Cavia_porcellus Locus Mono:SNORD61
snOPY snoRNA Orthological Gene Database
Cavia_porcellus Mono:SNORD61
Cavia_porcellus
Mono:SNORD61
scaffold_79
SNORD61
1156..1228
2073
AGGAAGCCCGTTGAATTTCCCAGCCCGCGTTGCTGGTAAAGTTAATTGCTTCACTGGTG
TCTGTGGTTCTGGGCTGAATCCAAGTGTCGCCATTTTGTCTTACACGCGGTCCTTAGTGA
CGAGTCTTAATTGGGTTCCGCCGCAGTCTCGGAGAGATGCGTGTTACTTTGTGCGTGCCG
ACGTTGCGTTATTTAATTTCAAACGATGTTGGCGCTTGTGTTTATTTTTTTAGCGAGGAA
AGTTATCTTTTTGGGCGTGCAGGAGATGAGGGGCTAGTGAAGATGAAGCATAACTTGGCT
CGAATTTTACGATTTCTACTGCTTAGACTTGCCGGGAAATCCTGATGAGAGGAAGGGCAA
GTTCCCTAAATTTGGAAGAAAGCTTTCGATGTGTGTTAAGGTCGTGCGTCTGCCCAGCGA
CCTTGAATGAGTGTAGTCAAAACCATCAACTAACCGTCGCCACACGCGCGCCGAGGGGTG
TATGCGCTAAGTAATTGAATCCCTAAAAGGCAACAGATGGACGATTAAAACTAAAATTGG
CCTTTTCAAACGTTGAGTAGCTGTGAATTGATGAAAAACAGTCAAGGGGTTAAGGTTAAT
GTGCAAAATTAGATTGAATGTTTTGACCAATTTAATGTAAAGTACGTTGTAAATATGCTA
CTTGGTTTAAATTGGTCTCCTGCATTTGAGGCTTATCGGTGGTTTTACTTATTTAAAGAT
GAAGTTTTAAGTCAAACAGGACGAAGGAAACATCACAGTAAGATGCCCATTAAATTTAGG
GAACTTTCTCCAAGGGGATAATACTACTAGCTTATTTTTTTTTCAGCGGATTCATCAGAG
GGAAAAATGGTTGAAGCAGATCGCCCAGGAAAGCTCTTTATTGGTGGGCTTAATACCGAA
ACAAATGAGAAAGCCCTAGAAGCAGTATTTGGAAAATATGGACGGATAGTGGAAGGTGAG
TTACCTGAAAGTATGTGCCTGATTATTGTAATTAAAAGAAAGCTGTGATGAATTTGATTG
AATTGATAATCTGACATGATAATGTATTTTTGTCCTCTAAGAAGTTCTGAGCTTTCACGT
TACAAGATTTAATTTCATTGTCTCATTTGAAATGTGGTAACACTTTCTTTAACTATTTCT
CAGTACTCTTGATGAAAGATCGAGAAACCAATAAATCAAGAGGATTTGCTTTTGTTACCT
TCGAAAGTCCAGCGGATGCGAAGGATGCAGCTAGAGACATGAATGGAAAGGTGAGGCTCC
CGCTCAGTGATTGACAGCATGTTTCCTACTGCATGAAGCAGCATGAATCCAAGTGTGGCT
CAGGCAAACTCTTGTGGAATTTTTGCTTTTTGAGCGTATACTTGTTGCTGAACATAGGAG
TGTGATACGAATCTGAAGTGTGTTGTTTGAATTCCAAACCCAAATTTTGTAGCTACAGTT
ATGGGTTATATAAGTCTATATGATATACCATAGTGTATTTTATGATGGGGTCCGTATATA
AGCTATCTTTTAACTTTTATTTTGATAATAAGCTGACACCTTGGATTGTTTTAAATATTA
CTGAACAGTAGTGCAGTGGGTTCACTTTGTTTTTAGTTTATCTTTAATAAAAACAGAAAT
TTAATGTGGGAAAGTTTTTTGTTTGTTTTGTTTTTTTGAAACACGTCTCACTATGTAGTT
CAGGCTGGCCTTGAGCTCATTGTGTAGCCCAGGCTAGTCTTGAAATTGCAGTGACCCTCC
TGCCTCAGCGTCCTGAGTGCTGGGAATACAGGCATGCACCACCACGCCCGTTTTTTTTGT
TTGTTTTGTTTTTGTTTTGCTTTTTTGGTCTTTGAGGAAAGGTCTCAGCTATGCACATAG
CAGGCTTCCTGCCTCAGCCACTCAAGTGCTGGGATTAGAGGCCTACACCACCACTCTGTT
TATGGAAAAGTCTCATTTATAGAGATACTATTTCTAGCATTTTTCCTTGAGTAGTGAGTA
AAATTTAATGAACTATTTTAAAGGACCTATTTATTTATGCTATTTATGATGAATGCTGGA
TCTGCAAATTCTTAAATCTCAATGTAGTTTATGT
  Untranslated Region
  Coding Sequence
  snoRNA
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved