Cavia_porcellus Locus LOC100715556
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LOC100715556
Cavia_porcellus
LOC100715556
scaffold_2
SNORD45, SNORD45, SNORD45
1969..2047, 2447..2529, 3033..3104
7852
atgataataaaataatgtttatgttaggacagtaaactaaactactagaaaaaaaagtt
aaaaagagggtgactggagtgttccaaagttcttatgttgtggacaaagagagttctatt
aactttagattttctttttcagtcctagggacttttaaaatgaaggccttcacattcagc
tatatccacagttttttaaaattgattgatttattaagcccgggccttttcactgagctg
catcttcagccctgttttaaaaattttattttgagacaggatcgcgctaagttgctcaaa
ctgggttcaaagttgccattttgcttgcttcagcctcacatagttctgggattagagacg
tggagtacaccaaactaacttcagaaatttttaagtatacaaggtaaatttcaaaatagt
caccaaaataacagaattgtagtttgtaacttataaattcaaatacttttaaatagaatg
aaccccgattttaaacaggaaaaatcatcagaattataaagatgatgaaatccataatca
taatacgatcaacatagtccacgtttcattatgtaaatagtgcttctccaaatcataaaa
taacactttacaggatgccaattcttttttaataggtggtcaaaaacacaagtgtaaaag
ataagaacacgttaatgaaaatagctagcatcttggaattctgcaggaagttcccaaaat
gctttattcaaaaagtaatttccaaatattttaattactgatagcacggtctcagggaca
gaggaaacaaaagtagcgtgaaaatccccttactctaaaaatgcttattttgaacactta
gtatccagaagcaggcattctactaattaaccccccccttcccgcctccaaactacagag
tgccaaaaactattttttaaccgcatttgaaaatttacatgttacttaaaactgacttac
ataaaaaaggttgaaaatgggcgcaggcagcgaggacacctATGAGAAATCCTAAGGGTC
CTGCTTCGCCCTTCAGGCGAGAATGTAGTCAGCTATGCCTGGCGTGGAAGGGCCCTGAGG
AGGGGCGTCTGCGCAGGCGCGCGGCTCCTAACTTTACCCAGGGGCTTGCTGGGTTCTGTC
TCTTTGGCTCTGCGACATGGTGGgtataggttgtccttttggagctgtccgaaggggtac
aggagagacaaggtggtgtgctgttgagtgctttggtcgccatatacagttgtctgctga
gtattagagagtgattaaattaagacgcgggccttggaatgtttgtgagagctcggagaa
tgtattactcagcgttccctgcagagctcgccgccttagtagcggcttctaattttgtgt
aggcttcttccttttgggcgggcctgctaggatttagcggtccgatttcttaatcctaaa
aagccgaggctgattcgttacttatcccattctatacatatatagctttaaatattttac
ttacatttgatttttggctcaaggaaatccaaaagtcattagtaaaaacctctgggttga
agtctgtaaattttaaattggatcgcccggaaatttgctgcccggtcatacttgttaatc
gtgaggatctacttagtaactgcagtgtacttttagttacgaagatgtaggtgcgtgaaa
accagatcagtacctgtagcaaatacagagcctctggttagggcgaacatgggagccaag
actgcttactggtaacttgtaatttagagggagcacagaagttcccgtggaacctgattt
tttataagccgaaatttgtctgcaaattttggctagtcagaccaaaaataaaaatttccc
tttttttgtgcgttgtacgacatactaacttattggtaagctttgatactttatagtgtt
tatttaactgactgaaagaataaatatcaaatgcaggtggtaatttttgggtcagtgatg
agatggcatgtattctgaatctaaagttgattattactgctttagctctagaattactct
gagacctgaaaaatacctgaatttggttaagtattagtacatttaactgcttttttcccg
tgtgttgaatatatgctaagaagcaggatataaaatgtggctaaaacacatctttttatt
ttgaaagGGCACGCCACAGAAGGATGTTACTATCAAGTCTGATGCACCCAACACCCTTTT
ACTGGGGAAACATGCGGATTATATTGCATCCTATGGGTCAAAGAAAGATGATTATgtatg
tataattttatattaaaaagcttctcgtaaaaagaggtataagcagtagggcaatattta
tgtactgatcttcccagtaattagaggcattgccagagcagagggtagatcaggattttg
ggatacaaaattggtccctgtctttataattggggtaatactttcaaggtcaatgatgta
ttggcatgtattatctgatttactgctgatgtgtaataacactttagctctagaattacg
ctgagaccttgaaatgagtttacctgaagtttaaatacttaataactttcttttctggga
gagtcttagattattttgcttaactcatttttctctggcttttggtcgatgttaagctct
atttatagtaatgctaagtttgtaactttgaaatatgaaatatgtcttgtcaaaaattca
aagtaacccatttaagaaattactattttagGAATACTGCATGTCTGAGTACTTGAGAAT
GAGTGGCATTTATTGGGGCTTGACAGTAATGGATCTCATGGGACAACTTGATCGCATGAA
TAGAGAAGAAATTCTGACCTTTATTAAATCGTGCCAACATGAGTGTGGTGGAATAAGTGC
CAGCATTGGGCATGATCCTCATCTTTTGTACACTCTTAGTGCTGTCCAGgtaactttcaa
attctgtcttgatactgttttctgggagtcaggagttgaaattgtattaggaagaggaca
gaataaattttgttgatcaagcctgttctgcaaggtcagtgatgtcatggcatgtattag
ctgaatgtgcagttgatgtgaattctgaaattaccctgagaccttggcgaagttagttta
attacctttgatatatgagacttggaaataattggttttattttgatattaatggatgta
cacattatggtttaaaaatccaagtactgggcctgggtatgtagctcagcggcataagcg
cctgccttgcaagcagacagtcgtgagttcgattcccggtaccgataaaaaggaaaaaat
aaaaaaaatccaagtactttagaatgccaagtttatatgtagaaaaatgctttaaatgtt
tggaaatattgctaaaatgttttaattttattgaataaccatatagtctacatatttgag
aatagctgacaatattaaactgaagtgtttcctttgacaagttagcatagcaatagaatg
aacttgaaaagttatttactaaattacttgtctttcatattacagATTCTTACTCTGTAT
GATAGTATTAATGTTATTGACGTAAATAAAGTGGTGGAATATGTTCAAAGTCTACAGAAA
GAAGATGGTTCCTTTGCTGGAGATATTTGGGgtaatgtcagatttagtctttgctaccct
aaatttaatactaaaacgttctggccttggtagtgaccagttgatgagcagatttaagtt
tttcatcttttcaggtcccactaagcagctggtctaactggagttaatgccccagcatgc
tctgtggtagttatagcagcatacaggagcactggaacagaggggccaatctaaaacata
cggtaggtgaaatattttccccgcatattgggtaactttaaaattaaacatgctaaaagg
gaaaaataaaaaatttttacaaaattactatttgatggagagagtgactcagattttatt
tggtaaatgtagataatctctgctttagggctgaacacagtacaggccagagagaccagc
tgcttcatgggatgtgaaaatctacttttataaaatagggtaagtttatttatgttatta
gaaattaactaatgtttcgcttcagtttcttaactttctgatataattgtaagtttgaga
ttatttgcagttacttttgacagttttctgctagtttctttagggataaagacatctgag
attgtgcttcctaatgtgatagttgcataagttttttttaggaacttgcagtatgaatga
tcagaagactagtaacatgtatgttgacactttcattttagGAGAAATTGATACAAGATT
CTCTTTTTGTGCGGTGGCTACCTTGGCTCTTTTGgtaagctttgataaattctacattga
aatgatttcatcatccatgaatactctggaatttagtggggttttttttcccctcccttt
tgtttatagGGCAAGCTTGATGCTATCAATGTGGAAAAGGCAATTGAATTTGTCTTATCC
TGTATGAACTTTGATGGTGGATTTGGTTGCAGACCAGGTTCTGAATCTCATGCTGGACAG
gtaatttatagagattattaatgtaaaatagactgtgtttgtagtaaattttactgtgtg
tgggatagtaccgaaaaattgtgtaattgttacttaaggaaatgtttttataatatacat
taccctgttaagtacttctgacacaagcaaagaaaactaggataatagttaaccgaaata
actttgggggaggcagctaaacccccacccacccccacatcatgctagacagcagtcttg
acaccactgagccacatcctagctctctagtgatgttcatttaggtgaattcagttctag
ccttgtctgctctatgagtaagcagatcttaatgtcagagaacataggtaaacagttttg
aataagctgtgaagagattctgaccatgtttaaatacaaaatagctttagtaattgaata
gttgttaccacctttactttcaagaaactatacacatgtactttatgtctgtaattttag
ATCTATTGTTGCACAGGATTCCTGGCTATTACTAGTCAGTTACATCAAGTGAATTCTGAT
TTACTTGGTTGGTGGCTTTGTGAACGACAGTTACCCTCAGGTGGACTCAATGGAAGACCA
GAGAAGgtattgtttcttagctgtgctctgtagcacttagctttctaacctttggtaatt
actactttatcttcacattttatgactgttcttgtatattgagtttttctcccttcctca
atgaagcattccacaatgtcaactcttggaaaaagtagaaccttcctggttgaaatgatt
gtggattctggtatcccatttccataagttcactactgggtgctctaccgcatagctgca
ccctctttctcagccttgtgttttgtttgagccagggtcttggaaagttttccaggtttg
ccttgtgttttttggacttggaaatgagaagctctttgcaaaccttttagtcacacatta
aaggtttgaaaactgagactagtggctttacttttacacgtgctgtatatgtctattata
gctctgaaaacaattgattttaccaaataatggactttttaaaaagctaggcagtttttt
taaaaacccaacagttaattgagggttactaatttttcttcatggcctctgtcccatgaa
ttgggacatgttatctgagctcgtgtgtctaattgtaaactttgctttctcaatatgtat
tttgagtaccttaatgagtaggaaaatggtgtctagataggatctgatgttttttaaatc
ctgcagaactgtcaaaattgctttaatgtgcttgtgaatttttcagggctcattaacatg
gagagcactagggtatcatgtacacatgatcgcattgtgaggacccaggttcttggcaaa
tttcaagtaggtgctacatgcacgagagtaacaagtccttgttgctacccttaggaaaca
acatatgcccatggatttcatgaactgctattagcctgagttgtaaagggctgagtcagg
cattagcgggggtgctactcactgagtacctgaaacagcaggggcacctatgaccttgac
atgggcattttttttgccaatcatctatctgggcaaacgttagacacttcatgttcgtcc
tcttccccctgtttggatatgagattagatagaatttaaaattatttttcagcataagaa
aacaaaggaataacattgtggcaacattggtgacctttctcccccccccccctttcagTT
GCCTGATGTGTGCTATTCATGGTGGGTTTTGGCATCCTTAAAGATAATTGGAAGGCTTCA
TTGGATTGATAGAGAGAAACTGCGTAGTTTTATCTTAGCATGTCAAGATGAAGAAACTGG
AGGTTTTGCAGACAGGCCAGGAGACATGgtaagtgtatttctgataagtttgattaagtt
gatttttttcagtgatgggttactttcatggttctagtgatttgcagaagtggatgtggt
gtagtttggtgggccatgcaagtgttgctttgaaaaggagtatttaccattacttccata
gtaaaatatgaagaaatttatcacctattgccagaaatacttagaaatggttttttttta
atagttgtcttcatttcttagtagtgtaaatccttttgtttttcttaaatagGTGGACCC
ATTTCATACATTATTTGGCATCGCAGGATTGTCGCTTCTGGGAGAAGAACAAATTAAACC
TGTTAGTCCTGTTTTTTGCATGCCTGAAGAAGTGCTTCAGAGAGTAAATGTTCACCCTGA
ACTAGTGAGCTAGatttgttgatagatggagaaaagtatgtgtagtagtttttgccatct
taacgtttctgtttttaaagtgcttactgaacctaaaaatgtctactgttgttaatattt
tgtatattgtgttaaattaatttgaataaattatatagttatacatattgtaaaataaat
tattgtattttcagcttttgtgaagtgctgttttgagtattttcttgtacatgtgtttta
tgtctgcttagcaaacttagggacttgggttctttctgcttttctttcccatgtatttct
tcagtgttctatgaaagtaaatgtattaagttggtttttgtcaaaagtgtcactggtaaa
agtggataaatcccatatatgaattaaaacatgggcagatatgggaataatttataggtt
tgcctataattactctgggttagtgacagttaaggtaaatggcagtgtaccatcttgaat
agctttacagttttcgacctcagagcattttattgagtgtcacagaagaggtggtcctcc
cagtaatgaaacagttttccattgccacaacagggactatcaaaaagaaatctatgattt
tgtagtctgtaccttattggaagtttactagaaattgaatccagggaactgccttctctg
cttcatgcctccacccagagtctgatcctaccatgccggacagccacagagatgctattt
tgtgataactgtttgctcacaagacatagataggcacgcaaaccttactatacttagaaa
tgtgagtgggtaaaaagctggttggagattttttttaatgtagtggtaagctgcattgag
ttgggctttccatgtgtctgggggtagccagtagcagatccctggggagagagggccgga
tgtgggccgtacttccgcccgtctgcgcctgcgcgcttgcgcgccgtcttcccgcccttt
ctgtgggccggtacccgctcgcctcgcggctcgctgagggccctcggcctggg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1162, 2167..2274, 2731..2928, 3525..3630, 4301..4353, 4449..4559, 5040..5165, 6298..6447, 6712..6852
1001..1162, 2167..2274, 2731..2928, 3525..3630, 4301..4353, 4449..4559, 5040..5165, 6298..6447, 6712..6852
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved