Cavia_porcellus Locus LOC100720389
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LOC100720389
Cavia_porcellus
LOC100720389
GeneScaffold_4685
SNORA11, SNORA11
6057..6184, 8341..8469
9104
CAGCCGAAGGCCACCTGCAATAACACTTCCTTCAAACAGAGGCACTGTTGACTGTTTAA
TTGGAGTGACCTTGATGTCAGGAGGAACTGACATCAAAGGACAGCTCACCTGTTAAGTTT
ATGGACTGTGAAACTTCTTAGAGAGGTTTCAGACAGGATGACCAATAGGACTGAGGACAT
TTTACCCCAGAAGTTGCTTGTTTGGGAGATGTTGGGTAGGTGAGGCCTGTCACTCACAAG
GAGATGGAGAGAGGATGCCTGCACTAGAAGAACATGGGCTTTGCAGTCAGAGAGCTGACT
CAGATCTAAATTTCGCATTTTCTGTTTGCTAGCCCGGCGGCATTTTCTGGTTCATAGGCT
GGCTGTGTGTGTGCCTCAGTTTCCTGGTTTGTAAAATCAGGACGCTGACATCTACCTCCC
AGAGGTTCTGTGAAAGGGCAAACAAGCCCAGGTCAGTGACCTTGCCCCATTGAGACCCAC
AAAGCTGCATAAGAGGCAGCATGGGAAGCAGATGCTCCCAGCCTGTCTCCGAGACCTGCA
GATGGGTAGTGGAGGCCGACACAAGGGCAGCATCTGCCCACTGTCCATTTCCGTTTTCTG
GCCCCTCAGGATGGAGGTTTCCACTTGTTGCCCGTCACGGACTCAGCTGGAGACCTCTTT
CATGAGGCCTAAGGGGTCATGCTGGGCAAGTGGGACATAAAAAGTATCCAGAAGCAGGCT
GGAAGAGCTCAGGTGAAAGGGCAGAGCTGAGGAGCATTGTGCAAGAGACTGGGCTACTGA
GAGCAGATGATCGAGTGGGCTTGCTGCACTGCAGGGTATGAGTGTGCTAGCTGGCTCTTT
GAAAAGCAGGGCTGAAGGAAATATGGCGGGAAGAGCAGCACTCCCCCCTCCAGCCCCTAT
GGTCGCCACAGCCCACCCACCCGCGAATCGCATGCGCACTGGGGACTAGGAGGAAAGGGC
TTTTGTTGAGAAAGCGGGCCCTCTGGAGGGGTCCACGCATGCGCGGGCTCCCCAGCCGCG
GGGGAAGCGGGCTGGCGGAGAAAAGGGGCGGGGTGGTCCGAGCTGCTGTGCTGGCAGCAA
GCAGTAGGCGAGGGCGCGGCTGCTGGGTTCCTGGTGCTGAGCACGGACGCCATTGGAGCA
CCGGGGAAGGTAAGGATCCAGCCCAGACAGGACCTGGCGAGGACTAGTGCAAGCCGACGC
GCTGCGCCCTCTCCCTGCCCTCTAGATCTGAACAAAGCCCTAACACTCAGAGCGGGAACC
TGATTAGACCCAACGTCTAAATAGGACCCTCACTACCATGACCATCAGACCCAAGCGCCC
CGATCCGAGCCTACTTGTGTGGGAGCCTGCAATCCCAACCCTTGTGACAGACCCCGAGCT
GAGCTTCCTTAGACGCGAGGCCCCACCCCCACCGCCTCCACTCCTAGATTACTCCAACTG
AGCTGAACACTTGCGCCTTCCTGGAGTCCCAGGCCTTGGACCTTGAGCGGTCCCGCGATC
CAGTTCAAGCCCTGCCTAGGTCCAAGGCTCCCATCCTCTGAGCTCAACCTATACCCACAG
TCAGGTGAACGCTCCCTCCCCTGACCCAGCCCCCGCCCCCCTTCCTGCACCTCCTTTTCC
TAGAGCTTTCTGCTGTCCCTGTTGTCTGAGCCCTCCTATTTGCTGCCCTCTTCACCAGTC
CCTGCCACCCATCCACCCCGTGATCATGGTCCCCTGCTCTGGCCCTTGAGTTCAAGCCCT
TTGTTTCTCCAGGTTTCAGTGCATCTCCACTGGGACTCTTGGGACCTGAACCCTCAGATA
CAGCCTTTATTCAAACCTAGTCACCAGAGTGGGGGAACCTGCCCATCCTAAGCTCCCCTT
ACAGTGGCGGGGGTTCGGGGGGTCGCTCTGAGATTTCCTCCATCCTTCTGGAGGCCACTG
GTCTGCCCCTATACACCCTGCAACCCTCACTGCTGTTGTGTAGTACTGCCTATAACCTGA
CAATGCTGCCCCTCATGTCTCCACAGATACAGCCTGCTACTGGTTCCTGCCCCCCTCTCC
CTGAGACAGAGCTCTCAGCTCCTTGGGAGCCGCAGCATGGCTGAGGGAACCTACAGTGTG
CAATCTGGAAACTCCAATGTCGAAGATATGGATGAGGGGAGCCACCAAGTTAGGGAGGAA
GAGATGGTTGGAGGCAACGACTATGAAGAGTTTGGTGCTTTTGGTGGTTATGGCACACTC
ACCAGCTTTGACATCCATCTGCTGAGAGCCTTTGGCACCTTGGGTTCCGGCTTTCACATC
TTAGCGGTGAGGCTCCTTCTTGGCCACCTGCTCCATCTGGGCCTTATCCTCTGTGTCTGT
GCAGGGAGGGAGGAGGGACCTGAGTGGGGAAGGCATGCCGGCTTTCCCGAACCTTCCCTG
GCTTTCTGAAGGAGGGATTTCTGGAAGTCCTTGGGGTGGCCAGTGCTGCCTGGTGGGAGG
AAACAGGCGAAGCACCATGACAGTGTGTAGAGTTGTCTGTCCTCCTCTCCCCTGCCCTCT
GGCCTGACAGAATGAGCCCTGGGAACTGGAAAATCCTGTGCTGGCTCAGACCCTGGTGGA
GGCATTGCAGCTGGATCCAGAAACCCTTGCCAATGAGACTGAGGCCCGTGCCGCCAATGT
GGCCCGCTCTGCCGCCTCCAACCGAGCTGCTCGGGCCGCTGCCACTGCTGCCCGTAGGTC
CTTCACTCAGGTGGTGGCTAACCACCTGGTGCCCACACAACTGGCCACAGGAGACAGTGC
CCAGCCTATGACATATTCTGAGGCTCAGGGGCCCACCCCTGAGGCAATCCTGGCCTCACC
ACCGAAGTCCCAGATGTCTCAGATGTCAGTCATCAGTGAGATGGCTGCTCCTGGGGCTCC
AACAATCTCCACACAGTCCCAGACGGCCTCCCTGGACCATCAGGCTGCTGCCGAGGGCCC
TGGTACTGCCCGTGCTGAGATTCCTAGTACTGCCTGTGTATTCTCTCAGGCTCCAAGTGC
CAGTGAGACGGATGCCACCTGGCCCCAGGCAGCCTTCCTGGGCCAGAAGGATGTCTTTGA
TTTCACTCAGCCAGCGGGTGTCAGTGGCATGGCCTTCACGCGCCCCAAGAGACCTGCCCC
ATCCCAAGAGGCCGCCACAGAGGACCCTAGCACTGCCTCTGGTGTGCCTCAGGCGGCATC
TGCCAAGGAAGTGGCAGCCACACGACCCAAGACCACCAAGTCTGGGAAGGCTGTGGCCAA
GACTCGGTGGGTGGAGCCTCAGAATGTTGCAGCCACAGCTGCTACCAACACCAAGATGGC
CACAAGCACCCCTGAGCCCGAGGGGGCAGCTGCAACTGCTCAGCAGAGTGGTGAGCCCTG
GGCCAGGATGGGAGGCAAAAGGACAAAGAAGGTGAGCACCCCGCCACCTAAACAGCCCCT
GGCTCCCCTCCTTTCCTGCTGCTCTCCCTGCTCCTTTCTCCTCTGCCCGCCTCTCCTCCC
CAGCCTGTCCCTCCTGTCCTGTCAGCTTGTCCATGTTTCTCCAGCACATGTTTGTTGAGC
ATGTTTTGACTCCACGTAGTTCCTGCTCTCAGCGCTGGTGGGAGAAGAGGTTGGCTCGGA
GCCTGGCACTTAGCAAGCTCTCGGCAAGTGCCAGCCACTGCTCATACTACTTTCGCTGCC
AAGTGCCTGCTGTGGGGCAAGGTGTGTGGTGCGTGCTTCTGCACGGGGAGTCCGGAAGCC
CTGGGTTGCTCCTCTCTCTGATGATGTATTACAGTCCAAACACCTGGATGACGAATGTGA
GAGCAGCGAGGAGGAGAGAGAGCCTCCTCCAGTCCCGGCAACCTGGAGAGCATCGCAGAC
CCCAGTGACAGCGCGGGCTCAGGTGGGCCCTCGGCCCATCATGGCCCCAAGGCCCCAGAC
ACCCTCGAGGCACATACTGTGCTTGCCCCCCCGCAACGTGACCCTGCTGCAAGAGAGGGT
AAGTAGTCTGCTTTCCCCATCTGCCTCCTTTCTTCCCCCCGTGGTCCAGCGCTCACTCTG
AGGTCTCCCGGGCCTTGATCTGCCCACACATTCCTCCTTCTCCAGGCAAATAAGTTGGTG
AAATACCTCATGATCAAGGACTACAAGAAGATCCCCATCAAGCGCTCGGGTAAGCACCCA
TGATCCCCTGCTAGCCTGTTCTGCTAGCCTCACTTTGCGTATGTGCCCACACCCTCCAGG
CAGGGTCCCGTTGCTCCATTTCTGCAGCACAGAGTGCTGGCCAGGTGCCTGCAGCACAAC
TGGCCTTGGGGCTGCAGCCCTCAAGCCCCTGCTCAGCCCGGGTCCCATCCCTGACCCTCC
CCCTCCCACAGACATGGTGAAAGACGTCATCCGAGAATACGATGAACATTTCCCTGAGAT
CATTGAACGAGCCACATACACTCTGGAAAAAGTGAGTGGGGGGATGGGAGGAGTAGGGCA
GCCTGCAGCCCTTCCAGGCTCAGTTCCTGCCCTGTGTGCTCTGGAAGCCTCCCGTGGTCC
TCCACCTCTGAGCTTCCAGTTACCCGTGGCACTGTGACACATGCCCTTTTCCTGGTACCT
CTCCGTGCTGCTCTCTGAGTGGGTCCCCTGCCGTGGGTCCCACTGCCTCTGCAGCCACCA
GAGCCCCCACGGGGCAGCCTTTGCTGCCCTGTCTTCTCCTGCTCTTGTCCAGTGGTTTGG
ACTCCCAGATGAGGGAAGCATTCAGAGCAGAGCCTGACCGAAGGCATGATGCCTCCGGCA
CGGGGTTTGATCTCACTTCTCTTGCCTTGTAGAAGTTTGGGATCCACCTAAAGGAAATCG
ACAAGGAGGAACACTTATACATTCTCGTCTGCACGCAGGATTCTTCTGCTCGCCTCCTCG
GGAAGTAAGGAAGGGAAAGAGGGCAGTGACCTCCTGGGTGATGCCCCATCCCCGCCCCCC
AGCATCTTGCGGGGGGCGGGGAGTAGGACCACTGCGCTCAGGGGTCCACCAGGGCTCTTC
CTCTCTGATCACTGCACCTAGTGACTGCTGGAGAAAAGAACTGGCATCCGGGGCAAAGCT
GTGGTGCTGTGGGATTTTGCTGGCCTCCCTGAAGATTCAGTGGAATGCAGCTTGTCTCTG
GCTACCACGTGCCTGGCTTGGGCTTGGCAAGGTAGACCTCTGGGGAGACTTTCCTGCAGT
GTAGGGGAGGTGGCCTCTGACAGCATCCCTCTTTGTCCACCCTTAGGACCAAGGACACTC
CCCGGCTGAGTCTGCTCTTGGTGATTCTGGGTGTCATTTTCATGAATGGCAACCGTGCCA
GTGAGGGTGAGTATGGGCTCTGCAGCTGGGGATTGGCCCACGGTCCCATCTTTTCGTGCC
AAACTCTTGTACCCCGTCTCCCCTCGCAGCTGTCCTCTGGGAGGCACTCCGCAAGATGGG
ACTTCGTCCTGGGTATGCACGGCTCCTCCCGGGATTGCGGTGGTCTGGGGTCTGGTGCCC
TAGGCTCCATAGAGAGGAGAGGGTCTCACCGGGATGGGTAGGGGTATCCATGGCTAACTC
TCAGCCCCTCTCGCCTCACTATTCCCAGAGGAGATCTCAGAGAGGCAAAGCAGAATGTGG
TCCTCCATCAAGCCCTTCCCTCGGGTATCCTTGAACAACTGTCTTTTGGCCTCTGCTCCC
TGGGGATGCCCCATGGACTGGAGAGCTCGAAATGGAGCTGGGGAGCATTCCTGCCCGCAT
ACACCACTACCCTGTTCGGTAATCCTGGATTCCTTTGTTTGCCCTCAGGGTAAGGCACCC
TTTCCTTGGTGACCTGAGGAAGCTCATCACAGATGACTTTGTGAAGCAAAAGTAAGTAGT
AGTGACTGAGCTCACCTTGTCTCACTCTCGGTATTCCCGGGTGCCAGTCTAGTAAAGAAA
ACCATTCCCAGCCTCAAATTTTAAACTAGAGGCATGAGTGGGGTCAGGATGTGGGAGTGC
TGAGGGAGTAGAATTCTGGGGTTGTCTTGGGGAAAGGGAGCAACCCCCAAACCACCAAGA
ACGTGGTATAGGGGAGTGGCGGTGAACCTATGGCACTGGTGCCGCAGCCAGCTGTTAGTT
AACATTGAAAACTCTGAAAGGTTCATCATCACCGGTGTAGCCTATGATAGGAGCACCATC
TACCCTGCGGCCCAGCACCATAGTTTCCCTTGTTTTGCACCCAAGCGGCCTAGGGCTCAG
TGAGGTGGCGGTTTCCGAACCTAGTCCACAGCTGGCGGGCTGGCAGGGCCAGGAGCCCAG
TTCTCTTGGTTTTCATCCCAAGGCCCAGTGTATATATACACTGTCACCCCCAGCAGCGGG
GTGGGGGGTGGGGGGTGGGAGAGGGGAAGAGTGAGAGACAGAGATGGAGAAGGAGATAGA
GGCAGAAACTGAGACGTTTTAGAGTGTGTGTGTGTGGCTACCCTTGACTGAATGTTTCTT
GTTTTCTGTAGTGGATCTTGCCCAGGCTTAGCTAGCCCTCCTTGGGGACCTTTGCCGTGG
GGTGTGCTCAGAGCAGGGGCCCTGAAGAATGGCTCCTCTGTTTACAACACACCCAACAGG
AATCCAGGGCCATTGTGAAGAGGGCCACAACACTTGTGGCCTCCCTATGAGCAAATGCCC
TACATGTGTCGCCTTTGCACCTAGACAGGGATTCTGAGGTCCTGGGAGTGAGGTTGTGCG
TGAGCCCAGGGCTGGGGACCCAGATGGTCCTCTTCCAGGAGGTGGGCTCCAGCACTCTGC
CTGAGGAGGAGCTGCCTCGAACACATCAGTTCAACCACAGGTCAGCTTGGCTAGCAGCAA
AGGGTGATTCCCTGTCACACTCAGGTACCTGGAATACAAGAAGGTCCCCAACAGCAGCCC
GCCAGAGTATGAGTTCCTCTGGGGCCTGCGAGCCTGTCACGAGACCAGCAAGATGAGAGT
CCTGAGATTCATTGCCCAGGTACCGGAGAGGGCCTGTCAGGTGCCAGCAGCAGGGTGGCA
CTTGCCCTGATTTGTGTGTTTCTTGGTCACCAACTTTCCTCTCTGGAGGTTCTGAAAGGT
TCTTGAGTTTCTTGGGCAGATTCCCAGAGGTCGCAGCGGGGGGAATGGGGCGTATTCCCA
GCTCTAGCCCAGAACAATAGGAACCTGGGCTTTTCAGGCCAGGGCCCCACCTGTCCTTTG
TCCATGGAGAACGTGGGAGCAGGCACACTGTTGGGCATAAGAGTGAGCATGGGAAGGGAT
GGCTAGCAGGAGGTGTTCCTTGAATGTGAAGTAACCCTGTCATTATGGCTGGCTGCTGTT
CACCACCCTCAGAACCAGAACCGAGACCCCCGGGAATGGAAGGCTCATTTTCTGGAGGCT
GTGGATGATGCTTTCAAGACGATGGACATGGATATGGCCGAGGAACATGCCAGGGCCCAA
ATGAGGGCCCGGATGAACATCGGAGACGAAGCTCTGATTGGACGGTGGAGCTGGGATGAC
ATACAGGCCGAACTGCTGACCTGGGATGAAGACGGGGATTTTGGCGATGCCTGGGCCAGG
ATCCCCTTTGCTTTCTGGGCCAGGTACCATCAGTACATCCTGAATAGCAGCCGTGCCAAC
AGGAGAGCCACATGGAGAGCTGGCGTCAGCAGTGGTACCAATGGTGGGGCCAGCACCAGC
ATCCTAGATGGCCCCAGCACCAGTTCCACCATCCGTACCAGAAATGCCGCTAGAGCTGGT
GCCAGCTTCTTCTCCTGGATCCAGTAAGATTGTCATGGGGACCTGAGACCCTCTGGGAGG
GTGATAGATGAGCTGGGTGATGTCAGGGGGAGGCCTGTGGAGGGCTGTGGTAGGGCAAGA
GTGAACCCGTGGAAACACACTTGTGTCACTGTTTGTCCCCCTCACTGGCTACTGTGGACT
CTGATGTGTACCTGTTCCCTTTCGTTCCCTGTGATGCAGACAGCGCTGAGGAGCTGCTGT
GGTTGTCCTCACCCAGCCAGACAGCCTCCTCAGAGGCCCTCTCACACAGCACTCCGGGCG
CTTCTCCCTGTGGGTCACAGGGGCTGTGAAGATGGAGCTTCCTTTACTCTTCCTGCTTTC
GCTGTGTGCTTTTCCTTGTGTGTTCATGGTTTTGGTATCAGTGTTACATTAAAGTTGCAA
ATCAATGTGGATGTCTCCTCCTTTTTGTACAAAGCGGGTCCTAGACATGGCCTGTGGCTG
GGCTCTTTAGGATGCCAGCAATCAGCGGGCGGCACCTCTGCGGAAAAAGGCCCATGGGTC
TGGGTGGGATGCTCGGAGTGTACATACTCCAGGTGGTGGAGAGGCCGTGAATGTAGGGGA
TTTCCCAGTGCATGTGGTTATGTGGATGTCCCACAGGGCAGCTCAGCAGCACCAGCTAGA
TGCCAAGAGGGGACGGGAGAAGGAATGGCACGGAGGACTGGAGGTTTATGCCATTCATTG
TCTCCCTCCCTCTTGAGCAATAGGATCCACAGGCACCCACTGGCAGGGCTCACTCAACAC
CTCAACCCCCATCTTCATGGAGATGAGGTTCCAAAACCCTTGGTGCATCACCCACACCCC
AAGACTGGGGCCGAGTCTTGAGGAAAATGAGGCAGGCTTTACAACGAAGGCCTTACCCTT
GTGCTGCGCAGCAGGAGCAAGCGCTGCTGAGAGAAGAGCAGGTTTCCAGCACAAAGCTTT
ACACACACCTAGACAGCCCATTGCCAGCGAGGGAGTGGAAGGCTGTTTGGGGCTTTGAGG
CTCCGTTTCCCTGGAACCAGGGCCATGCCGGGGATGCCGTGGCCAAGCCACAGCTTGGTG
TCTTCCAGGGTTGGCTGATACCCAGAGAACATGGGGCACAGGAGGCTGCGGATCCTCCAG
GTGAAAGGTGGTGAGGATGGACAGGTGGTTCTCCAGTGAAGGGCTCAGTAGCGGGCATGA
AAGGCGTCCGGTAATGCCTCAGGTTCTCCAGTAATGTCCACAACTTGGCAAGAGAGACGA
CTGGATGACCGGGCGGGAGACAGTGGTGTCAGCGACCCGTGTCCCATGCCCCGTCCCTTC
TGTGGCTCCTAAAAGAGTCTCCCATATCGGCTAGTCCCAATCCTGACACAGACTCTCCAC
AGAAATTGTGAGGCCTGGCTACCAATGAAAGCTCAGGTTTGATTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1206, 1403..1833, 2187..2301, 3295..3357, 3694..3736, 3820..3899, 4242..4333, 4695..4774, 4977..5040, 5148..5351, 5715..6575, 6820..7099, 7957..8103
1197..1206, 1403..1833, 2187..2301, 3295..3357, 3694..3736, 3820..3899, 4242..4333, 4695..4774, 4977..5040, 5148..5351, 5715..6575, 6820..7029
NT_176280
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved