Cavia_porcellus Locus RPS13
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPS13
Cavia_porcellus
RPS13
GeneScaffold_1881
SNORD14
3876..3964
5128
ACCCAATTTGAAGTTCCTAATATTTTGCGGAAAGTTATTCACAAAATAGTGTTAGGTTA
CAAGAATTAGCGTTTTAATGCCTAGGTTTTTTGTTTTTATTTTATTTTATTTTTTAGCTT
CTTATCAGTTAAGGTTGATTTCACTGAGATCCACCTTTCCAGGACTGCTTTTTGTTTTGA
ACAAGTAGCTTCATTGTCCATTCTTCGGAACGCACTGTATATCAATGCTGGATCAAAGAG
CTTCCTCAGTGGCGGTTCCCCTATTTCCCTCAAAAGATCAAAAGCGGACTCCTTTTCTCC
CTCATCCTCCTGGCCTTCACACTCTTCCTAAAGCTCTCCTCCCTCCACCGCTTGTTCATC
TAGGCATGCAAGTCCGCGAGGCTCTAACCTTTCCTGAGCTCCACAGCCCCGGGCCCAGGA
AGGGGCTCTGCAGGGCACGTTTACCGCCAGGATCTTCCCATGAGTTCACTTAGGATCTGA
GGGCTGCCTGGAGAGCAGTCACTACCATTACTTCCGGTGCAGCATTCTGACTACAGCTCT
GTGCCCGCGAATTAAGTACAGAGGCCGACAGGGAACGTAAGATACTCCGTACGAGACAAA
CCCAGGCTTTGGTGGAGGAATGAACTCTGACCCCTGCAGCTCTAAGTCATCTCCTACTCC
CGGGCCAGGATTCGGACCCCTATGACTGGGACTAACAGCACGTAGTCCTAGAGGAGCCCG
CGAGATACGAACTTTGAATGAAAGCCGCCTTTCCTTCAATTACCCCCTATGGCTCGACCC
AGACCTGGGATCCAAGAAGTCTGACTGTTCTTCTGGCCAATGGAGAACACATACTCACGC
CGAAGTGCATTTTGGGAATTGTAGTCACCGAGGCCACACAACATGACCCCACCTCCCACA
TGTGAGGACACAGATACGTGTGAGGTCACTTCCGGCGCGAGGGATAGTTTCCTGCGGCGT
TTCCACACTCGCTCTCCTTTTGCTTCTAGACTGCCGCCATCATGGGTCGCATGCATGCTC
CCGGGTGAGCTTGTGGCGCCGAGCAGGGCTGCCGGGTTGGGTCGTGGGCTGGGGAGAGAG
AAAGGAATCTGAGTTTCTGGTGGAGGGGATGATGTTCCTGGCTGCTGTGCTACGGGCCGC
GCCTCATTCCATCTGCTTCTGTTTCCAGGAAGGGCCTGTCCCAGTCGGCTCTGCCGTATC
GTCGCAGTGTCCCCACCGTAAGTAGTGCTCTGGGATTGGGGCGATCGTGGGAAGGAGAGG
CGTTTATCTAGGAGGAAGCGGCGCCGGAACGAGGGACCGGAGTGCGCGAAGAGCGCCGCT
TTGTAGCTGGAGGCGGCGGCGGGGGGGGGGGGGGCACTTAGGCACCCTCCCTGGATTCTT
CTCATCCTCCGCTCGGTTTCCCTCCCTCTCACAGTGGCTGAAGCTGAACGTTCTGACGAC
GTGAAGAGACAGATTTACAATTGGCCAAGAAGGGGCCTGACTTCCCTCACAGATCGGTGA
GCGCTTCTGGTAAACGTAGGCTTTTGCGGTAGGGCCGGCGTGGAAATTGTGTAAAAGACC
CAAAATGGGATAATCAACGCGCTTGGGAATACACTTATAGGCTTTTTGGCTTTCTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
AATTCCGCCTGATTCTCATCGAGAGCCGGATTCACAGATTGGCTCGATATTATAAAACCA
AACGGGTCCTCCCCCCAAACTGGAAATAGTAAGTATCTACTTTTTCTGATGCTAGATCTT
GAGTCAGTCAGACAGTAAATATTAGTAAGTAATAGTAAATGTTTTGGCCTTTATGGACCG
TATCAGTAACTAGTCTTGTAGCTTATCTGTGCCCATGCTCTGGTAACAGGCAGTAAGTAC
ATAATTAAATGCACATGGCTGTATTCACTTAAAACTTTGCAGGCCTCCAGTTTGGACCAT
GAACAAGCATTTTCACATCTGTGTAGACAGGGCTAACATTTCATTTCCCACGTTGGTCCC
AGATATTACTGTAGTTTTATTTGTTGCATGACTTGCTCACTGTGATGATTGATATCCAAA
CATTCGCAGTTTCCACCAGAAAGGTTTTCCTCATGTTGGTTGTTCTTCCTTGGATGTCTG
AGTGAGCACTGTGATCCATTATAGTTGAGCATTGTGAGCTGATTCTGGAACTCAATTTGG
TTCATTTTAGAGTCTTTACATGGGTACCCAGGTCCAGTATTAATCCCAATTTTCTCTCTC
TTTTTTTTTTTTCAGTGAGTCATCCACAGCCTCTGCCCTGGTGGCATAAATGTGTTTATG
TACTCAAGCAATAAAATCATGATTTAACTAAAGGTGTGTTTTGTGTTTATTTCTCCTAAA
GAAAAAAAAATAGTATCTACCAGTGATTTGTATGTTGATCTTTTAAGTATGTGTGTTTGA
TATATTTAATGTTAAATAACATGTTCACCACAGTGTAGCATCAGAAATAAGTATCAGTGG
AAGAATCTTTGACGTGGAGAGATCTTGGGTCTTGCTTATGAGGCTTAAAATAATACTTTT
TTCCCATTACCATGGATTGAACCCGGGGGTGTTCTGTCACTAAGCTTCATTCAAAGCCCT
TTTTATGTTTCAAGACTATAGAGTCAAGTACTATTGCCCAGCCTGGACTAGATCCCCTTG
CCTCAGCTCGTAAGCAGCTGTGATTACAAATGTGTGCCTTCATGCCCAAGGGAAATGATA
CAAAGCTTTTTCCTTCAGCTTTACTCTGAGCCACAGGCAAAACTGTTGGAAATCACTGGA
GAGCTGGACTTAGGCCTTCATGCTGGAACTCACTTTGAACTATGACTTTTTTTATGAGAC
AAAGTCTTGTTTAGTTTCCCAGGTAGGACTCAATATGAAATCCTCCTGCCTCTGCCTTCT
GAGTACTAAGATTAAGATGTCCACTTCCTCTCAACTGTGACATTTTGGTTTTGCTCCTTT
CCCTGGCATCCTCATAATTCTGTCATGTTTCATGGTTAAATCTGAATTCTTTGTTGACAT
TCATGTGACTTATATACACTGTTGGTATATCCTCTAGTTTCTGCAAACATTTACATAAAG
TTAGTAATTATGTCTTCTGTTGTTTAGTGTTTTCTAAATCATCTTCAAACTTAGAACCAT
AGTTTTGTTTTGGTATTTTCAAAAGTGAACAGTTGTACTTTGCTTTTTTGTCTTTCTAGT
TCTCATTTAGACAGCTTACTCTTTCAGACCTGAGGTTCTAGAATTTTTTTTTTTTAATCG
GTACCAGGGATCAAACTCAGGACTGCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1023, 1168..1216, 1414..1428, 1431..1457, 1460..1478, 1481..1495, 2456..2625, 3467..3567, 4095..4128
1001..1023, 1168..1216, 1414..1428, 1431..1457, 1460..1478, 1481..1495, 2456..2625, 3467..3567, 4095..4125
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved