Cavia_porcellus Locus C9orf102
snOPY snoRNA Orthological Gene Database
Cavia_porcellus C9orf102
Cavia_porcellus
C9orf102
GeneScaffold_6343
SNORA40
22842..22973
49412
TGGAAATCCTTATATCCTTCGGAAAGGAATTCAGAACTCTGACATTGGATTTTAGCTTA
AGGAGACATGTGTAGGGCTTCTGATCTACGTTAGGGTTACCTGTGACACATCTGGGCTGT
TTTAATTAAAAACAAAACAAAAAAAAAAAAAAACGTTTTGACAATTGGTTTCAGCACCAA
CAGGAAACTCCTACAGGCGTATTTTGGCTATAACTCGGTCGATGGGATCTGGAGGCAACA
AGCAGCCATGCTAGCACGTGCCGTAGCCGGCGAGGCTTGGTCTGAAGCGTCCGCAAACGT
ACCCAGGCAGTCTCGTTTGCTTCCCTTTGCGAGTGGCTGGGGTCCTGCACTTGCGTGGCT
TGGCCCTTCCACTACGCTACACACACGACTCCGGGCAGCGACAGGAGGCAGGGAAACCTC
TTAGATGTTGCCAGTGTTCGCGTGCCTGCCTTCCACTGACAGCGAGCATTGCTGATTTCC
TACTCTCAAGATTTACTAGAAACGATGTGACCCGGAAAAGCGCGCTCTGAGGCGAAGACA
CGAAGGAGCCAGGAACTACCTGCAAGTCGGGGAACCTTGGCCTCACCTGCGACCTCCTGC
AAGGTTTTGCACTCTTCCTTGCAAGCAGCCGCAACTCTCCCGAGACTTGCTGATCTCGCG
GGGCTTCCACTACGAGCCTGCAGGTGGAGCCCTGGAGAAAAGCGCTCCGCTCCCGTTTGT
CCCGATTAGACGTCTTCTCGCGAGACCCGGCGCCACCCGGATTCAGCTCTCGCGGGAATT
TCGCGGCTCCTGTTGGGGTGGGAAGTGATGGGCGTCGCGGAGTGGCTGCGCTTCGTGAGG
AAAGTTTAGGGGTCGAGATGTCAGCTTCCTGGCCTCCCCAGGCGGCAGCAGCTACTAAGT
CTGAGACTACATAGTGGTACCCCTCGGCCCGGACTCCTCCGCCCCGTTTCCCCCACCTGC
AGGCGCTCCGAGCTCCGGGGCGATGCTGGCTGTGACCGCCGACCCCGGGCTGGATGGAGT
CCCCCGCCGCCCCGAGCCCCGGTGCAGACGCCGCCGGCCCAGGTATGAGCTGTGAGCTCG
CCTCCTGCCCAACTCCGCGGGTCCTGACCGCCCTGGGCGAGGGCTCGTGAGTGACAGCTG
CGGGTCGCGTGCCCCTTCCTGGCAGGGTCCAACTGGCCCTGGCGCTACTGCTGTCTGAGA
CCAGAGCAGCAGCTTCGGGCTCTGTCCTGGGCCGTACATAAAGCAAGGTTCGCGTGACTG
TCCAATGAGATCGGATGTATGCAAAACATTTCTGTGACTTCACGAGTGATTCCCAGCGAG
CGTTCAGTAAACGTTAGGTATTTTTATTCTTCATTCTTCTGATGCCCCAGTTATTAGTAA
ATGGAAGTTTGTTATGTAGATGAACGCAGATTTGAGTTGTTTAGTTTCACTGCACAAAGT
TTAACACGTAGTTACTGAGATAGGGATTTATATTCTCCCTCTGTCAGGTGGGTGTGGTTA
TTTGCCACATTATCTGGGACACATTCTTGCTCATTAAGTAATAGGTTCCATGAGTAATGG
TTATATTTCAAGGCCACCTGGTATTGAGTGTTCGGTGTCCAGCAATATACTGATTGTTTA
TCTACTTGCTTTTCCTTTGAGGAAGTTGTCTGTCACTTACAATAGGTAGTGAAAGTAGAA
GTAAGTTTCAGGAAGGTAAGTAGCAAGTTTGAACTCTGAGAGCAAGGAATTGATCACTTA
ATTCAAGGACCACACATACAACTACCTAGAGTAGCCTGGCAGGTAAAAACATAGATGAAG
CTCCTGGCAGAGATTATGGAGGAATGCTGTTTCCTCAGCGTCACTTTGGCATTTAGGGAA
AGTGCAGAGAAAAGGAATACAAATTGAAAATAAGGAGGAGGGCAATTTGAAATAAAAAAG
GGAGAGGGAGCCAGGATCTAAAGAAACATTACTCTCACCATTCAGGTCCCACAGGAAATC
CTCCCAATTTCAACAGTTTTGCCTGTTGTTTGGCTACAAACCTAAATTTGATAGGGTTAT
CCAACAGAGGATCTAAAAAGATACCCATCAATNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTTA
GAAAAATGCACATATATATAATTGATCTTGTTTCAGTTCTTTGGCAAAAATATTTATGTG
GTACATTTTTCCCCCTCTCAGTGTATAAATGAGGTGCTACTATATAAGCTAGATTTTAAC
CTTTTCTTTTTTATTATTGCAGACATATGGCATCCAGGAGAGAGATGTCTCGCCCCTTTT
CCAGATAATGAAAAACTTTGTGAGGCAAGCATAAAATCTATCACAGTGGATGAACATGGG
AAGTCATTTGCAATTGTCTTATATTCAGATTTTCAAGAAAGGAAAATACCATTGAAAAAA
CTTCAGGAAATAAGAGCTATTAAAGATTGCCCCAGGAGTTTTATATTTGATGATGAAGAT
TTGGAAAAACCGTATTTTCCAGACAGAAAATTTCCTTTATCTTCTAATGATTTTAAGTTA
TCTGAAGATGGAGATGTTATTCCTTATACTATTAATAGGTACTTGAGAGACTACCAACGA
GAAGGGGCCCAGTTTCTCTATAGGCACTACATTCAAGGAAGAGGTTGTATTCTTGGTGAT
GACATGGGTCTTGGAAAGACAGTACAGGTATTTATTTTAATTATTTTAAAATTAAAATTC
ATTAAAGACATTGTGTATAGAGTGGATATTATTTGCAAATGGCTGTTCATATTACCAACT
CTTGTGGTACAGGTGTTTTGTGTGTGTCCCTATGTTTTTGTTTTTGTTTTACCAAGAGAC
AGTAAAGTCTCAAAGTGGATTAGTTTTCATTTATTATTTTATCCTCAGTACTTAATTAAT
AACTATAAAATGTGTTATTTAAAATAATGTTTTGACATAGTTTGGCTTGATTTTTACTTT
GGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTGGTGAAGTAAAGC
TAGTTCATAATTAGAGCTAATAAATTTACGGCACTTTTAATGAAATGCCTCTCAATTTCA
AATTTCATGGAATTTCATATTTAGAATTCATTTCATAGAATGTCATGTTTCTGTGAAATG
TCTCTTAAAGTTCTGAGATTCTTAAGTAAATAAAAGATATAGTTCACATACCAGAATTTG
ACAAATGAAGTTACAGTTAAGATTGTATACTATTTTAGATACATGAACAGATTGAATTAT
TAATTACTATAATTAGGAATATAGTTTTTCTGTAATTTAAAAAACTCATAGACAAGTAAG
AGTAAAGCAGGGGCGGGACCTTAAATGGTTATTTGGTATCTAACAGGTATCTTTTGCCTT
TTCAGTAACTATGACTAGTTATCTAAAATTAAAAGTAATACATGTATACAATTATATATG
TGTATATATATATATATTAATGTGTGTGTCTCTTTAAGGAATAATTACTAACAATAAAGT
TTATAGATCTTAATTATATTTCAGTGAATTTTGATGGATATGGGTGCCTGAGTAACCAGT
AATGCTCATCAGGGTGCCGAATATATTTATTACCCTAGAAAGTTCCACATCTTCCTTTCC
AGGGAATACCCTAGTTACCTGAACTTTTATTTATAGATTTGTTGTAATTCAATATTAAAT
ATTTGAAGAAGTAACCTGAAATATTTTGAATATTTATATCATTGAGAAATTCAGTGTATG
CTAAACTCACATTACATATTTTTGAACACAACACATAAATACCTTTAAGCTTAACTGACT
AAAACACTTGTAAAGTGTAAATTCTAGGCATGCATCAAAGATCTTTCACTTAGGTGATGT
TAAATTTTTTAAATTGTGCAATGCTCCAAGTCAATCATTTGCTCTTTTCTTGTGTGGCAT
AGGGATTGAACTCAGGGACTTCACACTAGAATATACCCCCAGGTTCCTTCCCCTTTTTTG
AGATAGGAGCTTGCTGCATTGTCCAGGCTGGGCTTGAATTTGTAATCCTTCTGTCTCAGC
CTCTCAGTGTTCTGGGATTATAGATATGCTGTGTCCTCTAATTTGTATTCAGTACCAGAT
TAATGCTCACCTTAATCTTTCTCCAGATTTCTTTAATGACTTTATTTTCTGTTCATTTCC
TTCTGTTTCCTTAACTATGCTTCTTACAGTACATCTCCTAATCATCCTTCTGTTCCTCAC
TCCCAGCTCTGCTGGATTTCGCATTACTGGGAAGTCAAAATAGCCTGTCAGGTAGACTAT
TCCAGCACCCAGCACAGTGCCAGTCATGGGGTAGGGAATAAACTTTTTTTTCAATCTATT
AGTGACTTGTAAGTTGAATTCGGTAAGGATGTGGTTCTGTGGGTATAGATTATATTTAAC
TCACTCTCTCTGCCAAGCTTTATGCTAGACATTGATCTAAACTGTCCCTCAGGAGTCTCA
TGTGTCCAGAGGTGACTGAAGCTTTGAGGGGCTGAATGTGTGGGTAGCCGGTGGGCTTGA
TGAAAAGAGAACACACTGAGGGTGTGACCTGAAGGGTGCCTCTCCCTTCCTGCCTCCTCC
TCCGTCCCTTCTTCCTGGCTGCCATGACTGGAGCAGCTTTCCTCTCTCACGATGCCACTG
CTGTCTTGGAGCCTGAATACCATGGATTGAAGCTGAGCCAAAGTAAACNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNT
CGATGTTCCCTCTTGTCATCACTTTACTCTTTTGACTTCACCTTTAGGTTTGCTCTTCCC
TGACACTGATTGTGTGTGTGTGTGTGTGTGTGCACACGCGCACGCACGCGCCCATGTGTA
TGTGCATGCTATGACATAGGTAGGAAGGCAACCTTTTCCTTTGGATGCCTAGTTGTCCTA
CTTTTTATTGAAGATTATTTCTACCATTTTGCTGTGCTACTTCTACTATAAGTAAAGTGT
CCAGATGTGAGTGGATCTGTTTATGGTCGTTTCATCCTGTACCATTGTTCAACTTGACTG
TTCTTATATTTATGATCCTTTTTTTTTTTTTTTTTTTGGTACTGGGGATCAAATTCATGA
CCTTGCACTTGCCAGACAGATGCTTAGGCCACTGAGCTAAAGGCCCAGCTTGATCATTTC
TTTATATTCCTTTTATGATAACTTTTTTGGCCAGTTTCATTTCCAAAGTTTTGATTGGTT
TGTTAACTTTCCATTTCCAAAGTTTTGATTGGTTTGTCAGCTTTCCTTGAATACATGTAT
TGGCATTTTAAGATTGGTATAATATTTTTCTGAAGCATTAGATCACTCTGTCAGTAAAAC
CATCTAGACCTTAATTTTCTTTGTGTAAAGCTTATAAGTATGTACTCAGTTTTCTTTTAT
GGATAAATGAGAATATAAATTTTATTTCTTTTTACATCAATTTTGGTAAGTTCTATTTCT
CCATTTCATCAAAAGTGTCTCATTTGTTGGGATGAAATTATTTCATCCTCTACATGTAAA
ATCAATATTGTTTTTTACCATTTTTATAGATGTTATTCAGGGAGGCTATTTCCCCAAGTT
CATATAGTTGTCTAGCAGTCAAAGCTAAAATTTGAACCAAAATCTTATTTGATGCAATAT
TTCTTGCTGTTCATTATATGTGGCTACATGTTCTTTTTCTTTCTTATTTGATTTTTGCTA
AACAACTGTTATTCAAATTGGTGGGCATAGTGATCAATTATATTAGACTATATTAAGATA
ACATTTTATCTTCCCACCTATATTTATTAGATAAACAGAAATGCACAAATTTATGATCAT
ATATTACTCCCTTTAAGGAAAGAATATGTGTATTTTATTTTAATAAAGAATATGTAGAGA
TAGTTTCCAGGAATACAAACAAATCAGAAGGCAATGGTCCAACTGACAGAATTAAGAAAG
AATTCATTGACTACATAGCTTGTAATGTGAAGGTTTTCTTTTTAATGTGCTCACAGATAA
TGTACTATTACACATTTATTTGGTAACACAAAAATTAAAATTAGCACTAATATTTTGTGT
TATTTTTAATCCTCAGTGTGTTTTGTTTTTGGTACTGGGAATTGAACTTTTCATACTTGC
CAGGCAGATGCTGCACCACTGAGCAATATCCCTAGCCCTATATTTTTATTCCTAAAATAT
TTTTTTACTTATTTTATCACTTACTGGGTAGTCATACAAGAGTGAAATTTTATATATCAT
GATACTTTATAAACAATGATTGAAACAGTTTTTCCCCTCAGGTTATTTCATTTTTGGCTG
CAGTTTTGCATAAAAACGGGAACTCGTGAAGATATTGAAAATAACATGCCAGAGTCTACT
ANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNGTTTTTATATTTAAAAGTAGGAGAAAAGATGGAACCATAGGGTAACTATCACAGT
GATAAACTCCAAAGAGCCAAGTATTTAAGTGAACCAAGTAGGACAAGAAAGTACTTGGAC
ACATTTCATAGTAGGGTAGGGAAAAGGAACTCTCACATTCAGTAGATTAATCTTTGTTTT
CTTCTTTCTTTTCAAAACACAGTCATAGATTTGACTTTGTCCTGGTGAAAAAAATGGCTG
AAAAAATAGACGAAATGTTTCTCAGAAAAAAGGGCAGGATTTAGCAGTGTGTTGGAAAAT
TTTCACCATGTTTAATTAGTTCATCTCTGTCCCGTAGGACAAGTATAAAACTTTAGAAAA
CAAACTTACTGTTAACTCTGTTATACATAACAGGTTAGCAGTATTAGTAATAATGAGAAA
TAAAAACATTAAAATGGCAGCAGTTTTCAGGGTTACTACAGAAAATTGTTCAGTGGAACC
CCAAAGAATTCTTACAAAAATTAAATAATTATACTAGTACTTTTAATAAGGACTGTTTTG
TTTGAAGGCTGCATGAGTTAGCTTCTCATTGCTATAACAAAATATCTAGGATAAAAACTT
ATAAGGAGGAGGGTATATTCCTGGTCAGTTGGCCTGCTGCCTTTTCGACCTAGAGTGAGA
TACAGGGAAGCTGCTCACTTCAAGGCTATTACAAAGTGAAAGAGAAGGAGATGCCAGGAA
TCTCCAAGGGTAACACCAAGATACAGCTTCCTTTTACTAGCCCCACCTCTTACAGGTTCT
TCCACCTTCCAGGCATGCCACAGGGTAGAGACCAAGGCCTTAACATACAAACCTTTGGAA
AACATTCAAACTACAGCGGAGGCATTAGGGCAGAAGTCCTACTCGTGAGTTCAAGAGAAC
AGGAAGATAGTCAAAATAATATTGATAACTGATAATTCTTGAGCATCATTGCTATAAAGA
GAGTAGATTAATTGCATGATACCTGGAGAGAGGTACAGAGATGCAGAAGATTATTTTTGT
TGTTTTATTTTGCTTTTTGAATTGTTTGCTTCTTTTAACCCTGGGAAATACTATATTTGC
TTATAAATGGAAGTGGTCCAGTAAAAAGTAAAAGCTATTCAAGACCAGTCTGGGCTACAA
AGTAAGCCCAAGGCCAGCCTGAACTGCATAAAAAAGGGAAAGCTAATCATAAGGACAAGA
TTAGGGACAGTTTCTACAACCTTTATTCTAGGTTTGTAAAGCCTTGGCATCATCCACATG
GTGCTGGTTCTAAGTGTATCCTGAAAGCAAGAGTTGTGGAGTTGGGAAGTGTGGGAGACC
AGATAATAAGAATTGAGGCCTAAATGACCTCTGTGAGCATGAAGGGGAAAGGTGATATTC
AGACATGCTGACATATTGTAGGTTCTAGGTAAGGGTCAACACAGCTGTGAACCAGTTATT
TACCTGGGCATGTACTTCAGATAACAGAAAGAAGATGAATCTTGTGTGCCCTGATTGCTT
GTGTCAAAGTGAATAAAAGCAAGGTTAGCCAGACACTCAGGGCTCTTTGTCCACTGATAA
CAGACTCCTATCTCCCACATTCTAAACTAACTGTGTCCTTTTGTCTTTCACCCTCATCAT
ATCCTGTCCCTGCCTCCCTCAGGGACAAATAGTAAACTCGGTCCCTACTAGGGTGCCTGA
ACAAGTACTTGACTGGGTAAGATTGGGTTCCTATGAGTGGCACCCTAACAGGCACTTAAT
GGGGGTTGATTCCCTACGAGAAAGTCTTCCACCAAGATTTCAGAAGCCGACCTGGGAAGC
CAGAGAGCTTGCCCCTGAGGGACCATTGTGTGAAGCCCAAGGTGCAGTAGAGACCTCAAT
AGTTTGGAGAAGCCAAGAATGTAGATTATTTGATAGAACTTCAGTGAGGGATCTGAGCCA
GCCTAAGAGAGAAGCCATGGGAGCTGTAACTACTCTCAGTGCCATAGGGCGAAGCCACCT
GAGCTCTTGCAAATTCACAGCTTGTCAGAGATTGCCAGGGATGCTGGACATGAAACTGCA
GGACTTAATGCTCGCCCTGGTGGATTTTGGACTTGCTTTGGTCCAGTTCTTTTGTGTCTC
TTTATTGTACCTTATACAATGGTAGTGTTTATCTTGTGCCATTGAATGTTGGAAGTGTTT
ACTTTTCATTTGTATAGGGCCCTGTAGCTAAGAATTTGCCTTAAATCTCAGAGGAGACTT
GGGATCTAGACTTTTAAGCATTGTTGAAATTATTAGGACCTGGCAATGCTTAGAGAAGAA
ATGGACTAAATGGCTTTTGTGTAAAGCGCAGTGTACATGAGTCTTTGGAGAACTGGGGTG
GAATGTGATGGCTTGTAGATGTCCCTTCAAAGCCTCCCCGCAGCTATAGGTAGGGCTTAT
ACAGAGGCAGCTGAATGTAAAGTGTGTGATGCTGGGATGANNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAAGTACTAATT
TGTATTTATTCTTATTAACCACACTATCAGCATCTAAAAATAAGACTGGTAGTTTTCTAG
ATTTCACGTGGTAGTTCTTTTTAATTTCTAAGAATCATCAAAAAATTTTTTTTCTTTTTA
GATGTTTTTAATAGTTGCACCTCTTTCTGTCCTCTACAACTGGAAGGATGAATTGGATAC
CTGGGGATATTTCAGAGTCACTATTGTGCATGGTAACAAAAAAGACAATGAATTGATTCG
TGTAAGGCAAAGGAAATGTGAAATTGCTCTAACAACGTATGAAACGCTGCGCTTATGTCT
GGATGAGCTCAACAGGTAATAAGAATAATGGGAAAGAAACATCAGTATCAAAAGTATCCC
CTATGGTGTGATTTTTAAAGAAAACTTTAAATTGCCTTCAGCTTGATTTCATTTCATTTC
AAATTTATTGAAATATGTAGTTTGTAATAATTTATTCTCTGACAAAAGTCCACATCAGAT
TTTCTACATTTTCTTACTGTGTTAAAATCAGTAGAGGGTAAAACCAGTACAATGCCTGTG
AAAGAATAATAAAACTTTTCCCATAACTCATACACAACCTTTTATGTACATGGTGTCTCT
GGATAGGATAGCAGTTTTATAAAAAATTTGAATTCTGAGTATCTGTTGTGAATATAGAAT
GGCAGAATACACTGTCACTGTAGCCTAGAATGTAAGAAGGATGTAGTTAGACGACAACTC
AATGAGTTACACGTATCATAAGTAGGATTGAAAGTCACCTAGAGTATTTGGTCTCTGTCT
CTAGGGCAGCAGAGTGTTTCTGAAGAGTTTTTAGCAAATTACAAGTGTGATGTAAATGAT
TAGATTTGCGTTTGGTAAGTACCTGTGTACTAGATGGACAGATAGTGGAAAGCTAGGTTG
ATAGAGGTTTATTATGGGCTTAGTTGTGTCCCTTCACCCCCAAATTCATATGCACAGTTC
CCAATCCGAGTACCTCAGAATGTAATCGTATTTCAAGATAGGTCTTTAAAGAGCTAGGTA
AAATGAGGTGGTTTGGATGGGGATGTGATCCCACAGGTCTGCTTATATGAAGATAAACAG
ACACTGAGAATAATTATACACAGAGGAAGGGACCTGTGAGGCCCAACCTGCTTGCACCTG
GATCTGGGATTTCTAGCTTACAGGATTGTAAGAAAATAAAGTTCTGATGTTGTCTAGTGT
GTGGTGTTTTATTTGGTAGTATTAGTGAGTGGGTACCAGGGTTTGTAATAGCCTGGTCAC
GGGGAAATGGTTGTCCAGTCTAAACTATTCATAGTTGTGCTAGCCACAGCTTGAGGCTTG
GTAAAGCCATAAACTTTGATCTGCTATAAGCTTAGATTTCTCCCTAAAAGGATACAACTT
ATACCTAGGGTATCATTGGAAAAAATTACCTAGTAAATCATTGAAGTGCTAAAGTATCAC
AGTTACAATCAGTTTGAATTACTGTCATTGAGAGAGTTAATGGCAGACAACCAGGTAATA
CATTGAAGGTAATCCTTCAAGTTCAGCATAAAGATGCTTTGGTATAACATAAAAATAAAG
AACAACTCTCAGCATGTGTCTCACAGATTTTATAAACTGGAAATATATTTAAGAGTTAAA
AGGTCACTAATTAGCTATGTGGCTTTGGATAAAGCAGCTTATATAGAAAATGATGGAATG
AATAAGATCAGGCTTTTCCAGAACTTGGTGATCAAACCCATTAGAAGAATTTTATTAATC
AACTTGAATAAACTTTAATTTGTAGGCAGTAATATTGATTTTAAGTATAGTTGACTCTTT
ATGATCCTGAGTTATATATCCAGGTATTCAATTTAATGCAGATCAAAAATATTTGTAAAA
ATAAACACATCTGTACTAAACATGTAGGTCCTTTTTTTCTTTCCATTATTCGCTACACCA
CTATAACAACTATTTACATTGCATTTTTCTTAGAGATTAAAGGAAAGAGACACATAGGTC
ATGTGCAAATACCATGACATTTTATATGACTCAGTCATCTGTATATTTTGACCCTGGGTC
AATCATTCTCAGATACTCAGACAACTGTATATGGTTCGCTTATTCTTGATCAGGGATGGG
AAAACATTTTCTGTGAGGAGTCATACAGCTCATATGTTGGGGCCACCAACTGTTCCCTTA
AACTAAGCTGTATTTCATTTTATTTGAGTGTGGGTATTTAGTTTTTGTAGTTTGGGGTTG
CTGTAAATAAAAATTTAAGGGATATTTGTATCTAGTCCTTTTTTGTACTTACATTTTCAT
TTCTCTTGGGTAAATATGTGGGAGTGGAATTTTGGGGTTTTAGGGTAAGCGACTGTTTAA
AGTTTTTGTTGTTGTTGATACCAGAAACCAAAAGCAGGATCTTGTACATGCCAAGCAGAC
GCCTGTACCACTGCGCTTATCCTTGACCCCGCAAAGGTCTAAATTCACAGAAGCAGACAA
GTCTTTTTCCAGAGTGACCGTACCATTTTCCTGACAGCTCGGTTGCTGTGTGTCTTTATC
AGTGTTACTACTGTCAGTCTGTTTTTAGTCATTTTGATGTAACTTGTGTTTTCTGATTTG
TGTAATACTCGATTCTACATATTGAGTATAGTATTCTGTAAATATCAATAAATCTAGTTA
ATTAAGGGTTCCTCAGATGTTCTCTGTATTTACTGATTTTGTATTGGGTTGCTTTACAAT
TTCTAAGAGAGAAGAGTTGAAATAGATTTTTTCTTTTTTCCATTCTGTAGGTTTCAATTC
ATGTATTTTGAAGCTGGGTTACTAGGTACACGTGCATTTATGATTGTGTTTGCCTGATGA
ATTAACTCTTCTATTTAAAAAGATGTATTCCTTTTCATTTCTAGTATTAATTCCTGTCTT
GATGTTTTGTTTAAAAAGTCAACATTACCAATAAAGTCTTATGCATGCTGCATGTGTAAT
CCTTATTTTTATATTTCAGCGTACCTGTTAGTTTTGAAATGGAGCTCTTTGTTGTTGAAT
CTTGCTCTTTTGTTCATTTTGTTTAAGTGTTGGGTTTTTTCCCCCACGGTCCTAGGGATT
GAACCTAGGACCTTGTGCTTACTAGGCAACTGCTCTACCACTGAGTTACATCCCCAGCCC
AATGATAAGCATTGCCTTTATATAAACCAGGGTATTTAGACCATTCACATTGGTAAGGTT
GAATATAGAGCTATCCTTTTTGTCAAGTCTGAGATTTGATATTATACCACTTATAAACCA
ACAAGTTAGCATGTTACTGTTTAATAGATGCTGGCAGAAGACAGTTTAATCTGAGTCAGG
CAGGTTATGTAATTTGTCCAAAACTACACAGTTAAGTCAATGATGGACATGAGATTTAAA
CATTAACCATCTAACTCTAGCCAGTATACTGTACCACCCAAAAGGATGGCTTGCAGTTAG
ACAAATACAATAAATTATTGTAGTACCAGTTATATGTTAATTCTTTTTAAACTATAAGCT
TATTAATGTACATTTTATCTTTAATTTTATAGTACAGTGCTTATTATAAATTTAGCACAT
AATAGTTGCTGAAGATATTTTTTCCAGTGGTTATTTTGTGACTTTTATAAATATTAAACA
AGAATTATATAACCATGAGTCATATATTTTTAAGAGAGAACATTACAAGTTTTTCATATT
TATTTTATCATTTGTTAGCTCAAATGGCATTAATTTGAGATACATGAAATAATTTATATT
TTATGAGGACTAATATTATTTTTGTGAGAGTAATGCTCTGTACATTTATCACAGATGATC
CAGAGAATAAACATACCACATAGGATGGAGTATATATCTTTTTGTTATTACCATTATTCT
TTTTACTTCAACTTATATCAAAGTAATATATGCATAAGATTTAAAGAGACAGATATGATG
AAGGGCTTACAGGGGAAACCAGCTCACTCCATGCTCAGTTTGGGGTTACTACAAATAAAA
TTTTAAGAGATATTTGTATCTAATCCTTTTGTGTACTTATATTTTCACTTCTCAGGTAAA
TATGTGGGTTTGGAATTTTGGGGCATTAGGGTAGGTGAAGGTCCAATTTTTTTTCCTTTG
GTACCAGGAACCAAATTCAGGACCTCACACTGCACTTGCCAGGCAGGTGCTCGTGCTGCT
GAGCTTTACAATAACTTGATCCAAGTGTTTTGTGGAGTGGGAATGGGTGTCTAGGAGCTC
CCTAAACAGACTGTTGTCACTGATTTGTCGCTGTTGAGGTATCTGGTACCACCAGTTTCT
AGCTTTTTCTTTTTTTTTTTTTTTTTGGTCTTTTTTGTTTTTATCGGTACCAGGGATCGA
ACTCACGACTGCCTGCTTGCAAGGCAGGTGCTTATGCTGCTGAGCTAAATCCCAGCCCCA
TTTAGCTCAGAGGCATAAGCGCCTGCCTTGCAAGTTTGTAGCTTTTTAAGAGTTGAATAA
CCAATCAGATTGTTTCTTTGCTTTCTCCTCCGCTGGCAAAGATATCGCCTTCTCCACTTT
TGTAACTCATCTTGTCCATTTTCTTTCCAACTTCTGCAATTTTGTAGCTCTTTTCTCCTT
TTGCTCTTGAAGGCTTCACCTTTTTTCAACTTTAAGAAAATTATAAAACCTGCAGGAAAA
ATGAGATGATATTTTTAAGTCTTTTGATCCCTCAGCCCTTTTACTTAGAAGTATTAGCAT
ATGCAAATTATTCTTGCCAAATTGGTTATATTACTGAGTGTTACAAACGGGGTTTTCCAA
TTTATTATTTTTTCTCTACTTGATGGTGTTCTTTTGTAAAGGAAAGCATGTCATTAATTA
GATTAACTACAAATTTAAAAAGTGAATTCTTGATTCTTTCGTTTTACGAATTTGAATATT
ACTGTAGACATGCTTATGTCATTTGTGTATCTTCAAAAAGACATTTGGAAAATGTCTATT
AAAATCTTGCCTAGTAGGGTGTGGTGGCGCACCCCAGTAATCCCAGCATTCGGGAGGCTG
ACTTAGGAGGATTGTTGTGAGTTTGAGGCCAGCCTGGGCTACAAAGTGCGCTCAAGGCCA
GCCTGAACTGCATAGCAAGACCCTGTCTCAAAAAGACCAAAAAAAGAAAAAATATTTTGC
CTATCTTTTATTTGGTTGTCTTGTATTGCATTGAGATGTGATAGTTCTCTATATATTCCA
TGTAATAGTTCTTTATCTGAGTGTTATATGCAAATATTTTCTCCTATCTGTCCTCTAATG
GTATCAATGGAAGAGAAAGTTTTTAACTTTGATGAAGCTCAACTTTGGCAAAAATATTTT
TATTGGCCATGAGTTTGGTATCATATCTAAGAAGTTTGTGTCTAACCCAGAACCATAAGG
ATTTATTTCTATATTTTGTGAGTGTTGTAATTTTGCCTCATATTTAAATCTCCTATCTGT
GTCAAGTTAACATTTATGTACAGTGTGAGGTAAGGTCTACATTGTTTTTGTGAAGCTCCT
AAAACATTTGTGTGCTCAGTGTTCTACACACAGTGGTAGTCCTTACTCCCAGTGCTGAAG
TGTGTGCACTGAGTTAGTTCCTGCATCCTCTGGATGTGTCCTCATTTGTCTCCAGACACA
TCTGTGCTGTCTCACTCTTCAGTATTTCCCATGCTGCCTGCCCGAAGCCAGCCATTTCTC
TATATTGCTGTGGTACTCTGCATCATTTTAGGAGATGAACCAGTATTGGTGCTGATTGCT
ACTAGGATGACAATTGATACTAAATCTTTGTAGTAAACAGAGTGATGTATGCTAACTTTA
AAAAACATCGTAAGTCTATACTGGTATTTTTTCATTCAGATTTAACATTGCAAAGCTTAC
GTCTTCTTTATTTCTGTCATTGTTACTTTAAAAGTTCCTTTGTTGTTTTTAATGATATTT
AAAGGAGAATTGTTTGATTCTTCTGTATTTAAACATAATCTCTGTACCTGGTATATTCTT
CATACCGCATTATCTGATTGTGGGCTATGATTAGTTAATTTAATTAGATGTAAGAATCAT
CAAGTGAAGAAGGAACAAAGAGCCTGCAAAACTTGCGTAAAGAAAACAGCTCACTTAAAG
CCCATTAGACTGAATTTTATTTTGCCTTTCATTACTCCTTGACAGTGTGGAGTGGTCAGC
CGTCATCGTGGACGAAGCTCACAGAATCATGAATCCAAAGGCAAGAGTGACAGAGGCCAT
GAAAGCTTTGAAGTGTGACATCGGCATCGGCCTCACCGGGACCATCCTCCAGAACAACAT
GAAGGAACTCTGGTGTGTTATGGACTGGTGAGTGAAAGCCCTGGTTTTACTCTTTTTTAA
AATTACTAAATACATACTTCTTTAGCTTAATGCTACCGTGTTTGCTGTTAGTTTCTGAAA
ACAAAAACAGCAATGATCATTTAACTGTTTGCAGAAAGACTTGTTACCAAGTATACCAAA
TCTTGATGGTATTTGTTATCAAGTATACCAAATACTTGATGATATTACCAAGTAGACAGT
CCCATGAAAACCTGTCTTCATGTTAGTTTGGTTTCTGAAGTAAATCAGAAGATGCCAATT
CCATCATCATCTTTATTTATAGCTTAACTCATAGAGAAAAAAATTCTGTTTTCTTGACTT
TTGATTTTGCTCTTAATAAACAGGTGACTTGGGTATATTTCTTAGAAGATAAATGAATGT
TTTTCTTTTTAGGTAACCTATTAAACTCTCAATTTTTCTATCTGCCTTTATAAAGGGCTG
TGCCAGGACTTTTAGGTAGCAGGATCCACTTTCAGAAGCAGTTTTCGGACCCCGTAGAAC
ATGGTCAGAAGCACACAGCGACAAAGAGAGAACTGGCCACTGGCCGGAGGGCCATGCGCA
GACTTGCAGCACGAATGTCTGGCTGTCTCCTCCGGCGCACCAAGGCGCTCATCAGTGGTC
AGTTGCCCAAGAAGGAAGATCGGGTAAGAGCTGCGTTTGTGTGTGTAATCAATTTTTGTC
ACATTTTATTATTTCTTCTTGAAAAATTCCTTTTTAAGAGAAAGTCTGTATCTGGTATTT
TGTACTGTAATTTTGTGTTGTTATTTTTGTGGAAAAAGTTTGTTATCTGCAAAATTTCAG
GAAACGTTGTTAGCCCAGTTGTTTTCCTAACTTTACTGATCTGTTGGCTACTGATCTGTT
GACAGATTTATTGTTAGTGTATGTGTTAGTCAGCTTTCTGTTGCTGTAACAAATGCTTAA
TTCTTAATATCTTAATGAACAATTAATATCTAACTCAACTTAAAAAGATTTCTTTTGGCT
CTTGGTATATGACGTTTTGGTCTGTAGTCTCTTGGCTGTGTTACTCACTGGGCCCATCCT
TCAGGAAACATGAAGCTGCTCTGGTGTGTTATGGGCTGGTGAGTGAAAACCCTGCCTGCG
ATGGGCAGTGCGGCTTGGTCGGGAGCAGCCAGGCAGAAAAGACACAGGAGGGGCTAGATT
CCCAAAGTCTCCCTTAAGAGCCGGGCCTCACTGACCTTCCTTCGAGGAGGCTTTCCTCCT
GAAAGTTCTGCTGCTTCCCAGCAGTGCCCCAGGCCGGGGCCAGGCCTTTGGTGTGTGACC
CTTTGTAGGTGCATTTAAGATCCAAACCACAGCATACATTAGACTCATTTCTTAAAACTT
TTGGTATAGTTATTCCTCAAGGAAGTAGGAAAAACTTCTGTCCTTAGTGTGTTTTCTGTT
TCACTTTGTCCTTTCTGTATGGTCTGCCCTCTGTGACCCGTTATGTGTAGCCATAAATCT
AGTTGTAGGACCAAAGGGATTAAGAGCTTGAGTTTTAGATTTGTTTTACTAACAGTGATA
TTTACAGTTATAAAACTAACTTAAGTTTTTGAATTTTGTGAAAAAGCTGATTAATTGCTT
AAGAAAATTTGGGTTAACTTTAATAGAATTTTAAAAATAGTTTTCTTTAATAGTGAATTT
TAAAAATTAATTTATTTATGCAGATCAAACTCAGGGCTTCATGCATGATAGGCAGTCACT
TGACCTGAGCCTCATTCCTAATTTTTCTTTCCTAGTTTTAAATTTTGTGATTTTTCTTGA
TAATGCAATGGAATAATGGTTCTATAAAGTGCTGTGAGTGAATCTAATTAAGGTTGCCCC
AAGTAAAGGTAATCCTATCAAATGTCTTCTAATGTAGGATATTTTGTGGATTATTACTTT
AAAAAGAGATTTGATATAAATACACAAGTTAGGGAAATTGATAGTATATATGACATTTGA
TATTTAAAGCAAATACTGTATTGAGATAGTTCATGAATACATACTTTCATAAAGTGTTTT
GCACAGTTATGTGTATATTATTTGCTAATGTGGGAACAATAAAAATATGAATATATGAAG
AAAATTATGCATAGCATTTTAAAACATGGGCTTTGAAATCAAATACTATGAGTTTGAATC
CTGACTTCTCTACTTAAAAGTTTTGTAACTTGAAGCAGTTTGCTGACTGTCAAACAGATA
CTTTGACTTGTTAAATGGAAATGATTTACCTTGCTTGACTGCTCTGAAATGCATGATGCA
AGAGAGATGTTTAGTAAATGTTAAAATGTTTAATAATAGCAATTCAAAACTCCCTACGTT
AATCAGTGATACCATGTTACACTGTTTCTTTTTGTTCTGATATGTACTTTTATATTCAAG
ATTGAGATTCAAGATAGTATATTTTATTTATGCATGTTTAAATCTAGTATCATTTTAGGT
AGACATCCTTAGATTTGTTCAGTGCACATTTGTCATTTTTTGCAGTAATATTCTTTGTAG
TGGCATATAAATACTTACAAGTAGATGATTTTTATTTCTTGTTCGGATTCTTGAAAGCCC
TACCATGGGTGTGTTTAGTTTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNCACATTACAAATAGTTGTATTAATAATTTATAGTATTATGGCACTTGAGTATGTTTT
TGTCTTAACTTGGTGGACTAAAAACTTACTGAACAGGTGCAAAACATAAAACCTCTTTTG
CAACCCAGAACTCATTGTTCAGTATGAGTTTTGATACATATAAGAAGGAATATTATTGAG
AAAAAATAATTTGTAGTATTATGAAAAATACAAAATAGATTGTATAATAATTTAGTTGTA
TTGCTCTATCAAATTTCTTATTTTGAATTTAGACATAAAATACCTGCTTGTGCTTTTATG
TATACTTTATTAATCATTATCTTTATTAATCTTGAAAATTTATAGCAAGATATTAAATAT
AGATAACTGTATTTTTAGTTTGCAATAATCAAGGAGTTTTCCAGCTATTTCAGTAAGCAT
TTATTATTCATAGCATTATTCTGAAGTATTGTCTTTTTCCTTATCAATTTTTTATCTTAA
ACTTTAATCATTTATTTGCATGATGGACTAATAGAACCTTATGAAGACCCAGAGCATATT
GAGAAATGAAAAAGGACACAATTAACTTTCTAAATATTTTCTTTTGATTAAAAACAAAGT
ATGATTTTATTTGAAAATTAAATTATAAGTTGTGTAGCCTACAGTGAAGTAGAAAGCAAA
AAAAAAAAAAGGAGATAATTGGGAAAAATTATCATAATATAACTAGAGGGAAAATAGTTT
ATGAACAATTCTCACTATTACAGTCTATTAAATCCTATGTACATTGTATTATTCTTATTG
CAACAAAACATACTAGTGATTGCCTTGTATTTTATCTTGCCAGATGGTTTATTGTTCTCT
GACAGACTTCCAGAAAGCTGTCTACCAAACAGTGTTAGAAACAGAAGATGTGACTTTGAT
CCTTCAATCTTCTAAGCCTTGTACCTGTAACAGTGGCCGGAAAAGGAGAAACTGTTGTTA
TAAGGCAAGTGTTTCAGTTTATCTTTGCCATCTTGCTTTTGGCAAAGAAGCACTTTAACT
TTAAAAGCTATAAATTTCTAAAAAGAATAGTTTTTTAAAAACTCTTTACAGTATTAAATA
GCAACCACATACAAATTTTGTGTTCAAATATAGCTTCAGAAATTAATTTTTGTAGTTAAA
CTTCAAATTGATATATTCTCTTTTAGCTTTTATTGGGGAGTACCCTACTTGTATCGTGAA
ATTTCATTTTCGGGGATTTGGCCCTTCTGTACTAGTAGTAAAATAACTCACTCTTGCATT
GTAAGCTGTGATACCGACAGATATACTGCAGTTTAACAGGTGCTGTTACCAATAGAGAAA
GTTTAGAAACAAAGTTCACTTATACTTTTCTACTTTCTGTTTTCTGCTCTTTTGTTTCAC
CTGTTTCATGTCACATACCCAGGTATATATAGGGATCCAGTAGATAGATTTTATTTCACC
TCATTTATTCTACTGTGATTAGCCACTTCCCAGTTTTATAATAGCCCCGTTTCCTATAAA
AACTAGTACAGAGAGAGGAGTCCTTTTAGCATTGCCACTGCATCATATTCTGTCACCAAT
AACCATGTAGTGGCAGCATTTCCATTACAGTGCACCATCAGGATCAACACATTCCAGAAT
GAGGACCTTGTCTCCACTGTTATTAAAAATAACACTGTCCAGTGATTCACCAAAAATGAT
TCCACATTTGTGACTCAGATACTTTGTGTAAATGGTTGACTGTCATTTTCTTAGGCTTTA
TTTGGCTCAAAGTAAGAACTGTTATTATAAGTGGTATATGTCATGATGAAAACAATAATA
TAGCCTTCTCTTATTTTTTCTTCGGTTACAGACTAATTCACATGGCGAAGCTGTGAAAGC
CTTGTATTTCAGCTACCTTGCAGTCCTTCAGAAGGTGGCAAACCATGTTGCGCTGCTGCA
GGCTGCCAGCACCTCCAGACACCAGGTGTGGACTGGCTTTCCACATTTCTTTGTGAGGCT
GCTGGTGTATAAATGATACTTGCTGTAAAAATTTTTAGTTAAGTATCTTGGAGGTTTATG
TATTAAATTTAAGAGAAACTGACTTGTTAATTTAAAAAATTTAAATCTCTGAGGCCTGGA
GGATGTAGCTTAATTGTTAGGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGCCTTCTGATGAGTTTT
GTTCTTCCTTGAAAATCGGATAGCTACTCTGGTGTGTAAAATGTGTCTCGTGTACAACAT
TCTGTTCTTTTTACTTTTTTGATCTAGTCTGCCACTCTGTGTTTTCTGATTGTGGAATTG
AGACACTTAGAATTATTCCTGAAGGTATTGACTTACTCCTGTCAATTACTGGACTATTTT
TCTGTTGTCAATTTCTTTGTTTTTCCTTTTTGCTTAACTGCTTTCCTTCCTTGTTTTATT
ATTCCATTAGACTTTTTGGAATCATTGGCTTCATTTCTTTTTGTGTAGGAAAGCCTTGAA
AATTTTTTGGAGAACTGGTTTAGTAGTCATGAGTTTCTTAAGATGTTTTTTGTCATAGAA
GGATAGCCTTTACGATGTGCATTTAGAAGTTTGCTATAATTCTAATGGATTGTAAATGAT
TTCCTGCTTTTCTCTATTCCTTTTGAGATTCTGGCCTTGTGTTGGAATTCTGGAATTTTG
GCTACAATGTGTCATGGAGAAGTTCTTTTCTGCTTGTGGATATTTGGGGTTTTATATGCC
TCACTTGAATGTATGCTGAGTTCCTTCTTCATACTTGAAGAAAAGTTTTCTGCTATGATT
TTTGTGAACAAATTTTATGCCATTTGTGCTATCTTCTTTAATTAGGAACAGTTAGTCTTA
GGTTACTATTTGCATCCTCTAGAAGCCATTGGGCCCATTTTCTTTGTTCTATTTTTGTTT
TTGAGATATGTCTGAGTATATGCTCATATGCGTCAGACCTGTCTTTTCTAGTTTTGACAT
TTTCTTTTCATTTTGATCATTTTTCCACCCTTACTTTCAATAGAATTCTTCATCTCCTGC
ATTTCTTTTTGGTACCTTTTCATGGACTCTTTAATTCTTTGNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNGGAGCGTTGGGAATTTTGGGGGGGCATGTGTTGTCTTGT
TTCCTCATAGGTTGGTGTGTGCATGTGTGTTGAGGACAGGGGATCAATTAGAATGGAGCA
ATTCTCGTAGTAGTATGGTATCTTTCATTAATGTCTCTTTCTAGTGATGTGATCTTGCTT
TTTGGTGTTTATTTACCTTTTTGCCTTTTTCAGTTTGGAAGGATCAGGCCAGGTTACTAT
TTCATAAGAGAAATTCCTATCTGTTGTGTCAGTTTCAACAGATCTAGCTGCACATTCTCA
TGTACATTGAAAATTACTTTAACAATTTCACCCTTATATATATCATAGTATACTACTACT
GACAGGTAGACTGAGATATGGGTGGAAGGAGGAGAGGGAAGAGGAGAAGGCAGGGGGTCA
ATCAGATAAAACAGAAAGAACAATGACAGTGATTAGAGGAAGAGGTAGACAAACACCAAC
ACCACTCGGAGTGAAGAGCATATCACTGTGATATTATATTTTTTTTTTTATTTTGAGCAG
AGGGCTGGTATAGAGGAGGTTTAAATGAATATTTGTGAGAGCAGAAGAAAAGATACAGGG
AAAGGAAGTGTAATCGGAGACTGAGGGAAGCTATGAGAAAATCTGAGCCAGCTAAATGCT
GATAGTTACCTTGTGTTTGGATCCTTTATGCACATTTCTGGTGAAGGTTACCCTGCTTTG
CTCAAGTTAATTCTCACTCCCCTTCTCTCATCTACAGACACCTCCCACATACATGTGACA
TTAGGACTCCAGTTGAGCATGCCCATAGCTCATTCTCTAGCTCAACAGAGCCCATATCCT
GCTCACCCTTTTTGCCCCCTGCCAAGTTGTCACCTTTCTGTTTACAAACTCAGTGGTGTC
TAGGGCTGTCTGGTTCTCAGTGACAGGAGAATCAGTCCACAGCTACTTGCCCGCAGTACA
ATACTATTACTATGGAATATTTGAAAATATCTCGGATTACAAGTGATGTATTGTATCATC
TCAAACAACAAAAGTAGCTTTCTGTGCAGTATATCCTTGGTTTAATATGCTATTGTCTTC
AGAGAAATGAAAAGACAAGCCCCAGACCAGGAGAAAAGATTGATAAAATAAGTTTGGTAT
CAAAATAATTGGTAAAATATATAAAGAACTGTTACAACCAGCAGTAAGAACACAGCAAAA
TTTAAAAGTGGACAAAAGATCTGAACAGATTTCTCATCAAAAAATAAATATAGATGACAA
AGAAGCACATGAAAAGATGTTCAATGTAATATGACATTAAGTAATTTCAAAATAAAATAC
AGAATACTGCTGTACACCTATTGGAATGGCCAAAAGCCAGCACATTCAGAACACTGGCCG
CACAAAATGGAGGTGAGGATGTGGAGACACAGGCACGCTCATTCATTCCTGGTGAGAATG
CAAGAGGGGCACCTTAGTAGACAGTTTTGGTAGCTTCTCCTCAAAATATTCTCATCAAAG
AATATTTAATGCAGAAGAAATTTCAAGACAGTCTGATGTTGAGGTGATAGCATGACTACT
ACTGTTAGTAGCTTTTAGCCAGGTGTGTTGAGATTCAAGAGCAGAGAGCCCAGCAGAATT
ATTTAAAATGTTTTGAGTTTGGCCAGAAAGGAAGGTCCAGGAAAGCTGTGGACTGTAAAG
ATAGAACAGAGTACTTGGGAGCTGAGAAGGAACAGAACAATAGAAAAGGTAGTGTGAGGA
TATGAGAACCAACAGAACTCCACCCTATGCAGCTTCACATTTGCAGAAGTGAAAGACTTC
ACTTTGAGAAGAGATTCCCAGAGGACTATGTTGCAGAATGGTGGAAACCTAGAGATTTTG
TTCCTTGAGATTGAGTTCAGAGTGCTCAGCAGTCAAGCACTAGAACCTACAACCAAGAGA
GAGAGAAGCCTAGGTACTGCTCCAACAGGCATCAGACCTTGGTGTCATTGACATGGTGCT
AATTTTAGGGGTATGCAGAACGCAAAAATTATGGGGGTCAGGATGGCTGCTGCCCAAATT
CCAGAAGGAGACCTGGGAGGCCAGAGGTTGTGCTCCTGAGAGGGCATTTTGTGAAGCTGT
GAGTGTGAAGCCCAAGGGACAGTGGGAACCTCAGAAGATTGGAGAAAGCAGGAATCTGGG
ATCATCTGAGGAAAGCAGCCAAGAGTGAGCAGAGCCAGCCTAAGCGAGAAACCATGGAAC
TACCATCATTCGCAGTACCATAGGGTGGGAACACTGAAGCCCTTTGGAGTTCATAACTTG
CCACAGATTGCCAGGGATGCTGGACATGAGGAACTGCAGGATTTAATGCTCACCCTGTGG
ATTTTAGAATGACATTGGTCCCATTCCTTTGTATCTCCATATTTATTTGTATGCTTTGGA
GTGGTAATGTTTATCTTGTGCCCTTGAATGTTGGCAGTCTTTAACTTTATTTTCTGTTGT
GCAGGGGCTTGCAGCTAAGATATTGACTTAAATATCAGAGGAGACTTTGGCCTTGGACTT
TTCAGCAGTGCTGAAACTATCAGGACATGGGCAACTCTGAGAGATGGGATGGACTAAATG
CCTTTTGCATAAAAGGATGCAATGAGGCTTGGGGGAGGGCAGAGCCAGAATGTTACGGTT
TGTGTCCTCCTGAAGCCTTGTGAATTCATAGGTGTAACTTTTTAGGAGTTCCAGGATGTG
TGAAGCTGGGATTAAGGGTGTGGTGCTAGCATGCAGGGCGTGTGATTACTAAATTAAGTC
CACTGATTGGTTTGACATAATTCTAGGTGTGGATAAGGGGAAGCCTGCCCCTACCCCATG
TGAGTACTACTCACCCTAAGTACCTGTGGCCTGGGTAGAATTTAAGGGACAATAGAGACC
TGTGGTCATTGATGCTACTTCATTGCTTTCCTGACTTCTGCCAGCCAGGAACTATTTCTG
CTCTGCCATCCCATCCTGCCTCACAGCCAGCCAACTACTGACCCAAACCTCTACAAATTG
AGCCAAACCATTCCTCTTTTAACTTTGGGTGTTGGGATTTTATCTCAGAAGCTAGAAAAG
TAACCAAGTCCCTTAGCAATAAGAAGATTGAGGATCACACTGTGATAAGAATGGAGAAAT
CTTCAATGCATATTGCTAAATGAAGAAGCCAGTCTCAAAAGGCTACATGTTGTGCAATTT
TAACTAGATGACCCAGGAAAAGGATAAATTATGGAGTCAATATAAAGATCGGTGGCTTCT
GAGGTTCTGGGGGAAGCAGGATGAATAGTATAGCACAGAAATGTTGTAGGACAGTGAAAC
TTTTCTGTATAGTACCACAATTATGAATGCGTGTCATGATATAGTTGTTGAAACCCTGAG
AACTGTATGACACAGGAGTGAGCCCTATTGTGAATTCTAGACTGTACTTAATCATAATGT
ACAAATAGTTATCAAATTTTATTATTATAAAATAAGTGATTCTTTTTCTAATATTAATTT
TATTGTATAGATATTAATAGGAGAAAGGGGCAGGAGTGAGGTAGGAGAGGAAATATATAT
GGAACTTTTCTGTAGTTTCTACTCAGTTATTTAAAGTCTCATCAATGTAAAAGTTACTGC
CTTTTTTTTTTTTCGGTACCAGGGATTGAACTCATGACCTCACACTTGCCAGGCAGGTGC
TTATGCCTCGGAGCTAAATCCCCAGCTAAAAGTTTCTGTCTTAAGTGAAATTCACATTCA
TATACTTTACTGAACCAGTTGTTGTGGCTTGTGTCTACTTGTCATAGGTAGTGCTTTTTC
AGAGGTTACTGGATCTAAAATGTGTGACACTGGGGTAGCCTAGATAGAACATGAAAGGGG
CAGAGAGGAGTTGCTGCTGTCGCTTGCTTGCCTTTGCTGTCTTCTGCCTGTGAAAAACTG
TTTTATTTCTCCTCTGTGATGCCCTTCTGCCATGCTGCCCTGTCTTGCAGCAAGATGACT
ATGGACCGAAACCTCTACAAACTCTAAGCCAAAACACCTTTCCTCCTTTAACTTTGAGTG
CCAGGTATTTTGTCTCAGCAACAACAAAAGTAACTAAAACACCAGTTATTTCATTGAAAT
GTAAAAGTAAATGCAAATAAACCTTATATGTTATATTAACATGTTGACCTGAGTTGTGAT
GGTTCCATTTGCCATTTGATTGCTTACCTAAACAAATTCAAAAAACTCCCTAGCTTTTTT
TGAGGGATTGAGAGTAAGAATCCAGCTTAGCATGAGGTCTTCACTTGCTCAACTGTTAAG
AAAGAGTGTTATATTGGGTATAAACTTTTATTTGGAAGTTTAAATGTTTAAACCAAGCAT
GGCGGCATACATTTTTAGTTCCAGAACTTGGGAGGTTGAGGTGGGAGGCTCACCAAGAGT
TCAAGGCCCGCCTGGACTGCATAGTGAGTTCAGGGCCAGCCTAGACTGCATACTGAGACC
CTGTCTTAGAAAAGCAAGTTTAAATGTTTATCATTGATTAAATAAGATTGCTTAAGTGAT
CTTTTCATTTAGACTTAGTACAGAAAATTCCTTTTCTTCTTTGTGGATTGCTTTTCTACC
ATGTTCTGGAGCTGTCATTGCCAGATGTGGAAATGGCTGTTTAAAAATAACAGTATTTCT
GTTATATACAAGGCTTGGACTGTTTGCTTCCTTTCTAATAGCACTGTGTGTGGGGCCAAG
TTACTGACATTTTGAGGTCAAAATCCAATCTGGAAGGCAGGGCTTACTATAAATATAGAA
ACAAAGGGGAGAAAATGAGAAAAGGTATATATCTGACTGATTATTCCAAAAAAAGTAAAT
ATCAGGACTTTTAGAGCATAGATGTAATTGAACTCACTTTATTACATTTATCCAGAGACA
ACTTAAATACTTCCTAAAAGGTATGCTGCTTAACATATTATAGATATAAAGAAAATGTAC
TTTGGAAATTAATTAATCTATTTAAATACACCTCGTTTTGCTAAAATCAGACGAGGTAAA
ATAAAGTCTTTAGGAACTTTACTTTCTTATTGATAATATGATATTGAATAACATTTAATG
TAATACCTAATGCTTTATTTCTCTAACTTGGAAAAACTAAAAGGAATTAGTGAAGGCGAC
TACAGTTAGCATTATAACAAATAATTTTTAAGAAATTCTCAAGCTGGGTGCATTAGCTCA
GTGGCATAAGTGCCTGCCTGGCAAGCACAAGGTCATGAGTTTGATCCCTGGTACCAAAAA
AAAAAAACTCAAGTGATATTTATATGTATGAAGCACACTTTTAATTGGAACAGGTTCACT
GATGATCTGTGCTTCATTTCCAGGTTCTTCAGCAGCTTTTAAATCATTTCAGGAAAAACA
AAGATAAGGTTCTTCTCTTCTCCTTTTCCACCAAGGTGAGTTTCATCTGAGTGCATTCTT
CACTGATCAGCCCTGACTCCTGAGGCATAGATCAGAAAGGACAAAGTGACCGACAGCCAC
ATTTTGTCTTAACCACATGATAGTAAGTGGCAATGAGGTTAGCGACTCAGAATTTTCAAG
CAGACACTTACATATCGGTTAGCTCAGAGGGTTACTGTCGAGTAGCAAAGAAAGACTTTT
TTGGTTGATTTTCTTGTTAATACTTAAGGTCCTCTGTAGAACATTTAAAATATTTTAGGG
GATTAAGAAAATAGCCTGAGTAGTAAAATGCATTCTTACAAATGACTTGACCAGTAATTT
TCTTTTTACTTAGTTGAAGTTTTTATTTTTATTTTTTTTTAAATCAAAAGTTTTTAAATT
TTAAAGCAAGTTTCAGAATGATGAAGAGAAACAGTGGGTCAGCAGTATGAAAAATACTTA
TTTTTTGTGGTGCCCGTGATCACACCAGTAATCACCTGTGCGTGGTAGCCAAGTGGTCTA
CTTGAGGCACAGCCCCAGCCCCCAAATACTTGATTGCTCATGGAATTTTAAGAAAGCAAT
CATGAGCACCACTAATGAATGTTGGCAAATCCAATCTCTGTTACGGAATGAAGCTTACGG
ACTTATAGGAATGTGTCTGCCTGCCCCGCTGCCTGCCTTCCAGCTGCTCGATGTGCTGCA
GCAGTACTGCATGGCGTCCGGGCTTGACTACCGGCGGCTGGACGGAAGTACGAAGTCGGA
GGAAAGACTCCGGATTGTGAAAGAGTTCAACAGTACGCAAGACGTGAACATTTGCCTTGT
CTCAACGATGTAAGAAAATCAGTCTCGATAGCTTGATTTGTATCTAGTTGTGTTTAAGAT
TTAGAGTAATTTTAGAGCTGTTCTGGATTAATTTCGGTGGATATGCTTCTGCTAGTTTTA
TTTGACTTAGGGGAGGCAGCCAAAACGCTATTAATTATAACTGAAATACAGTATCTTGAG
TCTCATGTAATGTTTTTCCTCATTTCCTTTATCACTGAATTCCCTTTATATTAAATATAG
GTTTATAAAGATAACAGTTTTTTAAAAATGGAGGCAACCTCCCATATTTCTGGAGTAGTG
TTGGGACACATCTTGTCAGGCTTCTTTTTCTGCTGGTTGTTGGGCGTCGCTGCAGCAGCA
GCTTGTGGGAGCTCGAGGAACTCGGCCTCCGCCTTCACTGTGTCTTCACGGGGTAGCGCC
ACTGATAGGCATTTTACAAAGGCAAACAAGGGTTAGCACCTATTTATGAATCTCTAATTC
AAATTTTGTAAAGAAAATACCCATTGGAGGAAGATTTAAATTAATATAAATACTTAAGTT
ATAGGAACCCCTTTGAGGAGTAATAAACCCCTAATTTTTCATATAAGAATGTTACAGATT
TATTCCCACTGTCTTTCAAAAAGAATTTCAAGAGACTTTAAAAATAAACATGTAAAATAC
ATGAAGAAAAGCAGAATAAAAATTGGCTTAAAATGAGAATTAAGATATATTTGTACTGAG
ATTCTGCTGTGGACCACTAAAATTATTCATCATTCCCACAACAAAATCAAAAGAAGAGAA
GGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTTACTGGTTCTTTGGTTGA
AGTTCCAGAATGACCAATATCAGAGTAGCTGCAGAGGAAATAGGTTGGTTTCTGATCAGT
AGGAACTTAAGACTTTAGAATTTTCAAACGGGACCATTATACTTGGGGTTTTTACTGTAA
GTTTAAAACTATTTTATATAAAGTGGGAATGAATTCAAAGTCCTAGGGAAGGGATCACAG
GAGACCAGTGTAATACCTGTAAGTCAGTGTAAGAACAGTTTGACATAAGACAGTAGAGAA
TGGACTCATAGATAAACATTTTCCAGATAAACTTGGCGGGATTTAATATTGATTGACTCA
TAGAGAAAGGGGAGTAGTGATGGAGAAGAAAAAATGATACCTAGAATGGCTTTCATTTTG
ATGAGTGAGTGTGTAGGTAGCAACCTAGGGAAAAGTATATGGAGAAAGCAACCCTCTGAG
GCCAGAAAAGTATAAGAGGGAGCTCACTGCAAAATCAGCATTGATGGCAGCTTGTTCTCT
GCTTAGTGGAAACAGAGAACATGTGGCATTTTTTTTGCAGTAGGTAAAGTAATTCCTTCA
AGTTATTTACCCCCGATATTGTATTAGGTATTCTGTGACATGCTTTTTGACATGAATTTT
AGAATGTACAAAAATAACTTTGTCATAATCTTGATAGGAATTTTATCATAGCTCAGTCTG
GGAAAATTGACATCGTTATGTTGATCCTTCCAATCCATAAGCATGTGGATCTTCCACTTC
AGATCTGCATTGATCTCTTTAATCAACATTTTGTGATTTTCAACCTACAAATGCTGTATG
TATTTTGCTTCCTTTATATTATATTTAAGCATTTCATTTTCTTTTGTGTGGTTGNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCATTTTGTGATTTTCAACCTACAAAT
GCTGTATGTATTTTCGCTTCCTTTATATTATATTTAAGCATTTCATTTTCTTTTGTGTGG
TTGTAAATGGTATTGCTTTCAATTTTTGGTTTTCCATTTTTTAATCCAAAAATCTGAAGC
ACAAATGCTCCAGAATCTAGTATGATATTACAAGTAGAAAATTCCAGTCCTGATTTCATG
TGACAGATTGCAGTCAAAACACAATATACAACATCTAGTTTATTTAACATGAGGGGAAAA
AAAACCCTTAGCCCCTTTAGCAAGCAAATCATGGACAAACTTGGCTTCATGTACAAAATT
ATAAAATGTAATGTATACCATTACTTTCAAGCTCTTTGTAAAGTAGTTTTGAAACATAAA
TGAATTCATGGTTTAGACTTGGCTTCCATCCCCAGAATATCTTCTAATGTGCAAATAGTC
AAAAGTCTGAAAAACTCCTAAGTTTATAATAGTTCTGGCCCCAAGTGCTTTGGATAAGGA
ATATTCAATCTGACCATACAAAAACTGGGCAGGGGGAGTGGTTAGATTAATCATGTACCT
TCTTGCATTTCTGGGATTACCTATTTCTAGCAAGTTTTTTCCCCTAGATTCTTTGAGACT
TTCTATATAGATGTTCCTCCTCAAGTAATTTTCCTGCCTGATTTGCTTATCTGTTTCTTC
TCATCTGCTGCAGCAGTTAGAACTAGTGGTGTTAAAGAACGATGAGCAGGAACATAGCGC
TTTCCTCTCCAGATTTAAGGTGTACAGCCCTTTACTGCTAACTGTGGTGCTAGCTATGGC
TTTCTTGGGAATGTTCTTTGTTGAACTGAGGAATTTCTAACTTCCTGAGAGTTTTAAATT
ATGAATTGGTACTGGATTTCATCAACTACTTTCTCTGCATCCATTGATGTGAGCTGGCTT
TTCTTCTTTAGCCTATCAATATAGATTACATTCATTGGGTTCAGATCTTGAACCTGCCCT
GAATTTTTGCAATAAATACTAATCAGCAGTGGTATACAATTATTTTTATGTATTTTTAGA
TTTATTGATACTTTCTTTAGGATTTTTCAAAATTTAAATTCATGCAAATCCTGATGGAAA
GTTTTCTTCACTCCCCCTCCCTTTTTTTTTTTTTTAATTGTTGGCTTTGGTAAGTGGAAC
AGGGTGGTACTAGCTTTATACAGTGAATGTTAATTGTTCTTTTTTTATTTTTGTGGATAT
AGAGTTTGTGATAAATGATATTGCACTGAGCATTATGGCATATGCCTATAATCTTATCAC
TCAGGAGGCTGAGGCAGGAGGATAGCAAATTCAGTAGTAGCCTGGGTAACTGAGTAAGAC
CCTACCTTAGAATGATATTTGGAAAGGGTTGGAGATTTCCCTCAGCTGTACAGTGCTTGA
CTAGCGTATATGAGGCTCTGGGTTCGATCACTGGTCCCACAAAAAACTGATGCACATTTT
TTGGTAAATGATAAAATTCTCCAGTGAAACTATCAGGCTTGGATTACTTTTTCCCCTATG
ATCATTTTAAATGCTTATTTAATTTTCTTAGTTGCTACAAGACTATTCAAGTCTTTTTTT
TTTATTTAGTTGGGTTTAATACTTTGTAGTTTTTGAGATATTAGTCCATTTTTAATTTGT
TGAATTTATGAAGATCAAATGGTGCATGGTGTTCACCTACCCTTTTAGGAGTTGCAGAAT
GGCTGGTGATAGCTCCTGTTCTATTCCTGATATTGATAATTGGTGTATTCTGTCTATCTG
TGACATTCTTTATAAAAGTTAATAAAGATTGTGCTTTTCATTTCCTTTTTTTTCTCTTAT
TGTTTTATTATGCTTGGTTGTATTTATTTCTGCTGTTAACTCTTAACTATTTGCTGAGTT
TTTGCCTTTTTCTACATTCTATATAGGTCTTCTTTATTATTGATTTGGGCTTCACTCTTT
TTAAAATGTAATTTATTTATGGGCATCAACCCTTTTTTGGGGAGCTTCTTTTTATCCTGT
GACTGTGGATAATGCCTGCTTCTTANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNAGGAGGAGTCAGTGTGGGAGGCCAATGTCTTCCACCTTTACAGTTCTTCGTGTCC
AGTTGTGCATAATGTTTAAGGGGTTTGGGCTGCCATGGGGGGAATAGTTTATGTCCTTCT
GGTCCCTGGACCGGATTTTTAAACACATTTCAGTAAATCTTTGATTCATGAAACACTTGT
GTTTGTAAATAATTCGGTTCACAAAACAAAAAGCGTTTGGCAAAATTTTGCTCCATTCGC
AAACTTTCCCATTGAATGACAAGCATGACCATGGCCATCTTCCCGACACAAACACAAACG
CAGCTGTCTTTCCCAGAATCATAAAACAAATTAGTTTGTAAACCTAAGTACCACTCTGTT
ATTTTATGTAAATAAAACTTTTTTTAAATTATGTAGGGAAAGCTTACAGGAATAGTACTT
GAGTGTCCAAAACTTGTAGCAAGCACAGCCTATTTGCATCAGTTCAAATGATCATCTCTT
TCAAGGATTTTCTAGAATAGTAGAAAAAGAATATGCCATAGGTATCTTATTTGAGTGGTT
TAATCATCCTGCTTTTATGATGTTAATGTATGATTTACTGTTTTGTCTGCAGAAACTTGG
CACAGTTTAGCTCTAGTGCAACAGTTGATGCTTTTTTAATGAGCTCTTTTCTGTTTCTTC
CAGGGCTGGTGGACTAGGCCTCAATTTTGTTGGTGCCAATGTTGTTATCTTATTTGATCC
TACTTGGAATCCAGCCAATGATCTTCAAGCTATTGACAGGTATAATGCTGGCAAAATTTA
AAATGATCTGCAAATTCTTTTAATTTAAAAATACTCCTTAACTTTTTAGGTTGCTTATAG
CAGGGTTATACTAAAGGAGCAGAAGCTTCTGTGTAAGATAACCCTGATCCTCTATCGTCC
AATAACAGAACAGTAACAGCTATTTATTTTGTCATTCTCAAATCTATTAATATGACAGAA
ATGACTAAAGAAGAAAAAACAAATCCATAACACTAATGTAAAATAGTACAGTTCATTGCT
GGCTGATCAGACATTTTGAGAAACTCCTTAAAGATAGAATGCAAAGATCAAGAAATCAAC
AGAGAAAAGCTGCAATCCGGGAAAGTGTGCAGGGAAGACAGAGAGATTCTCACCTGAGAA
ACAGACCATAGTGTGCCCTTGTGGAAGTTAATTAATTAATGTAACTTCCCTTTCATGCTT
TATATTTACAGAGGGGTTATCTATAACAAGTGTTCCTTCATTGAAGCTGAAAGAATAATT
TGGTAATTTTATAGACAAGCAGGCAATCTGCAGTAGAAAAGTTCCTTGAATTGACATTGG
AACTAGATTATAAAGTGTGCCAAGCCTGAGGCAATCCCAGATCTCCTCAGGACACAGAAA
GAGGAGTGGTTAGATAAACCTGTGTTTTCATTCCTTTTTGGTAGCATTAGAAAATGGTGC
CTGAGCAGAATGATTTCACAGGAGCTCTGTAAACCAGTCAGAGATCTCCAGTGACCAGGT
GAAGTCCCAGTCAAGAATTTCAAGCCATAGGAAGTGTTTTAGTGCTGTGACTCTCCCTGT
TGTACCCCATCACGTGCTTTTCAGCTGAGAGGAGGTGGCTTATTCCTGGTGCCCTCTCAG
GCCAAAAACCACAGTGCAGAATCCTGTACAACCTTTGACCTATCTGTGGGCCTCCCAGGG
AACTCATTTCTATCTTAGATGACTCAGTACAAAGCTGGGAATGGTGGCATTGCTTGGATC
TCGGACAGCAGAAACTGTCAGAGCCAATAGTGAACTCTGGGCAAGTGCTAGGGAAGAAGA
CTATAATAGAACACGTAAACCTTTGAGAAGAATTTGATGTGAAACTTTTTGGGAAGTTAT
GACATTTAAAAGTAATGAGATATATAGGGAGATCCAAATGCACACACATACACACTTGCA
CATCCTAGGAGGATATATACCCAGAAGTGAACTGGGAGAATTTGAATCCTCCACCCTAAG
CTATTACTAAGGTTTAAGATTCATCCCAGTGGGCCAGGGGTTTAGTTTAGTGGAGTAAGC
GTGAGGTCATGAGTTCGATCCCTGGTACCAAAAAAACAAAACAAAACAAAAAACATTCAC
AAAAAAACAAAACAGATTCATCCCAGTAATTGGTGAAGGTCTTCTACATTAGTCTGCATA
GACTGGAAGAGATGGCTGTTTTTCCAAATAGTTGTCAACAAAGACCACATTAGCTGGAGT
GGATTTATAGAATATAGCATTTATAATGTCTATTAAAAGTTATGGGGCCATATTTGGGAA
GATTGAGTTTATGGGATGTAGCATTTATGATTTCTATTAAAAGTTATCATTATTTTGAAA
AACACTTTACAGGTATTCAACAATAAGGAGTTTTTTCTGTTTTAAAGTTCTAACAGGAAA
ATGTGACATATTAAAGGTAACAAACTCTCTAGAAATTGTCCTTGTAGAAATCAAGATTGT
GAACTTATTAAACAACATTTTTAAAAGCTTTCTTAAATACTTGAGTTGAAGGAAAACATA
GAGAAAGAATGAAATGGAAATCAGGTAAAGGACATGTGAACAGAAATGAGAATATTAGAG
AGACATTGGAAGGAAATGAGAGAAAAAGGAAGAAAGAGGACCATGTATACAGAAATTTTG
GAACTGAAAATTTTACTTGAGAGATTTAATCCAAATGCATATAGGTAGAAGAAATAATCA
GCAAGCCTAAAAACTGATTATTGGAAATTATTAAGTATGACAATGAAAAAAAGAAAAAAT
AAACATATCCCAAAAGACTTAGGAGGTAAAATTGAATGAGCCAGTTTACATATTACAGTG
TTCTCAAAGAGAGAGAGAAAGGAGAATGGTTATTGAAAGAAGTAATTACTGAAAAGGTTC
CCAAATTTGAGGGAAAAACATTGGTATGGCAAGCCAAGAAAGTTAAAATTCTGGACCCAC
ACCAAGATGTTCTAAAATCAAACTGTCAAAAATCAAAGACAGAGAATATCTGAAAGTAGC
AAGAGGAAAACACAATCACATAGAAGGGATTTTCAATAAATTTAACTACAGATTCTCAGC
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GTAAATGTTAAATTTAAATTACTCCCTGTACTTGGTTGGCATCAGTTTAAGAGCAAACAT
CTGCCACAAGTGGTGGTAGTTAACCCAAGAATGATCCAATCTTAAATTTATGCTGTTTTC
CTCATTCTAAAAATGGAATTGTACACAGCAGATTTTGGGTTTTTTCCTTAAGCTATTTAA
TTCCACAAGAAATGGATCATCTTTTTGTTCTTTGGTGCAACACAGCTACTTGAAAATTAT
TTTTTCTAATCTACTTAACCAGTCTTGAAAAAATTAGAACACAAGTGATACCTTGCTTCA
TGAACTTCATTTGTTGTATGATTTTGGAGAAGATGGCAGTGTTTGTGTTCATGCAGGAAA
GATGGCAACGGTCATGTTCCTCACCTGATGCAGAGTTTGCAAACAAAAACAAAGTTTTGC
CAAACGCTTCTGTTTGTGAACCAAATCACTTGCAAACAGAAGCCTTCATGAAGCAAGGTG
CTACTGTAGTTTCACCGTAGGAGCTGATCTTTAGAATATGCCTGACTTGTCACAAGTAAG
AGTGTTTTCTCAATCATGTAATTTTTATCAACCCATCATTACATACATTTCCTTTTATCT
GTTTGTCTTGGCTCATTTAATAAAATAAAATGGCTTGCCATATAATAATATGCAATAAAA
GTTTTCAGGAGACAAAGTAATTTGTCAGAGCTTTGTATAATACAAATAAGGATAAGGTGG
CAGTCACTTAAGGGAAAGGCATTAACAGGTGGGTGATGGGTCCATAACTTACATTTCTCA
TGACAGACAGCACTGAACCACCAGTGGAATAAACATGTCTGTAGCGCTTAAGGCCAGCTG
GAATGTTAAAGATAATTGAAAGGTGACATGAAATTTGAGCCGCGGGTGCCTGTGAGAAAC
ACTCCCACCTCCCAAGTAGTCCTCAAATCCTTGGAGGAAAGAATTTTTAAACCCAACCAA
AAAAGGCAACTATAAATGTGAAAGCAAGACTAGTTCTCTCATTGGCACAAAAATTGTGAG
AAATCTGGAAAGAAAGCAGTTGGGATTAGATTTAAAGAAAAACCAACCTGAACACAGAAG
AATACTGAAAACGTTAGGTGCAACAGTGTCTCCATCTAAGAGTCAGCATTTGCTACAAGA
AGAAGGGATCCTGGGGTGATTCCTTGGGGCATCCCTTGATGGAGGACTCTTTATGGTCTT
ATCAAAGTTGTATCAAATTATAGTCAACAGAGATATTGACTCTGCTAGAAATAGTGGAAG
CAAAGAAAGTCTGCAAAGCTCCAGTTTTTTCCTGGTATCCAGAAGAAAGTCTCTCCCATT
GCCCAAGAGACTAAATACCTGCACTGCCCACCACACTTCACATAACCAGGGGAGTAAGCT
TGAGATAGTATGTAAGGTATTGAAAGGTAGATGAGCAAGCAGCCAAAAGTAATTACTAGA
CAGTGACAGACAGTAAGTACTGTGAAAAGGGCACTGTGTAACAGCCCTCAAGAACAGGAG
ATCCTGGTCCCTGGAACCTGTGGACACACTTAATGTGAAGGAGACTGCAGATGTGATTCA
ATTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGAAACATGAAATAAAATATAATGTGTTT
TACACATTCTGCAAAAGAAATTTTTAAAAATTTTTTTAGTCTTCTCTTGCAGGATTTGGG
GCTGGTTAGGGAGATTAATGCTGTTCACTATTGTAGGCCTCTGTAAAAATGTACTCACAA
ATGATCATTGGTAATACAACTGGTGTATGACTAGTCTAGAAGCTGACTGAAGCATTTTAA
AATTTGTAGCACCTTTTCCATACCAACTGAACAGAAGTAAATGCTCTTGTATGTGTCTAG
GGAATGATGGTGACAGGGATTTATAGTCAGTGTTGTTAGTGTTTGTTTGGGAGATAAAAA
GGAAACAGCCTGAGCACAGAACAATAACAAATTCTGTTACACCAGTGATAGATACTCCGC
AACAGAAAGATGAAACTAGAGTCAGATCAAATTACTGATGCCACAAGATCTCTGATATAT
CTTCACGTGGGTGAGAAGCAATGTGGAGAACAATGTTTACAGCATATCAGCTCCATTTGC
ATATAAGGCTATTTAATCAGCTATAACTGTACTGATGATAGAGATTTAGGAGGGATCTGA
TAAGGGGAGATCTGTGCAGTTTGAGGAACTTTTCACTTTGATGTGTTTTGTTTGAATCTG
TTATGATAATGCATTTAGATACTATGCACTGTTAAAAATAACATCGTTTATATGCCAACT
GTACTCCTTTATGTTCGGAACATTATATGAAGTCTAAAGTTTAGTATTCAGAAAGTTTGT
CTCACACACACACACTCAGACATATTGAGAAATATTTACTGAAGAATTGTAAGAAAAGCA
TAGAGAATCCCCAGACTTTATCCAGCTTCCCCAGTTGATGACATTTTACATGTTTGCTTT
CTCTTTCTCTTAGCCATTATCATCCTTTTTCTGAACCATTTGGGAGAATATTATAGATTT
ATCACTAGTGTGTATTTTCTTCAAACAAGGACACTTCTCTATTTGTGTATCATATAAAAA
CGTAGTTTTAGCTGTGTGTGGTCATGCACACTTGTAGCCCAGCACTCTGAAAGTGAAGCC
TGGGCAACTTAGCAAGACCCTGTCTCAAAATTTAAAAAAAAAAAGCTGGGATTGTGCTTC
AGTGCAAAGGCCCTGTGTTCCGTCCCCAGTACTGCAAAAATAACCAACTAATTAACTTTA
AAATAAAGCTTTATACATTATAAACAGTAATGCCTAGTGTTCTACAGCTTAGCTTTGTTT
CCCCATTTTGTTCTCCAGAATGTAGTTATTCAGACCATTAATATTATCTCATTGCTAACC
CACTGGAATTTCCCCAGTTCCCCCACAGTGTCTCCTTTTTCCTTTTGGAGCGAAAAACTA
ATCAGAATCATAGTCCATTTACTGGGGCCTTTCAGCTCTTCATGTGGAATAATTTTCACC
TTTGATGAGCATAACAGTGTGAAAGAGAAAGGCCTTCCTTTGTGCAGTATGTCTCTCACT
GGGTTTTCCTCATTTCAGATGCAGGCCACAAACTATACTCTACTTACGGTGTCCTTGAGA
ACTCCCAGGATGGTGACCTGCAGGTTTCTCCCCTGCAACATTGCTGTTTTTTTTACTTTG
TGATTAATAAGCAATTCATGAGCAAGCCTCTAAGACACTGCCAGTATCTGATTTCTCATC
AAATTTGTATCCATCCTTAGCATTCATTGATGATTCTTTAGTTACTTTTCCTGTTGCTAG
GACAAAGTACCCTGCACACAAAAGCTTAAGGAGGAAAGGTTTATTTCAGCTCACAGTTTG
TAGAGGTTTCAGTCCATAGTTAGCTGGCTGTGAGGCGGGATGGCATGGCAGAGGGGCATC
ACCGGTGAGAAACAGTTCATGGAGTGGCAGGCAGAAGGCCGCAGCATCCAGCCTGCCTTT
CCTCTCTCCCTTTATATTCCATCCAGGCTGTAAGCCTGTTGATCGGTGCCACCCACACCG
AGGCTGGGACTTCCATCATTTACACCCAGGACTTTGCTGAACTCCGTTATCACACACCCT
AGATCCAACCACCTACAGAAAGCCCACCTAGGAGTGCATAATAATCTGGATCCAAGGTAT
AACAATTTCTGTCTGAGTTAGCTACTGTCATAATGGTGCTCAGGTGTGCCTTTTCTATTT
CCATTATTCTCTCCTTGTTCTTTGGTGTTCTACCACAAAAGAGAGCTTTTCTTTTCTTTA
TGTAAATCTGGACTCATGGGTTTCTACTTTAGTAACAGATTATAGCTCATCGAATATCAC
CATTAATTTCAAGTTCAAATTGTCTCATTTGGGCCAGTGGAACCCCGTCAAGGTGCCTAG
CTGTGTCATTTTGACATGACCCTTTTTCCTTTGTGCACCTGTCTCTGTGGTAGGCTTAAT
AATGGTCCCCCCAAATGTCTACATCCTAATCCCCCATCCATGTAGGTTATCTGGGTGGGC
CCAGGAGATCACAAGAGTCCTTATAAAGAAGAAACAGTAGGGGCAGAGGAGGCAAAGATG
GAGATGTAAAGGCAGAAGCTGCATGGAAGTTGGGAAGATACGCTGTTGGCCTTCAAGAAG
GAAGGGGCCTTGGACTTCTTAACTTGATGAATATTGTCTTCTTTCTCCTTCTTTTGCTTC
TGTCTTATCTAGTGTTATGATGAAATTCAAGTATTTTGTGTCTTTATGTGGTTTTTTTCT
TAAACTGCAGTTCCAACACTTATTTTTCTTCCTCTGTCATTTGAATTTCAGACGTAACTA
GCCTACTGATGAAAGCACCTGGTTCTCACTTTCGCTGAAGCCACTTTGGAAAACTTACCT
GAAGTACAAAATAATGTGCTTTTTATAAATGTCATGATAAATATTTGTTAGGAAACTTAC
AAAGCCACATTAGGGCTTGCAAATTACCTTAGTGATTATAGTTAGTAGATCTACAATCTG
ACAATATCAGTGTTAGTCAGTAGCAAGAGTAAAGTAAAACACTGGGCCATCAGTTGCAGT
TGTGATTCTATATTCCCAAGATTAAACCTCATATTCCTGGAACATTGATACTGAGCTGCT
CAAGTTGCTATGCTGATGGATAACTTTTCAAACTAAGCTCCAAACAGTCTTCTTTTAAGA
GAGGTATCTTGTAGGTAAGAATTAAGAGTGTATATTTGATTTAGCCAAACCCCTGTACAG
ATTTTAAAATTGGCACTTCTTAGCTGGCACAGGTAGGCAGGGCGTTTTTCTAAAATTGTT
TTTATTTCTAAAATGGAGAAATTCCAGTTTTATTATTTTTGAAATGGAGATTACATAAAG
TTACAGAGGTGAAATGAGAGAATGTAAACAAAATGGATATACTAAGTATTTTATACTAAC
AGTTACTAATAAGAATTTAAAGGCTGGGAATGTAATTGCCTAGCACATGTGAGGCCCAGT
CCATAGAACATATGCACTACACACGCTTATATTCTCACACACACAAACACATGCGCGCAT
ACACACACAAAGAATTTTAGTACTCAGTAACATATTGCAGTGCAAATCAACTCTGATAAT
CAAAATAGTTGTGTTGCTTTTCACCATTTTCATTGACAATAAATTTATTTTCCATTCTGT
GCATTTTTTTCTTACACACATTTTAAAGTGTATGTAGGGTTAATCAGATTATATTTTAAT
TTTACACGTTTACATTCCATTTACTAAGATGTCCAGCAAACAAGGTACACACTAATGTTG
ACACTAAGATAGTCTATATCCTTAAGGTTTTCATGTTAGTGTTCTTTCTTATACTCAGAA
TTGTTTCAGAAATGCTGCATTTCTACAGTGACAAGGCTTTTGCTGTTAAGTTACAGTGTA
ATCAGGTACGATTAGTTTGACAGCAACAACGTTATCATATATTACTTTGGAATGTCATTT
AACTTTACTGTTATAGTGATTATTTCTTCCATTTTTAAGTTTCTAGTTCAGTAAGAAGAA
ATATATATTCAAGTGTACACTTTTACTATTAAACATTTTATCAGGTAGATAGTCCCTGAA
AATGTAATCTTGACTTAGCTGTTAGAAAACAGATAAAATAGAAAATATAAGATCTCTGCT
TCAGCACGACTGACCAGATTATTGTTATATTTCACCATAATGGCAACATCTGCCAGGGAA
ATTAAAACAAAATTTCCTCCCTAAGGAGACTTCGGTCTGCTCCAGCTAAGGCTGTGTATA
TCCAGGGAATGCCAGGAAATTTTGACATATTATTGGAACAAACACTTCCAATCCTTGTGT
TTTTTCTGTTTTAGCAACTTCACTGTGTGGTGGTTGGAAGTGAAAATGCCAAGAGATACT
TCGAGGCAGTTCAAGGATCAAAAGAGCATCGAGGAGAGCTCTTCGGGACCCACAACCTCT
TCACGCTGAGATCCCAGGGGTCTTGTCTTACAAGGGACATCTTGGAGGTGTGAAATTGTT
CTCTAACCCTTTCAATAACACAGTATTTTAAATATGGCTTTATCAAGAAGCTTGAAGTAC
AGTTGTTGGTAACTTTTCAGAGAAATTTTCAGTTCTCCTTATAAAAAATGTTTATGCTTA
GACATTTTACTTTTAGAGAAATAGCAAATGAGTTGCGGTACCTTTAAAATAGTTTTCCCA
TGCATAATTATAAATAATGCACATATGTATACAGATACATGTATGAGGAGAGTATGAACT
CCAAGCTATTTTCTGAGTTACAGAGGGAAGTTTATTTTGAAAAAAACAATTTCTAAATAC
GAAACTACAAAATGTTTTGATTAAAAGTTACCAGATACTCCCTAAGATGTACTCTCATCT
CTCATAGAGATTTTTCTTTTCTGTTCCTAATAAAAATTCCACACTAATATTTCACACTCT
TCCATTTGTTCATCCTCAACATTCAGATGTTTCTTATTCTTCAAATGAGATATTTATATT
TTTTTGGAAAAATCTTTAAATTCTTTAATAGATCAGAGTACTAATGATATTAACCTGTTA
TTCTAATTGACATTAGTATGGGTTTCATAAAGTCTTGGAATCATCCTCTTTTCAATTCTT
TATAATATAGATCAGAAAGCTGAGTCTGGGAAAATATCAAGCTATTTCCCTCGACCTTGA
GAACTTTGTTGTAAAACCTTAATGTAATTCATTTAATTTATAAGCACCATAAAGCAAGTT
CAAGAAAAAGCTGGTCCATGTACTTAAGGAACTTAGAGCATGTTAATGAGAGGTGGAAGA
AGACATTTACACAAGGAGCAAGCAGTATGGAATGTCACACTGGGCAAGTTCAGAAGTAGT
TTGACATGGTCACTGATCAAGGAGAAAAAAGAAGGTGTACATTATTCGTATCCTGGGAAC
ATTTGAACTGTTACACAGTGTGTGATGTCTGTTGCTGAGTTTTTAGGTTATATTAAGTAC
AATTCTAAATTGGAAGGCAAGTGAGGCTGGAGG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1017, 1019..1032, 1034..1039, 1041..1061, 4042..4466, 9521..9555, 9557..9596, 9601..9648, 13981..14174, 19965..20126, 20575..20782, 23623..23755, 24109..24119, 24631..24744, 25023..25142, 31523..31594, 32263..32408, 37803..37898, 40300..40399, 48254..48412
1001..1017, 1019..1032, 1034..1039, 1041..1061, 4042..4466, 9521..9555, 9557..9596, 9601..9648, 13981..14174, 19965..20126, 20575..20782, 23623..23755, 24109..24119, 24631..24744, 25023..25142, 31523..31594, 32263..32408, 37803..37898, 40300..40399, 48254..48409
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved