Cavia_porcellus Locus Poly:SNORD49
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Poly:SNORD49
Cavia_porcellus
Poly:SNORD49
scaffold_61
SNORD49, SNORD49, SNORD65
1001..1073, 1777..1848, 2782..2852
3852
CTGGAGAAGCAGGAGAGCAAAGGAAGATGTAGGTCCCCAAAACGGAGAGGAAGAGGGGC
TTCAAGTGGACCCAGACTTCTGGTTGCTCCTTCAGGGTCATCCTTACAATGAAGGATGCC
AGTGTGCAAGGGGTCTGAAGGTTCCGCGGAAATTCTGGGGCAGCTGTGGGGAGACAGTAG
ACTGCCCCGATTAGATTCAGGAGCAGAAACTATTTCTGAGAGCTTGCTCTGTGTCCAGGG
TCTGCATTCCACACATGCGGTCTCATCTAATACTCACAGCTAACTTTTGGGGCCCTTGTG
TCTCCATTTTTATCCTCAGCCATCCGAATTCACCAAGGTTAAAGCCGAACTCGACGCCAG
ATGACCAAGACACAGACAACTTCGCGCAAACCTTGGCGCAAGCACTCACTCACTTCATTA
CCCAGAATCCTCTTTGGCGTGGACGAGACCATTAGCTTAGTAGGATGGGGGGAGAATCCG
GGGGAGATCCGGACCGGAAGTTCCCGTGAGTCTTTGCCAGACTCACCCTGTGTTACGTGA
GCCGTGGGACGTTCTGGGTCTTTAAGTGCTGCGGGTTCTAGCAGAGCGGTCTTTTCGCTA
CAGTGACCGTGAGTGTTGTCTGTGTATGTGAGCGACGAGGGCCGATAAAGATCTAGATTT
TTTTTTTTTTTTTTTTAACCACTTTACCCAGGTGTTTTTAGAGAAATTTAGCTAAATGGA
GGAGTCCGGGCGAGAGTTGCGATTCAGTGTTCCATATTTTTCTAGGGCCGCGTTGTGTAG
AATGCTGCGAGCTGCGACTCACATACCGCATGTTTCTCGGCGGAGCCACCGCCGCAGGAG
TGTGAGGTTTGCGGAGAGCAGCTTTCTGTTTCTGCACCCTCCAGGAGGAGTGCACAGACC
TGAAAAGCTGGGTAGGTTGGGGTCTGCCTGGCAGTACCTGGAAATAACTGAAGGGCGCTA
CTCCTAGAGGGATTTTAACGGGAACACGAAGAAGACGTGACTGTTGTGATGATAACGAGT
AATAGGAAGTGCCGTCAGAAGCGATAACTGACGATATATATTCTTGATCTGATTACAGTC
GCTAAAACCTCAGTACATTAAATTAGTTAAATGTGACTGCCAGACTCGACAAGTTCTTGT
TCTTCCTTCTTTCAGATGTCGGACTCAGTGCAGAATATTGAAGATGGGAGCAGCATCTCA
TGAAGTCGGGTGCGTTTAATATTCGAGTTTGGGGGATGGAGATGCAACTCGATGTTGGAG
GGTGGTCTGGCACAGTCGAGGTCTTGGGTTCGAGTTCCAGCATTGAAAAAAAGGGACTTA
GTAGTAATTTAGCTACCAAACAAGAAGTGAAGTTTAGTTGTATCCTGAACATTATAACAC
GTGTTTTTCAGCGGTGTGGAGACTGGAATCCAAACATGTGTTTGTATACAGATACATTAT
AGGTATATGCACTAAGGCATTGGCAGACACAAGGTGTCAGGAGTGTTTTGGTACATGTGG
TTGTGAGGATGTAGCCCCCAGGAACTTCGTGCTGTGCGCTACACCTTCTTCTAGTTTGGT
TTCAGATGTCCATGTCTCCAGTTCGTTCTTGGGGATCCAACTCACGACTGCCTAGTTTTT
TTTTTTTTTTTTTTGTCTTTTTCCTTTTTATCGGTACCAGGGATCGAACTCATGACTGCC
TACTTGCAAGGCAGGTGCTTATGCCGCTGAGCTAATTCCCCAGCCCCTTTTTTTTTCTCC
AGTTGGAAGAGTACTGTACAGTGATGAGTGTTTTGACTGCTCTGATGATACCACTTAATA
GGAAGTGCCGTCAGAATCGATAACTGACGATAACTATTCCTGGCTGACCGCAGTCAACAA
GTCTGCACCAGTTGCTGCTTTTGGCCAGGATTAAGTTGATCTGAACTGTGACAACCTTTC
TACATTCATTCAGGTTGCAGACTGTCAGGATACCAACAGCGTTGTATCACTGGCCCCTTA
AGTCACCTGGAGGGCTGCTGGACAAAGGCTGCAGTGGCAAATTTTTGCTCAAAACCTGTT
AGAGAACTGGCTTTGGATCAGGTAAGCTTTGCTCTCTGGAAGGATTGGTTGGTGGCTGAG
AAATTCTAGGTGTTTGGCCAGATATTGGCGGTTTCATCGTATTACCATAGTATGTGTCAA
TGCCTTGACTTCTATTGGAAGAATATCCTGCATGTCCTGGCTAGTTCATGGGGTAGTGGA
ACCCAGAAGAATGTTTATTCCAAATGGGAAAGTGGTTCCCATTTGACTTGGGTGTTTAAT
CTTGAGCAAATTATTTCTGCCCTGAGGTATAGCTTTCCTCATTTTTGATAAATAATAGAT
TTGTGGGGGCTGGGGATTTAGCTCAGCAGCATAAGCGCCTGCCTGGGAAGCATGTGGTTG
TGAGTTCAATCCCCAGTATCGATTAAAAAAAAAAAAGAATACATCTGTGACTTTGAAGAT
GCCCTACTAAGTAGAGATTTAAGTCTCAGGAGGTTATTTCGGATTTGTAAGTTTAGTAAT
TGGCACAGTGTCCCATCTGCAGGTTCTGAGGGATGATGTTCATAGAGTGGTCTTACTAAG
CTTGTAGACTAAGGCTGTGGAAGGCATTTCCCGTTCTGTAGCTTTCTCTTGTTTCCCCAG
GTTTTGGGATCAGTGCTGGAGTGCAGTTTGAGAGCTGGCAGCAGCACAGCCCAGCAGGAG
GTAAGCCTTGATCTGCACTGTGATTTGTCATGGATTGAATAAGCTGCTGGTTGTAAAATT
GGTTTTTGTGGAAAAGGATATCAAATGATGAAATGACCAAAACTAGCTGGAATTACCGGC
AGATTGGCAGTGGTGATTCATGGTTTTCTGAAGATGTCTTTTGAGTATTGAATGACTGTT
GGAGGGTACAGAAAATGAGACTGAAACGTAGTTTCTTTGCAGGTGAAGGATCTGAAGCTG
CTGTTGATTCTGTTTGAGAATCTAAATGGCTGGAATGTTTGGTGTGGAAGAAACAAGCTG
CTCACCTGTGTCAGAGCCCTTCTCAACAGAACTGATGTCTGGCCATTTTTTTAGGACAGC
GCGGCACACTGAGTCTTTGATTAATCTACCCAACAGAGGAGCTTGTGTGTTTTTGGACAA
GTTTATGTTTACAAATGTTGTTATTAAATACTATTTTAATAAAGAACATTCTTTTGTATT
AGAAATGTATATTTGGGAAAAAGTTAAATTTGACTATGATAAGGTATGAACTTCATTGAA
GTTTGTGAACTTCTGGTCAGTCTTGTCATTTTAACTGTGGGCCTCAAAGTCAGAAACTCT
GAGGCACTTAAAGCATTTATACTTGATTTCAGTGTCTGCTTCTATTATCCTTTGCATGTA
AGTGAGGTGGCTCTGTGCAGTACTTGGCACCAGGTAAGGACTTGTTCAGCCTTCATCTTT
TTTTTTTTTTTCCCCTTTTTATCGGTACCGGGGATTAAACTCAACGACCACCTGCTTGCA
AGGCAGGTGCTTATGCCGCAGAGCTAAATCCCCAGCCCCTTCAGCCTTCATCTTGTTGGC
TTTTTTTTTTTTTTTTTTTTTTTTTGGCGTTTTTCGGGTTTTTATCGGTACCAGGGATCG
AACTCACAACTGCCTGCTTGCAAGGCAGGTGCTTATGCTGCTGAGCTAAATCCCCAGCCC
CGATCTTGTTGGCTTTCTTTTTCCTGGCGTTCAAATGCAGCTGGCCAAGTACTCTACCAC
TAAAGATGCATCCTTAGTACCCTTTGTTGCTATCCTAACGTGGAATATTGTGGCTAGAGG
CCAGTTGATAGTATTACACTAGGGATTGTTGCTAAAAGGGCTTTAAAATCATTGATAAGG
TCTTTTTTCACAA
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved