGCGGCAGGCTGAGTTAAAACGGAAATTTGAGCAGCTGAAACAGGAGAGA
ATTAGTCGATACCAGGTGAGATGGGGTGAGCCAGCCCGTTGTGGGGGTATTTCCCATGAA
ATACTTGCAAAGCACCCTTTTAGCAAGCTTAAAAGGATCTGTACCAACCAGATAAGGCAA
CAGTTACTTAACAGGGGCAAGTGACTTCATTTAGAAGCCCTCCATTCTGGAACCCTCTGG
CCTGTTGTTCCTTGCTGCATAGGTTCCTTTTTACTCAAATGGTAACCTCTAAACATGTAG
TAATAAAAACTGGTGCCCCTTCGTTAGGAGTAGTGCAGGAATGCTGCCTGGGTAAGTGGT
TAGCCAGAATTCCCTCTGGAGGAGGGTTACGAGTCCTGCATTGATGGTCTCAGCAGTCCC
AGGTAATTTCTCAGCATTGAGATTGCAACAGAATTGTCAGTGGGACTTGTTTTTTGAGAC
AGAGTCTAACTATATAGTTCAGGTAAGTCTTGACCTTGGGGTAGCCAGCCTCCCAGGTGC
TAGGGATTACAGACATGTACCACTATGCCAGGCCAAATCCAGCTTTTGTGTATATGTGTG
TGTGCTCTACTTGATGAAACATGCTGGGCTCTAAACCCAGAGTTCCTGATTAATTGGGTT
TAAGGTCTAGCCTAGAAATCTACCACCCCTACAATGTTGGGGCTCAAACCCAGGGGTCTC
CTGTCTGCTGTGCGGGCCCTCTTCTACTAGTTTGTTTTTTTTTTTAAGGCAACTTTTCAG
TTATCCTGGCTGGCCACAAACCTGAGATCTTCTTGCTTTAGCCACCTGAGTAGCTGGGGT
TATGGGTGCAGTGGTGGGGAGGTGAGACAGGGTTTTGCTAAATAGCTCAGGCTGGCTTCT
AAATCTAGACAGTCCTCCTGCCTCAGCTGTACAAGTGCTTGGACTACAGGTATATATCAT
CACACCTGGCAAGAATACTCATTTCTGTTTGTCTTTTTTTGGAGGGAGTACCAGGGATCA
AACTGATGACCTCACACTTGCCAGGCAGGTGCTTAAGCTGCTGAGCTAAATCCCGGCCTC
TAGAATACTCGTTTCTAACAAAGTCCCAAACAGCTAGCTCTTGCTGTTGCTCTGGGGACC
ACAGATTGGGAACAACTATTACAGAGAAATTAGATTTAGAAAGAAGTTAATAATGATGTT
TCTCTTTCAGGGAGTAAATCTCTACATTAAGAACTTGGACGACACCATTGATGATGAGAA
ATTAAGAAAAGAATTTTCTCCTTTTGGATCAATCACCAGTGCTAAGGTACTTCCATACGG
AATTTTGTAGTTGAAAACACTTTCGCAGGTTTCTCGGTCTAAGTTAACTGGTGTTTCTGA
GTGTAGCTACTTCCTTCGGCATAGCGTTTACAAGGGTGCGTCACAGGATCAGCATTGCTG
TCCGCCCTGCGGTGGACACGAGTCTGAGCCAGGCCTCCTGCTGCCTTCCTCAGCACCCAA
TCTTTCCCATTCCTGCTGCTTTGTGCTGGCCTGGGGACAGTGGGTGCTACAACATGAGCA
GAGGATATCCAGACGGGTTGCTTTCCATTTGTCTTGGGGCCTGTCTCTACAACTCTGCCA
CATTGCTCCTTGAGAGTGAAGCTGTTTTGAGGATTTGGGAGCTGGGGCTTAACAGCCATT
TTCATGGTCTCACTAAGAAAAATAGTGGAAGCTGAGCATGTTGGCGCGCACCTGTCATCC
TAGCACTTGAGAGAGGCTGGTTCAGGATCGCTGTGAGGTCAAGACCAGCCAAGGCTTTAG
CCTTGTGTGAGGCCAGTCTTAACTACATAACAAGACACTGTCTAAAAAAAAAATGGGGTG
TTTTTCCATGGTTTGGCTTCCTTGATGTTCTTTGATCATATCAATTAAGTCAGCAGGCTT
TTAAAGACAAAGAATGAGTCCTTGAGCCAGAAAAGAACGTTGACTGTGTTGTGGTGGTAT
GCTGTGTGGTCGTGGCACTGAGGAGTGTGGTGGGGGCTGGGGACACCAGGGAAGTTTTAC
ATCCTGGCCTGTCTGGCAGAGGTGCAGTAGAGGCCACAGAGTCCTTTGGGAGATGAATGG
AGGTTGGGTTGGCCCTACCCTGGCCCTTTGCGAATGTTGTTCTCAACACTAGAACACTGT
GCAAAGAAACTTGATCAGTTGTGGGAAGCTGAGCAAGGCCATCTCGGTGGGGTTCGCCCT
CTTCCTCTCGGCATCACTCCTCTCACTGGTCTCTTGGCTGCAAGGGATGATATTTCTGTC
TACCTGCACACCTGACAAGTTGGCACTGGTGAGGAGTGGCTGAAAAGATTCGAATTAGAA
GTTTCAGGCAGTGTTGTTTTGTTTTGTTTTTAGTAGTATCTATTTGGCATACATAATGAT
CACATTCAGCATAGGAAATTGGTGACTGTTCATAATAATCTTCATATCTCCCGTTCCCCT
CATCAACTCCTTTCTCCCCACTGACAAAAGCTTGTTTCCATTTTTCCCTTCCATTTGATT
TTCATAATCCTTTTCCCTCCCTCTCTTGTTCCTCTCCCCATTTGATCATGTTGCTCCTAT
TTCCTAATAATATTTACCCCGTTTTATTCCTTTTGAGTTTCTCGCACAAGGGAAACAATG
CAGTATTTAAATTGGTGCAGGCACTGTTCTTCAGATTCTGTTGGGGCATTGTTTTACACA
CCTTACTGGCCTGCCTCACTGGTAGGAAGTTACTGGGTTGGTACCTGTCGATATCCAAGT
CCTCCACTTGAGAGAGTCCATCCAGGCCACTAAGACACAAATGATGTGAAGCACAAGAAG
ACATATACCTGGGAAAATGACTGCCCAAATCAGAAGCTCTGTGGCTATTTTACAGCTTTT
TGTCCTGGAGTAGACCATAGAAACTGAGGCTCAAAGCAATTAAGAGTTGAGTTAGATTCT
GGGTTCCTGGGCTCGGTGAATTGTGTTTGTTGTTCCTATCAAGTTAGTGGTGGCAATCCT
TGATGACCTTGTTGAAATTTTGTCCATGAAGGCTTTGGACTGGATTAGCTCTACAAATAA
ATTGCTCCACACTGTTATCAAGGATACCTAGGGGTGTTGTGTTGCTCAGATATCAGGAAA
TGTCTTCAGGTTCTGGTTCTACCATTAGCTACATCATAGGGTTTAGGGAATGTTAGCATC
ATCTGGGGATTTAAAGAAAATTTCTAGATACCTTAAAGGTACATCTTTACTGGTCCTAGG
GTACGTTCTAGGTCACAGTGCATCCTGGACCTAAAATTGGTAACTCTGGAGCAGAGTCTA
GATTTTTGGCTGTCATGAGTAGCTCCTCCTCACCACATTTAGGTAGCTGGTCTCATTTTG
TAGGTAATGCTGGAGGATGGAAGAAGCAAAGGATTTGGTTTCGTCTGTTTCTCATCTCCT
GAGGAGGCAACCAAAGCAGTCACTGAAATGAATGGGCGCATTGTGGTTCCAAGCCATTGT
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNAGGCTGTAACTCTGACCCCTTTTCAAACCATTTTTGCCTCACTCTTCCTGCTATCC
CCACCTTTCCCAACATGTGAGAGGCTGAGGCAAGAACACAAGTTCAAGCCCAGCCTGGGC
AACTTAGATCCTGTGTCATAATGGGGGGGGGGGGGCGGAATTGTAGCTCACCCAGTGTGA
AGGCCTTGGGTTCAACCAAGTATCCACCCAAAAAGAGAATGAAGGACTTGATCGTGATCA
TACACGCACAGTAGAAGGGAGAGAATAGACTGCCCTGAGGACCCTTAACCAGCACTTCAG
CTTTTGAGTAGAGATCTTTATTCTAAATAGCCTCGGCCAGTGGTGTTGAACCTTTGACGT
GTATATTGTGTTTAAGACAAAAAGATGTTACTGCACAAGTTGTTCTTATAAATGAAAACC
CCAGTATTTAGGCTTAACTGCAATGTTAGTTCTTTGCGATAAATAATTAGGTTTTAGATT
ATAGTTTGGGCATTTGTTTCTAAAAGGTTCACCGTCACTGGCCTAGGGCCTAGTAGCGAG
GTAACAGTTTAGCTGGGTTCAGGTCTGTAAAATAAAAGGACTTAGGTGCTCTTTCCCTAT
AGGCTCAGGGACGACCGCCGTATTACACACCTAACCAATTGGCACAGATGAGGCCTAATC
CACGCTGGCAGCAGGGTGGGAGACCTCAAGGTAAGTGGTAGGAGCAGAGCCTGCCCAGGA
TGTACCTAGTCTGTCTGCCTGCTTTTTCCTGCATGCATCTTGTGGGGCAGAGCCTAGCTT
CTCTTGGTCCGTGTTGCTTGTCAGTAATGAGCAATTTCTGTCTTACCTCCAGGCTTCCAA
GGAATGCCGAGCGCTATACGCCAATCTGGGCCTCGTCCAACTCTTCGCCATCTGGCTCCA
ACTGGTAATGCTCCGGCCTCTCGTGGCCTCCCTACTACCACTCAGAGAGTCGGTGAGCAA
ACTGGCCTGTAGGAGCGTGGCCTGGGGAGGAGGGAGTCAGGAGAACTAGCTCTGCCCTCG
CTTGGTCAGTTTGTTCGGCTCATGTGTGGAGCCCTGGTTCTGTTACCTTAGCTCTGTGTT
TGAGTAGGTAGGTATTTCATTCAGGAGCAGACAGCCAGTGTGAGTTCTGGGTGCGCTGGT
TACTTCCACCATTCTTTGCTTATTGGTGAGTCAGGTGAAAAATGTTAATCATATTAGTTT
GCTAACAGGATGACAACAGAGCATATATTTGGTGGGGCGGGAGATACAAGGAAGCTTTTT
TACAGAGTGTCCTGTTCTCCAAGATGTGGAAAAGTTGTGTTAGTCTTTGGCTTATCCTGG
AAAGTAGCAGTAGTGGCCCAGAGTGTGATGTGTCATGTGAACGTGCTTTGGAATCTCTCC
TTCCGTGGGACGTGGCCAGTTGGACATTGGCCTCCAACACTGATGTGCATTTGCTGGTCT
GTTGTAGGGTCTGAGTGCCCGGACCGCTTGGCTATGGACTTTGGTGGGGCTGGTGCCGCC
CAGCAAGGGCTGACTGACAGCTGCCAGTCTGGAGGTGGTATTGGACGCACACAGAAGGGG
GAAAGATGGGATTTGACGGGCCTTTGCCCAGACTGATGGGCTTTAATTGCGTTCATTCTT
TCCTCAAGGTGTTCCCACAGCAGTCCCGAACCTCGCGCCTCGGGCTGCAGTTGCTGCTGC
CGCTCCTCGGGCTGTGGCCCCATACAAGTATGCCTCCAGCGTCGCAGCTGCACTGCCATA
CAGCCAGCAGGTGAGGCCACCAGATGTGTCAAAGCATTTGCCCCATTCTACATAGTCCTT
CAGGAGTATTGCAACCCTGCCCCCAGTTACAGTGCTGAGTTTTGGGTTTTGGGTTTTTTG
AGATGGGGTCTTGCTGTGTCACAGGCTGGCCTTGAATTTATAGTGATTCTCCTCCTTAGC
ACCAAGTCCTGGAGTTCCAGGTATATGCCGTCAAGCCTGCAAGGTCCCGTGCTATGCATG
GTGATTTGGACCCTGTCCCTGAGAAAGTGTTCTTCTCAGAATAGCTCACTGGCCCACAGC
AGGAAGCAGGTGCTTCCTCTGCTGCTTGTGTGACACCTGTGCTGAATATTCTGAGCCCTG
GGTGACTTTTCTATCCAGTACCATATTTGATCCTTGACTGCTCTGCAAGGTGATTGGGAT
ATTAAGGCAGAAAATAACTTCAATTTAGAAATTAAGAAACTTCTCTCAGATGACAAGGGC
AGAAAAAAAAAAAATTAAGAAGCTTCAATTTAGAATTTAAGAAATTCAGCATTAAAAGTG
TTAAGAGCAAATAGCCGGGGGATTTAGCTGAGTGGCATAATAAGTACCTGCCTGGTAAGC
ATGAGGTCATGAGTTCAGTTCCTGGTACCAAAAAAAAAGAGAGAGAGAGAAAGGGAATAG
AGTAGCTCAGATTGCCTAAGCTGGAATTTTCAGCCTTTAGAGCTGTGCTCTTCAGTGCAA
ACAAAGATACAACCAGTTTGCTTCAGAGCTCAGCAGTTTTCTGTGGCAAGGCCACGCTCA
GCCATTAGGTCCATAAGCTGCTTCATAGTTCTTTTTTTTTAATCAGTACCAGGGATCGAA
CTTATGACTGCCTGCTTGCAAGGCAGGCGCTTATGCTGCTGAGCTAAATCCCCAGCCGAT
AGTTCACTTTTTAGATGTGTCCCCCACCCCCAACATACTCTTAAGGGATTTCCCAGGGCT
TGAGGTGAGTGTAAACTGTCTTCTGCACAGGCCCTGGTTTTAGGGCTGTGCGGTGAGCGT
TAGTGCTGCATGCTGGCAGTCCTCAAGCAGCTGATAATAGTAAAAGCATTGTCACTGTGT
AGGTGTGGTGTAGGATATAATTATAAATATTTTGATAGGCACATTCTTTGACCCAGCCTC
CACTGAAATTAACACTAAAGGAAAGTTCCAAGAAAAGGCTACCTGCACAGATGTTCATTG
TGGCCTGATTTATGGTACAGCCTTGAATTTTTGGATAGGTCAAATTGAACATCAGCAAAT
GGTTGCTTAGCATTATGCATTTGTTTTATTTTGGGGTTTTACTTACCCTTCTGATAGCTT
GTCCTTTTTGAGTTTTTTTGGGAGGGGGAGGTTTTGAGACATCTAGCTGTGTATCCCAGG
CTGGTCTCAGACTCAAAACCATCTTGCTGTGCTACCATGCCCAGCTGAACAGCGTGTCCT
CTCGCATTGCAGTTAATGTCTGTAATATTCTGTTCCTCGAAACTGAAGTTCAAGAAAACA
AAGCTGCCCCATTCCTCTTTCAGATTAAGAACCTAGATGTTGAGATGTTGAGTAGTGAGG
CTCTCAGTCACTGCCCAGCATCCTGTCTTTGGTGCTAACCTACTGCCTGTGCTGGCTTCC
AGGCACCCCAGCCTGCTGTCCACGTGCAGGGGCAGGAGCCCCTGACTGCCTCCATGCTGG
CTGCCGCGCCCCCCCAGGAGCAGAAGCAGATGCTGGGTAAGTGCGCCATCAGCCTGTAAG
AGGAGGTTGGCTAACCTGGACGTCAGTGTTCACTGAGGTTTCTTCTGTTTCTTTTTTGTA
GTATTTGGGACTAAGTCCAGGAGTACTGAGCTACAACCTCAGCCCTTGTTTAAAATTTTG
AGACAGGGTCTCCCTAAGTTACCCAGAGTGGCCTCAAACTTCTGGCCTTTCTCCCTCAGC
CCTCTGAATAGCTGGGGATTAACAGATGTGCACCACTGATTTGAGCTGGTCTTTTATTGA
CTGTCTTGTCCACAGGAGAACGATTGTTCCCACTCATCCAAACAATGCATTCGAACCTGG
CTGGCAAAATCACGGGCATGCTGCTAGAGATCGACAACTCAGAACTGCTGCACATGCTCG
AGTCCCCTGAGTCTCTGCGCTCAAAGGTGAGCTGCTGCTCAGAGCTTGCAGTGACAGCTC
TCGGCTCGGGAGGGTGGAGGGGGCCTGGACACTGGGTCCAGCAGAGAGGATATTCTGCCA
CCTTATTCCTCTCATGCCTTACTTGTGATTGATGCTGCTAGTGTGGGTGCTGAGACGTCT
GTCAGCAGAGGCCACTGGGCCTGGGTATCGGGGAGGGACCTGGTGCTCTCCTGAGTCACT
GACTGCGTGGCGGATTCTCCCAGGTGGATGAAGCTGTGGCAGTTCTACAGGCTCATCATG
CCAAGAAAGAAGCTGCCCAGAAGGTGGGCGCTCGTGCTGCTGCTACCTCTTAGACAAGGA
AAGACACTATGTTTGCCTGTCACATTTTCAATCATTTTGATTTATAAATGTCTTTGTAAA
AAAGTGAGGACATTTTTCTGACATTTCACCTACGATTTGGCTTCTGAGCCTCCCACCTGA
ATCAGTTACTATGGAAAGAACGAAGGGGTTTGGAATTGAAGAACAAAGAGCCAGGTACAG
TGGTCATGTCTTCGGTTACACTGGAAGCTGAGGCAGGAGAATTTGAGCCCAGGAGTTTAA
AGCCAGCATGGCCTACATTGCAAGACCCTGTCTTGAGGGTAGAAAAAAAGTTTTCTCAAA
GAGGTCAGATTTCTCTCAAGAATGTCCATAAAACTACCTCTGTTGGCTCAGATTAGTCTG
TGTGCTTAGCACATAGAAGGCCTTCATTTGTCCTCTAGCACCTCTCTTCCGTCCTGTCTC
TGACACAGTGGTAGATATGTAAGGAGTTATCACACACCAAAGCCTCACGACTGTGAGCAT
CGTTTCCTGGTTTGGCCTGGTGAGGCTGGAGAGGTGTGTATACCTGCAGCTTAGCTGTGG
CACACAGCAGGCACTGGGTTGTGGTCTAGTGCCAGAGACAGCCCCACGTGAACTGCAGTT
ACAGAGTGTGCCCCTGCCTTGCGGAGGGGGGACAGGGGGGCGATGGGTGAGTGAAGTTTC
AGCCGGCCCGGGGCCTCGGGGTAGGGAAGGGAGAGGCACGCTGAGGTTGAAGGCCCTCTT
CTGGAACACCTTTGTCAGGGAGTCTCGGCAATTTTTTTTTAAATTTGTGTTGGTGCTTTT
GTTTTTTTCCAGGATTCAAAAGCCAAATAATCCCTCACGGAATTGAGCTCAAGGTTTGAA
GACTTCCTAGTTTGTCCTATGGACCTCAACACCAAGAACCACAAGTTGCAAATTGAATAG
GTCATTTTGTATCAAAAGGTCAATTATGAAGCACCTAGAACTTTTCAATTATAAAAGTAT
ATTCTCTGGGTTCTGCTGTGGCCCAGACATTTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1192, 14725..14727, 14729..14739, 14741..14769, 14771..14789, 14791..14820, 14822..14845, 16039..16076, 16079..16098, 16104..16111, 16113..16135, 16137..16181, 16541..16635, 17457..17594, 18730..18825, 20883..20981, 20984..21154, 22022..22109, 22252..22371, 22867..22953, 23048..23139, 23142..23162, 23164..23169, 24782..24875, 25155..25285, 25523..25612
1001..1192, 14725..14727, 14729..14739, 14741..14769, 14771..14789, 14791..14820, 14822..14845, 16039..16076, 16079..16098, 16104..16111, 16113..16135, 16137..16181, 16541..16635, 17457..17594, 18730..18825, 20883..20981, 20984..21154, 22022..22109, 22252..22371, 22867..22953, 23048..23139, 23142..23162, 23164..23169, 24782..24875, 25155..25285, 25523..25609
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved