Cavia_porcellus Locus RPL5
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPL5
Cavia_porcellus
RPL5
GeneScaffold_2590
SNORD21, SNORA66
28338..28432, 31221..31353
32718
GGGCATCTTGGTTGTTTCCAAGATTTAGCTATTACAAATTGTGCTGCTATGAACATGGG
TGCACATATATCACTGTGATATGACCTTTTCAATTTTTCTGGGAAAATATCCAGGAGGGA
TTTGGACTGAATGGAACTTCCAATCCTAGTCTTTTAAGAATTCTCCACACTGATTTCCAT
AGTGGTTGCACCAGTCTATCCTCCCACCAGCAGTGGAGCAGTGTTTCTTTTTTCCCACAA
CCTCACCAACATTTGTTATCAGTTGATTTCTTGATGGCAATTATTCTTTCTGGAGTGAGA
TGAAATCCCAATGCTGTTTTCATTAGCATTTCTTGAGTGATCAGTTATGGTGAACATTTT
TCATGTATTTATTTGACCTTTATCTTCATCTGAGAACTGTGTGTTCATCTCAGATAAGGC
ATGGTCTTTTAAAAATATGCTTTTCATTAGTCACTATCATTTTGCAAAACATCTGAGATT
GAAAGGAGTGGTTTCATACATGCACATACAACTCATATTTTGCTCAGATTCAGCTCCTTA
CTGTCCTGATTTTAATTAAAGAGCTTTTACATATTTCATTCCTGCCCAAACTGGCTGTTA
TCATTTTGATGACTTGACTTTGAGCTATGACATTCCCCCAGAGGATATGTCTGTGGAAAT
TGTGTTTTAGATAGTTATTTTTCTGGCATCTCTAAAGNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNAGCCGCCTTTACTGTGCTGTGTAAAACTTGGTGACAGGTGAAA
AGTACAACAGTGTATTGATTCCAGTAAGAAACAGGGGCTGCAAAAGTTGACAATTGTTTG
TATTTGCTCTTGAAAAATTACTTTGTTAATGTGGTTAGCTCATGTCAGAAGTATAGGTTA
AAATTATCAAGATTTTAATAATACTCTTTTTTTTTTTAAAGGGTTTTGTTAAAGTTGTCA
AGAATAAGGCCTACTTTAAGAGATACCAAGTGAAGTTTAGAAGAAGACGAGGTATGGAGA
GATTTTTCTTTTTTCTTTTTTTTGTCTTTGAGACAGGGCGTCACTGTGCAGTTCAGGTTG
GACTTGATCTCATATTGTAGCCCAGGCTGATCTTGAACTTGCAGTGATCCTCTTTCCTCA
GCCTCCCAAGTGCTGGTATTACAGGTGTAGACCACCACATCCTGCTCAAGTATTCGTTTT
CTAAGCGTTAAAACAATGCTGTTTATAATACAGCAACCCTTACTTTTTTTCTTTCTCTTT
CAGAGGGCAAAACTGACTACTATGCTCGCGTTTTCTAAGCGTTAAAACAATGCTGTTTAT
AATACAGCAACCCTTACTTTTTTTCTTTCTCTTTCAGAGGGCAAAACTGACTACTATGCT
CGGAAACGCTTGGTGATCCAAGACAAAAATAAGTACAACACACCTAAATACAGGATGATA
GTTCGTGTAACTAACAGAGATATCATTTGTCAGGTAAGTTGTGTTCTACTCAGGCAGTGG
GTAGTAATAAAAATCTAGTCCCCTTCACTCACTGTGCTAGAGAAGGTGTATTTGGGAAGC
AAAGAACCTGATAAAATAGGTTAGGTGGGTTGTTGAGTGGTTCGTTTGCTTTTAGTAGGT
CTAGACTTGAAGATTAGGTAACCAGTATTTTAAAACTGGAAGATCAGCTATATTTGGACA
ACTAGACCCATTTTTATCTTGCTTCTACTTTTTTTTTTTTTTTTCTCTGTCTTTTTGAGA
TAGGGTCTCATTATGCAGTTCAGGCTGGCTTTAAGCTCACTTTGTAACCCAGGCTAGTCT
CAAACTCCCAATGATCTTTCTGTCTCAGCCTTCTGAGTGCTGAGATTACAGGCATGAGCC
ACCATACCTGGCATCACTTCCACTTTCTAATTTTAAGGATTTAAAGAGGCTTTTATGTAC
GTGAGTATGGTGGGGAAATAAACAAAGCAAGCAGAAGGTTCTTTCATCCCATTTTTCAGT
ACAAATTTGTCCTTGGCTAACTCCTGACTTTTGCCGTTTGACTTTACATGCCATTTAAGT
TATTAAAGAGGTTTATAGCTGCTTATTGTTTGACACAGACTTTAATACAAAAAGTGCTAT
TTGAGCATTTAAAAAGTACCAGTTCATCAGGTTCTAGAACTAGGGGACATTTTTTTTTTT
TCCTTTTTTTTCTTTTTATCGGTACCGGGGATCGAACTCACGACTGCCTGCTTGCAAGGC
AGGTGCTTATGCCACTGAGCTAAATCCCCAGCCCCTTAGGGGACATTTTGATAGTTGAGA
TTTGCCAGTCTTTTGTAAGAGGCAGGCAAATCTGGGTTTTTGTTTTGTTTTGTGTTGTTT
GGAGACAAATTTTATGTAATTTCGGCTGGCCTTGAACATATTATGTAGCCCAGGCTGGCC
TTAAACTCACAGCACTCCGCCTGTGTCAGCCTCCTGAGTGCTGGGATTACCGGCGTGTGA
CACCACGCTGGGCTGGCAAATCCATTTTCTGCACGTTGTTCACTTCGAAGTCAGTGTCTT
CATATCTACATTCAGGTACTAAACATGAGGTCTCTGAAACTGTTGAATTTAGCCTAAGTT
CAAAAGTGTTTAAAATAAATGGGATTCCCTTTGAACTTTTTAAAAGTGTCTCACTAGTTT
ACTAGTTAATGCATCTGAGAACTGTTTCTGCCTCTAGAGTAAGGAACTAGAGTATAATTT
TTCAAAGCATCTGTCTATTTGGAAATTTTGACATTGGTCATGTTTGAAAATACGTCCACC
TTATATACAGCTCCTTAACTGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAGATTAGTAAGACCCA
GAGAAACCACCAACATGAGTGGACTTTTCTTGAATACTGTGAGGAAAGTATTTTTGTACA
GGAAAATCTCTTTGCAAGCCTCTTTGCCCTCGCTTCGCCCGTGAAAGCTTGTGTGGCATC
TGGCCCGTTAGTAATCCAGAGTGGCTGCACATGAGCCCCAGATAGCAAGCAATGGAAGCA
CCAAAAAAGATGATAAAATATCTATGCTTGAGATCAGATGGCAGCTGCCAACAAATTCTT
CTGCATGCACATTAACGCTATGGAGAGAAACACTGCCATCCTATCTCTTGTCATTGGCTT
TTAAATCACAAAGCTCTTTCCACAAACAGAGATGCTAACCTCCTGTGAAAATGAAGACTT
ACCTGTTTTCCACTTTATCAGTATGACCTTTAAGTGATGTAATTCTCTTCCTGTGTGTCA
TGTCTGCCTCTATAAACCAATTTCAAATTTAAAAAAGCTGTTTCTCAGACACGTACATGT
GCATGCACACACACAATTGAGGTTGTGACTGTGGCAGGAACTTAGAATGGTTCAGAGGTT
ACATCATTAAATGGAGTCAATTCTGTCTTAATAATTACTGCATTTCAGCTTTGGTATTTG
CTTAGATGACTTAAAGGCTTGGGGTTATTGATACCAGTGTCTCTGAAAGGAACATTCAAA
TAAACTTCTAAGCCCTTCTAGCTATTGATCTCCATGCATTCATTAGATTCTGTAAGAACA
CAGAGCCTGTTTGCTACAGTAGTTAGTATCTACCTTGTCATGTGACAGCTGCAATTATCT
TTTTGGGCGATGAATGTGATCTTTGCAGTGATTACCTTTTAAAATTTTTCTTAGCCAATT
AAATAAAATTCGGTGACATTTCAAGACTGTAATCACAACCAAATGCTCTAAATGTCAGGA
TGCATTGAAATTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNGTGGTTTTCCATCTGCTAAAACAGTAGTATTATTGCCTTATATAC
TGCTAACCCAAGAGCACATACGAGGTCTGAATTGTAAGAGTGGCTGCCAGTGCTAGATTG
AAGTGAGGCATGTGCCTGGGACACAGAATTTAAGGAATACTTACTCTCAGGCTCATAGGT
AAGAATGGAGAGAGAAAGATGTAAGAGGAGATTAACACTTGTGAAGTATTAATGATAATG
CATCACTATCTTAGTTTATTTTTCATTACTCTGAACAAGATGGCTCAGATAGGATCACTA
TATAAAGAATTTATATTTAGCTCACAGTTTCGAAGGCTAAAAGTCCAACATCAAGTAGCC
CCATTAGCTTGGCCTCTCCCAAGCTTGATGATGACATCACGGCAGGAGTACATGCAAGAG
TGCGAGAGCACTTATCCTGAAACAGCCAGAGAGGCCACAGATCATGTCCCTTCTTATAAC
TTGTTCTCTCCAGAACTGGTTTAGTCTCTTCTGAGAGTGGCACCCTGAGTGACTTAAGAA
CCTGCCACCTGGCTTCACCGCCCAAGCCTCCAACCCAGGAAACCTTGGGGATATACTCAA
ATGATATCCAAAGCACAACAATCCCCACCTGCTTAAGGATCTTTGTGTCTTTACTAAAAG
GTGTAGAAGGAACTGAGTAGATGCTAGAGCTCTTTTACCGGTATTCAGATACCAGCTGTG
TCATCTAGTATCTGTGGGCAGATTAGCTAGGCTCTCTCTTCCTCAGCCTCCCCACCTAGA
AGATGGGGAAGAGGATTGCCTATAGTAAAGGTTGAGTGAGTTCCTGATTGTAGCTCCAAA
TACCATGAACGTTTAACCTGAGTGGTAATGACTGTATAAGGATTTTTTCTATCACGTGCA
CAGAGAAGTTAATGTTCAGAAAGGAGAATCAATGCCAGATACTTAGCTATTGCACTAGGA
TAGGACAGATTCAGTGCTGCCCACAATATCATGATAACCCATGCATGTTTTGACTTGGCT
TTTCTCTGTCTTCATGATTGCAAGGTGATTCCACTTATCCATCCATCCACCCATCCATTC
ATCCATCCAGTTATTTATAGACAAATTCTACAGCAGACTTCTAAATACATGGATAATGGG
CATTGACAACCTAAATGCCTTAGCTGGGCATCGTGTCACACACACGTAATCCTAGTACTT
CAGGGGCCAAGACAGGAGAGTGCTATAAGTTCAAGGCCAGCCTGGACTACATAGTGAGTT
CAAAGCCAGATGACCTACATAGTAAGAGCCTATCTCGAAAAACAAAAACAACACGACAGA
ATATAACAGAACAAAAACTTCAATGCTATGTCCTCTGCCTTACCATTGGCCACCCAGCAA
GTCTAACCTTAGACTTGCTGGGGTGGCCAATGGTAAGGCAGAGGACATAGCATTCCTTAT
CATCATGGCTGGAGGTTGAACATGTCAAGGATGCTCCACTCATTGACTGCTTCCACACTT
AAGTGTTTGGTCTTTCAGAAATGCCCTTTCCCCACAACCTCCCCCTCAGCAGCAATTATC
CAGATATTGTATTCTCAATGATGTCTTCTTTGACTACTTTTTTTTTGGTAAAATTACTCC
CTCCCCATTTGTAATCTGCTGTCTCTTCCTTCTCTTTTTCCCCTTCCCATCCATCATCTT
TATAAAATATGCAGCATAGTTTACCTACCTACCTTGAGTTTGCACAACTCCTTAGAAAGA
ATAAAAGCTACAAAGGGAAAGGTATTTGTGTGGTTCATCCTCAGCACTGTGTGAGCACTT
AGCAAATAATTTTACAGTAAACTCTACAGATTATAATGGAGGGTGTATTCACCACTGAAT
GCCAAAGACATTGTGTATAATTCCCCATCTCCCCACATCTATTTGTAGAATTTTTAAAGC
ACACCACAGTATTTTGAATTGCATCATTAATAGCATTATTAAAGGAATTTGTCACCCCAC
ACTCAAGGGAAAGACACACATCTCTGGCAACTATATTTGGTCATTTTAGATACTACTCAT
AAAGCCTGGAATTTTTGAAAACATAAAGTTTCAAGTTGAAGAAGTTTAGAGATTTTCTCA
CCAGCAGGTACAATCTTGGAATTTCAGCATGATACTCCTACTAATAATAAACCAAAGAAA
ATGTGACATTCAGGTAACGCATATTTAAAATACATGCTCAAAAAAAGATAATTGTCTGAA
TTGTATATTCTTGAATCTGTTCCCTATTTGTTCAAAACTTCCCTGATTTTATTATATGGT
CCATTCTGTACTCATCAGACCTACACAGAGCAGACCACCTTAAATGTCAGAACAGCTGTG
CCTCTCAGATGCCCTGATGCCCATGCCATGGGCCTTAACAGACTTACAGAAATGCTTTTG
GCCTTGTGTGTGCAAATGTGGTCCATACCTGAGGGTAACTTGCGTGGGTCTGCAATTAGC
CCTTGTCTGTCAGTGCAGGTATGGGAGCCCACACAGGACGCTTACCTGGTAGGGCATGTG
CAGCCAGCTGCTGCCTTGTGAGGCTTCCCAAGCTCATACTAATGCCCCTGGTGTCTTAAG
GGCATGCCGAAGGGTTTCTCTGATGTGTTGACTCAAATGTTTGCTTTCCGCAGTTCAACC
ACACGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTCTTCCCAATGCTGAGATCAATGCTACACCCAGCTTTA
AATTTTAAAAAAATTAAAATTTTAGAGACTTTTTTTTTCTAAATTGAGATTATTTTTTGA
TAGCTTGATGTACATAGTCAAAAAGGATTTTTGAACAAATAAAGCAGCACACTGCCATCT
TGTTTTTCTTTTTCTCCTTTTTTTTTTTTTTTTTTAAATGTATGTGTTTCTGGCCTGTTG
TATGTTAGGCAAATGCTCTGCCACGGAGCTATATCCCCAGTCCTTTGAACGCGTCGTACT
GCGCCAAGTGCAGGGATTCCAAATGCTCCTGGCAGTGGGCTGACCCTCATAGAGTATGCA
GTCTGTGGTGGGCTGAAGCAGATACAAAGGTGTTGTGCAGAGAGAGGAGAATGGTCTCTA
CCCCAGGTTTGAGGCTCTCAAGCAAGGATTCCCTACCGGTGCCTTAGTTGTTCCTGCTGA
GTAGGCTGAGTAGTCCAGGAGGCTGAATGTTGGAGCAGGCTAGAGGACTCCAGAACAAAC
TCGTTACACTTAATTATTTTTCCAGCTTAGAAAAGTAATATACATTTTTTTTTTTTTTTT
TTATGTCTTTTTCCTTTTTATCCGGTACCGGGGATCGAACTCACGACTGCCTGGCTTGCA
AGGCAGGCGGCCTATGCCGCTGAGCTAAATCCCCAGCCCCCATACCGTTCTTTTACAAAT
AGTTGTTCAAGGTACAAAAGTGGAACATATAAAGTGGGAATTCAAACAGCAAGACTGCAA
ACAGTTCTGTTCAACTATCCAAAAAAAAATTAGTAATATAGTTGTCAATCCCTATAAATT
TAAACATACATGCAGTTATCCATATCTTCATTTATGTTGGGATTAAACAAACTAAAGCAG
GCTAAAATCATTCTGAACAAAGAATAATAGTATTGCTGGATTTCACATCATTACACTCCA
GGATCAGCACTGGGTACTGTAGTGTCTTTTTAAAAACTTTTATTTAAAGAAAGAGTAAAC
AAAACAGAAAATGGGTAGAAATAATAGATACTTTCAAAGAAAAAATAAACAGTAAGAAAT
CACTGTTGATGATTACAGATTGTTCTCTTACAAATAATTATTCAGGATACTAAAGTGGAG
CATAATAAGTGGGTATTTAAACAGTGAGACTACAACCAGTTCTGTTCAATTATCCAACAA
AAACTTAGAAATATGGTTATCAATCCTATACACTTAAACATACATGCAGTTATCCATATC
TTCAATTACGTTGACATTGAACCAACCCAAGCAGTCTAATATCATTCTGAACAAAGAATA
GTACTGTTGCTGGGTTTCACATTATGACCCTCCAGGATCAGCACTGGGTACTTTAGTGAC
TCTTTTTCTTCAAAGTATCTGTTCATTTCATCATGTGTCATAAGATCAGTTCTCATAAAC
TGTTTATAGATTCTACACATGCATGAGTCTTAACATGTATTTCTATCCTTTCTATATTAG
AGGGAGAAACAAAACAAAGCAAGATAAAACAAAACATATTCCTATAAACATATGAAATGA
AAAAGACAAATAAGACCGTTGTACAAAGAATTCTACCATAGTTCCTGTGTCGTCTCTTGT
TATCTTCAATAGAATTGGCTATATCATCAGATGTAGTATAATTGAATATATCAGTACATA
ACAGTATTAATAAAACATAACTTTGTATATAGTATAAAACTTCAAAAGCAGGCAGTTATC
AAACCAGAATGTGTATCGTAGAGTCTTACCATCTTCTGTGTAGTTGCCTATACTCTCAGA
CTTGATGCTATCAATCATATCCGTTTTGAATAAAATCTATTGGTACTAAACAGCAATCAA
ACAAACCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCGTTTGCTTTTAGTAGGTCTA
GACTTGAAGATTAGGTAACCAGTATTTTAAAACTGGAAGATCAGCTATATTTGGACAACT
AGACCCATTTTTATCTTGCTTCTACTTTTTTTTTTTTTTTTCTCTGTCTTTTTGAGATAG
GGTCTCATTATGCAGTTCAGGCTGGCTTTAAGCTCACTTTGTAACCCAGGCTAGTCTCAA
ACTCCCAATGATCTTTCTGTCTCAGCCTTCTGAGTGCTGAGATTACAGGCATGAGCCACC
ATACCTGGCATCACTTCCACTTTCTAATTTTAAGGATTTAAAGAGGCTTTTATGTACGTG
AGTATGGTGGGGAAATAAACAAAGCAAGCAGAAGGTTCTTTCATCCCATTTTTCAGTACA
AATTTGTCCTTGGCTAACTCCTGACTTTTGCCGTTTGACTTTACATGCCATTTAAGTTAT
TAAAGAGGTTTATAGCTGCTTATTGTTTGACACAGACTTTAATACAAAAAGTGCTATTTG
AGCATTTAAAAAGTACCAGTTCATCAGGTTCTAGAACTAGGGGACATTTTTTTTTTTTCC
TTTTTTTTCTTTTTATCGGTACCGGGGATCGAACTCACGACTGCCTGCTTGCAAGGCAGG
TGCTTATGCCACTGAGCTAAATCCCCAGCCCCTTAGGGGACATTTTGATAGTTGAGATTT
GCCAGTCTTTTGTAAGAGGCAGGCAAATCTGGGTTTTTGTTTTGTTTTGTGTTGTTTGGA
GACAAATTTTATGTAATTTCGGCTGGCCTTGAACATATTATGTAGCCCAGGCTGGCCTTA
AACTCACAGCACTCCGCCTGTGTCAGCCTCCTGAGTGCTGGGATTACCGGCGTGTGACAC
CACGCTGGGCTGGCAAATCCATTTTCTGCACGTTGTTCACTTCGAAGTCAGTGTCTTCAT
ATCTACATTCAGGTACTAAACATGAGGTCTCTGAAACTGTTGAATTTAGCCTACGTTCAA
AAGTGTTTAAAATAAATGGGATTCCCTTTTGACCTTTCTAAAAGTGTCTCACTAGTTTAC
TAGTTAATGCATCTGAGAACTGTTTCTGCCTCTAGAGTAAGAGACTAGAGTATGATTTTA
CAAAGCATCTGTCTATGTGGATATGTAGACATTGGTCATGTTCGAGAATACGTCCACCTC
CTATACAGCTCCTTAACTGTTACAGTTGACCAAGTCATAAATTGTAGTTGGAGATGAGTG
GGATTAAAACATTTTAAGTGATACAGATCTGTGTCTGTTGAGGGTTTTAAAAAAAATTTC
CTTTGAAGAAAACAGGACAAATAATGAAACAGTGAAAGCAACAGATTACTAACCTGACTT
TTCTTTTGCCTAGATTGCTTATGCCCGTATTGAAGGGGATATGATAGTCTGTGCAGCATA
TGCACATGAACTACCAAAGTATGGTGTGAAAGTTGGCCTAACAAATTATGCTGCAGCATA
CTGTACTGGCCTGCTGCTGGCCCGCAGGGTATGTATAAAGAGACTTTGCTATGTTAGCTT
GTTGAGATGAGCTGGTTGTTTGGAATTGCCTTTGGGATGTTTGTATGTGGGTAAGAGACT
CCAGTGGGGTTTCTAGCAATGTTTACTCTTGGATGGCTAACAAGGAAGATGATTTTATAA
ATACAAAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATAGCTTCTCA
ATAGGTTTGGCATGGATAAGACTCTATGAAGGCCAGGTGGAGGTGACTGGAGATGAATAC
AATGTGGAAAGCATTGATGGTAAACCTGGTGCCTTCACCTGCTATTTGGATGCAGGCCTT
GCCAGAACTACAACTGGCAATAAAGTTTTTGGAGCTCTCAAGGGTGCTGTGGATGGAGGT
TTGTCTATCCCTCACAGGTAATAGTATTTAAGACCTCGTACTTTGACCCCGTTGTTTTCC
TTGATTCTACCTAGTGTAGAGATTACTTAAGAGTACTAAAATAGCTATCATTGGATACCC
ACTCTATGTTGGTACTATGCAAAAGGAACCTCACATGGCAGGAGGGAATTGTAACCCATA
AAGAGACTTGGGGCTCAGAGGCAGTGGTTTGTCCAAGGTTTTGGAGCTAGTAAGTGGAAG
ACTGGGGTAGGAGCTATAATCTTTTGCATTTGATTTAATTTTGTTTAGAAATGAACAACT
GTTCCTGCTCTGTGCATTTTCCTTTGATATATGGGTTAAAATGGGTCTAAAAGGCTTATG
TAAGATTCCTAAACATTCAATTGAAAATAGAATTTCAGGCAATTCTTTTTTTTTTTTTTC
TTTTTCTTTTTTTTTTGTCTTTTTCATTTTTACCAGTACCAGGGATCGAACTCACGACCG
CCTGCTTACAAGGCAGGTGCTTATGCCACTGAGCTAAATCCCCAGCCCCTCAGGCAATTC
TTGGTAGCTTCTTTGGTTTGAGTTGTTGAATAGAGGTATATTGACCCTCATCTTCAGATT
GAACTGGGGGCCTTAGTACTGAACTACATCTTGGTCTTATTTTTTATTTTGAGACAGGTC
CTTTTTTGCTAAGGTGCCTTTACTGACCTTAAACAGTGGTTCTCTTGCCTTAGATTCCCA
GAGTGCTGGGGTTACAGGCATGGGCCACCATTTGGCTCATCTGCTGTGTGTTTTTGCATG
TTTGTTACTGTTGTAAACAGTATGCAATTTTATATTTAATTGTAAATTCATCTCTGATTA
GAAACAAGTTAATGAGATACAAAGTATCTCATTGGAGGATTTCCTTAATCTTGTAGAAAT
CATTTATTCCCCTTTCCTTTGAGGCCTAAGAAATTACAGGATTTGGGAGATAAGTTTTGA
AACCCTTTCCTGTGCTAATACAGATAGTGATAAACAGCCTTGGTAATTGTTTTAAAGGTC
TTTGTGGCAGGGTGCAGAGGTATCCACCTGTGTATGGAAGTCTTAAGGCAGGATGATTAC
ACTTGAACCCCCAGGGGTTTGGAACCTTCGGAGGAAGGGTGTTGTATGTTTTTCTATTCT
GGAATTCAGTGGTAAGCTGCCAAATGATGATAGTCTACAAACTGAGCAGTCAGTAGTTGG
TCCTTTGATTGCATATGATATAATAATTGTTTCAAGACGGGACTGATGGCAGCTACTAAA
ATGCATTACTGTCAGTGAACTTATTTTAGTTAATCTGTACTAAACTATGAAAATAATTTA
TTTTAGTACCAAACGATTCCCTGGTTATGATTCGGAAAGTAAGGAGTTCAATGCAGAAGT
ACATCGGAAGCACATCATGGGTCAGAATGTTGCAGATTATATGCGTTACCTGATGGAAGA
AGATGAAGATGCTTACAAGAAACAGTTCTCTCAGTACATAAAGAACAATGTAACTCCAGA
TATGGTAAATTTACCTAAAAATGCTTGTATATTCATTTTATATAAACAAGTTTGTTGGGT
TACATTTGTTTCAGGCTAGCAGTTGAAAATTAAAGATGGTATGTTTTGTAGGTATGGTAG
ATTCACATAGTTGATCTTTTCTTAAATTGAGAATGTTGAATGAGGGTAGATTAAGCATTC
AATTAGTATTAACTCTTGGGGATGCAGTATAAGCAATGAGCTAAAGTTATCAGGTTAATC
TTTTAGATACTTAAGCGTGGCATGCTTTAAGTACTTAAGGCCTTTGATGCCTTTTAGGTT
TTGGCTGTTCTGTATTTATAGATCTCATCCTGTAACCACGGGATTTGTAATTACTTTGAT
ATAAAGGGTTAAGTACTAAGCACTTAATTTTGAGGAGGAAGAAAGTTCTTCATAGCAAAT
ACGTGCTATATTCTGGACTACGAATACCCCAGGCGTAAATACAAAAAGGGAGCCTTACAG
ACTCTTGTGCATGACGTTGCACAAAAGGGGGAACCATGTTGCAAAAGTTAAATGTTGGAA
ATTTGTCAGCCCCAAAATTGAATTTCTCTGGCTACCTCTTTTAAAAGACATTGGACTAAT
TGAAGATTACAGTGCCAGTTTTGAAGTTGTAGTGAAAATGTAGAACCCAAATTAGATTAT
TACAACTGTAAAACTACACATAAGTTGTTTGTAATTGTTAGGTCTTTTCTGTTTAGAGCG
TTTTAGTTTGTTTCTATTAAGAATAGCTGTTCTTGTAGACTGTTACTTTACCTGGCCTGC
ACAGTATCTCTTCCTAAGCCATAATCTTGATGTGTTATGTTGCAGTTGTTCAGAACATCC
ACTTCCAGCCTGTTTGCGCTTTCAGATACTCATTTGTTGATGGCTTCCTTGTTTTAGGGG
CAGATTTGAGGAGCTAGGAATTGAACCCAGGCCCTTTTGCATGCTGTTCACATACTTTAT
CACTGAGCTACAGCCTCAGCCCCTTGCTCATTAATTTTGTCTGTGGTAGCCTCTTCCTCC
TTTGTACCTGGTGAAATCCTCTGCAGACATCAAAACAGGATTATAGGTGGAAAAGAATCA
GCCTTAAAAACTAGAGATCAGAGAAGCCACTGAGCAAGAGAACAGTAATGCCAGCTAAAG
CAAATAGGCTGATTGGGGCTGGTTTTTTTTCTCCCCTGGTTGTGGGCTGACATTTTTGAG
CTGTAGTTTTTTTTCAAGGCTGATTTTCTGACTAGGGTTGTCTCTTGGAAGTAGAGAAAG
TAACTATGTTGCTGATGACCGAACCCAGGTTTTTCTTTTTTTTTTTTTTTTTTTTTTTTT
AATGACTTGGTCTTATCAGTGTAGTTCAGACTTGACCTTGAACTATGTAGCTTGGGCTGA
GTTTGAACTCTTGTCTTAGCCTCCCAGGTCCTGGGGTACAGGAGTATGCCATGCCTAGCC
CTCATGCTTTTTAGTTTTATTTTGACATAGGTTTTGCTAAATTACCTGGGTTGGCCTTGA
ACTTGAAATCTTTGTGCCTTCTTAAGTATTTGGGATTAGAGGTGTCATCCACAGTTACTC
ACAATTAACTTTGCTGGGCTGGGGATTTAGCTCAGTGGCATAAGTGCTTGCCTGGCAAGC
ATGAGGTCATGATTTCAATCCCCAGTACCATAAGAAAAAAAATTATGCTAGGTGGTTAAA
GCCTTTTGTGGTTGGGGGTATACTGAAGATGGAATCCAAGTACTGAGCTGTGTGAGCTAT
ATTCCCTGTGTTTTGTTTGTTTTTTTGAAATAAGATTTTGCCCTGTAGTTTAGGCTGCCC
TTGGATTCACTAGGTAGCCCAGACTGGCCTCAAGTTTACAGTGATCCTTCTGCCTCAGCT
TCCTGAGTGCTGGGATTACAGGTATGCACTGCTATACCTGGCTCCTCAGCCTTTTTTTAA
AAAAAAGTGTCATGTTTGTTTTCCTTAATGCTAAAAATATGCCGTACCACTGAGCCAAAC
AATTGTTATATCTAGAAGTTGTCACTGGATTTTAAAAATGAGCTATGGAAAAAAATTGCC
CAATGAAAAATCAAAATTGATGACTTCAGAGTTTCTAGAAAATCCAGACCTTTTGACTTG
AAGGGACGTTATATTACTTAGAAATGCAGTTAACAAAAGAATTTAACAGTTACTTATTGG
TCTTTATTGTCCTGTACTTGGTCTGAATGAAGCTATGTCAGGAAAAGTTGGCTTACCTTT
AGGACATTAGGCAAGGACTGATACTGACTTAGGTTATTTCCTTTTGAGAACCAAGGTTAG
AGAGGCAAAGCAAGTAGTAGAACACTTTGTCTTAATACAGTAGGGCATATGAAATGAAAC
CAAGTACTGTTTGCTTTCCTTTGTTTCAGATGGAGGAGATGTATAAGAAAGCTCATGCTG
CTATACGAGAGAATCCAGTCTATAAAAAGAAGCCGAAGAGAGAAGTTAAAAAGAAGAGGT
ACGTATCTTTCTGTCTTGAGAATTTTAGTGTGGGTCTCACATGCCTTGTTCCATTTTGTG
GATCAGGCTTTCAGTGAGGTTGTGCAAACTCGATCACTAGCTCTGCATGATGTGGCAGAA
GCTAAGGGAACCAGGTTTGCTAAAGTAATTGTGGTGATAGGACTGTATTAGCCTCAGAAG
CTACTGGGGTAGTTCGTTCTATCCTCATATAGTACAAGAATCAATGACTGCATTTTAAAA
TGGCTATATCTCAGTAATTAAAAAATAATATATGCACACTTAGCCATTGTACTATCATTT
TTTTATGTTTACATTTTGGACCCTGTGATAATATGACAAAGTGCTTGGGAAAGTTAGCTT
AAGAAAATGTATTAGAACTGAGATTAACCTCCATCTGATAGTCTGTCATTTTCAGCTGAA
GTTAATATTCTGTATCCTTTTTAGCTATGGTTTTAAAAAAATATATTCTTGTTTTATAGG
TGGAACCGTCCCAAAATGTCACTTGCCCAGAAGAAAGATCGGGTAGCTCAAAAGAAAGCA
AGCTTCCTCAGAGCTCAGGAACGGGCTGCGGAGAGTTAAAAATTTCTATCAAGACTTTTC
AGATAAAGACCAATAAATTTATTCAGATAAAGACCAATAAATTAAGCTCTGTGTTAAGCT
CTTATAACGAGAGTCTAGGAAATAAACTGAAGCAAAGGAGTTGACAGGTTTTCTTTTCTC
CAAGAAAAAGGTGTAATTTTTTCCAGAAAAAAACATCTTGTTGATGCCAGCAAAGTTCAT
ACCTATTTCTTGGGCTTCTGTTCTCTTTATTATCCCTCAGATTCTAAGTTTGACAAGCAC
AACAACAGACCAACAGTGATCACTATAAGTATTTCTTCTGTCCATTTGTTAACAACAGAT
CATTAGAGGGAAGAAAACATCTCAAAGTATACAATCTTAAAGGAAATAAAACTGCCTTTA
AATTTTTGAGAGCAAATGAAGATCACAGATTTAATACATTCATGTTAACTAAGATAAACC
TGTAAACAGAAAGTATGCTGTTGTCTTCAGTTTGAAGAGGAGGTGTGAATTTTATGGAGC
TGTTAAGGTACATGCAGATCTGACTGAAAATACATGGGAAAGGATCAAANNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATG
CAGGGTAAATGAATTTTTGGTTATGTGGTCTTAAGATGTCAGGGTTTTTTTTTTTTTTTT
TTTTGTAATTGTCAGTTTCGCAGGGCTGGGCTCAAACCCAGGACCTTAAGCATCTACCAC
TGAGCTACATTCCAAGCCCAAGGGGTTGGGGATTTAGCTCAGGGGCATAAGCACCTGCCT
TGCAAGCAGGCAGTCATGAGTTCAATCCCTGGTTCCGATAAAAATAAAAGACAAAAAAAC
CAAGCCCAAGGGTTTTTTAGGAGCTTGGTAGTAGCCTTAGGCTAAGTGGACTCATCCAAC
TTTTTTTTTGAGGCAGGTT
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1070, 1417..1532, 25393..25527, 26993..27020, 27022..27196, 28506..28683, 31049..31137, 31619..31718
1001..1070, 1417..1532, 25393..25527, 26993..27020, 27022..27196, 28506..28683, 31049..31137, 31619..31715
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved