Cavia_porcellus Locus ENSCPOG00000010002
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000010002
Cavia_porcellus
ENSCPOG00000010002
GeneScaffold_2765
SNORA21
1127..1260
2503
GCGCACTCCTGTAATCCCAGCATTGAGAGGCTGAGGCAGAATTGTTTGCAAATTTGCAA
CCAGCCTTGGCTACAAACTGAGCCCAAGGCCAGCCTGAACTGCATAGCGAGACCCTGCGT
TAAAAAAAAAAAAAAAAAAAAAAAAAGGCTAAAGAATGTGACTCTGTGTTCCTAGGTTCA
GTCCCATGTATCGTAAAGAAATATACAAATAAAGATAAAGCAGTACATATCTTTAAAAAT
AATAGCGATATGACACCAAGTACACGCAAACCAGACAACTACTTGTTTCATTTATAGTTT
GACACCTCAACCTTCTCCACCCATGTCGCACCCCTGCGCCAGCTGCGGACCAGGATTTAT
TACGTCACAAGGCTGCGCCCTAGGGAGGGGAAGAGACAGGTTGAACCTTCGAGGGATCAC
GTGGATAGAGTGGGCGGGGCGTTCCAGTTAACGTCCCAGCATTCTTTGAGCCTACTTCCT
TTCTGTTTCTTTTCGGCGTCCAATATGTCGAAGCGAGGTGAGGTTTGGTTCTGGAGAATC
CGTCGCCATCTAGCGCGTGGGAGTTGTCGTTTTCCTCGGGAGTGACACCCCCGTGCAATT
GGGGCGCTTTGCTCTCCTCTGGGCCAGAGCAGGGGAGGAAGGACACCGTGATGGCTTTGG
AAGGGCCCCGAAAGTGACGGGTGGGGGAGCTGGAGCATAGAGTTGGCAGGACCTGGACGC
GGTTGTAGACGGGTTCCGGTGAGATTGCTCCGCACACACTCGTGTAGTGGTGGAGTCCCA
CTTGGTCCGGTTTCGTTGGGGCATCCGATGCCTTCTGCCTTGCGTGTTGCAAAAATTGGA
GCGAGGTTTGAGTGCACCGGCGCCCTAAATGTCGAACCGAGGGTGGTTTTAGTGTGGGCT
TCGCTGTTTCCCGTGAGAACCGGGTGGCACAAGGGGAGAGCGTGAGCGGAATCCTACGAA
AACTTGTCCGGAGCGTGTTTCCATAGTGACCCCTTAATCCTTTTCTTCCCGTAGGACGCG
GTGGGTCCTCGGGTGCAAAATTCCGGATCTCCTTGGGTCTTCCGGTGGGAGCCGTGATCA
ACTGTGCTGACAACACAGGTGAGGCGCAGGCCGCGCCAGCTCCGTACCCCCCTTTAAAAG
CACTCGCTGGGCCCCTGCTCGTGACCCATTGAGCCGTCAAGAAGGGCAGAGTACAAACAC
CGCTTTTGGGTGAAGCGGCAGCGTGTCGTGTTGTTATGCTTCAATCGGTGGTGTGACAAG
ATATCCCCCCCCCCCCCCGTTGGGGACTAGCTGTTTGGGGAGTGAGCGGAGGAGAAGTGT
CCTTTGGGCATTTGCTAGGCCCTCAGAAATACTTGCTTTTTGTTTGCATCTTATAGGAGC
CAAAAATCTGTATATCATCTCCGTGAAGGGGATCAAGGGGCGGCTGAACAGACTTCCCGC
TGCTGGTGTAGGGGACATGGTGATGGCCACGGTCAAGAAGGGCAAACCAGAGCTCAGAAA
GAAGGGTGAGTAGAGCAGTCTGCCTGGTCTCGACTGTGTGCCAGGCTCGTCCCCAGTCAC
TGGAAAATGGGACCTTAACTTTGCCAATTCCTGGGGACTCTAAAGTACTTGCTTTGTCTT
GAGAGAAGTGCCTGAGATTCTTGTCACTTGGCCTTCTAAGTTTTTTGATGTCTCCTGAGG
ACCCAGAGTACCCTAGCACGCCACTTCAGCTCAGTTCGCCAGGCACTTGTAGACTTGTTG
TGTTCCAGAAGAAGAGCCTTCAGTGGCTCGCAGCTCCAGACACATCAAGTGACCCTGTGT
GAACATGAAACCTGTTTTCAGTAGCTTAGAGGCAAAACAGGTGAGAACACAGGTTTATGT
CACCACAGGAATTGGTGCCCATGCCCCTTGTCAACGGCTGGTGCCAGCTGGGTCAAACAA
AGCTGCATGTGTGGAGAACATGTGCTGATACAGTGCTAGGTGGTCCACTCGGGAACACCT
TTATGCCCAAGACTGACAAGCTCAGGATAGGGTCGCCAGAGGCTGTCACGGTTGGTATTG
ACAGAAACTGAAATAGGGAGCTGATCATTGCTTAACCGAGGGCTGGAAGTGTTTCCACAC
ATAGTGGCTAAGGTGCATAGTCTCAGTGCTCAGGAGGATCACAAATTTGAGGCCTGTCTG
GGCTAGATAGCAAGACCGTGTCTTGGCGTAAGAAAAGCAAAGTCTGACCATGCATGGTGG
CACACCCCTGTAATCCTAGCACTCAGCAGGCTTAGGCAGGAGGATTGTTGCAAATTTGAG
GCCAGTTTAGGCTACAAAGTGACCTAAAGCCAGCCTGATCTCCATAGCAAGACTGTGTCT
CAAAAGAAAAGCAAAATCTGCGGGTTGAGACCCTGGTACTTTCAGAACTGGTGATGCTCC
TTTGATTTTTTTTGAGAAAGGATCTCTATGCAAATCAGCCTGGTCTTGAACTCACTGTTT
ATCCCAGGCAGGCCTCGCACAGAGATCAGACAGTGATCTTCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1097, 1376..1503
1001..1097, 1376..1503
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved