Cavia_porcellus Locus LRIG2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus LRIG2
Cavia_porcellus
LRIG2
GeneScaffold_7551
SNORA73
3687..3890
59770
TCCTATTCACAATGTTGGATATAATTTACGGCTGACTAAGCATAACATGTACCTAGACT
TTAAATTTTCCATTGCCTCTGTATCAGGACAAAAAAGAAAAAATTCCATTCAATCATCAC
TTTGTTGATGGCTCAAAACACCTTGTTTACTTGTACCACTTGTTTTTCTGAACGTGTGCA
TCGAGGCCAGTACCTTCCCAAACGTAGTCGAGGATTTCTGAGACATACACTGGTTTGGAG
TCCAGCAGTCATTGAACTCCAAGCAGAAGCTGGAGGTGCAGGGATGAATAAACAGAGCCT
GTGACTCAGGACTTCACAGGTTCTCTGCAGACTTGAGAGCATATTTTGTCAGAAGAGCAG
AGGTGCATGACTCTTGCAGGACAGCACACGCGGCACAGCGCCAGGGGGCAGTGGAGGCCA
ACCCGGCCGAAGCCAGGATGAGAGCTTCCCCGCGCGCTGGAGTCTGCGGCTTGGAACCCT
TCTGCGGTCTCCCTTTCTTAGTGCCTAGACAAGGTAAGACTTTTCCAATACTACGGTATA
TACATCCACAGGGGGGACTGGAGACTCCCAAAGCTTCACGCCTGTTTCCTCTTAAGGAGT
CACTGCGCCCCCTAGCGTAAGAACTTTGACGGAACTGCAGAGAGACACCAAGGTCGCCAT
GGATTTTTAACACCCGCCTTCTAAATGAACCGGAAGGCTGAGGGCCGCGCCTCCTCCGGA
GTCCCGCCCCGACGCAACCCATCCTATGGCGCCGATTGGCTGCTTCCTGTGCGTGAGGAC
GTTGCGTCGCGGGGCGGGGCGGAGGATCCTTGTCCGCGGCGCTTCAGTCGTGTGTCCCCG
GCCGCCGCCCCCGCTGTCGCACCGCAGCTAGCTTTCCCCTGCTTTTAGAGTGTACACGTG
ACAGTCAGGGCTTCGGCCCCTTCTCACAGCCGCCAAACGTCTCAGCTGAGCAGCCTAGTC
CAGCAGGCAGCTCTTCTTGACTAGTCCGGGTTGTGGGGAAGATGGCGCCGGCGCCTGTAG
GCGTCCGGGAGGAGCAGCAATTGGGGTGTCGATCCGGACCCCTATCTCGGCTCCTTTTCC
TCGCCCAGGCGGTTCTTTTGTTGCCCGGCGCCCGGGCAGTGCCCTGCCCCGCACCCTGCT
CCTGCAGCGTTCCTCTGCTGGACTGCAGTCGCAGGAAGCTGCCCGCGCTGAGCTGGAGGG
CGCTGTCGGGCCCGCTGCCCCCCGACACAGCCAGCTTGTGAGTAGAGTGCCGAGTCCTTT
ACGGGGATCAGCACGGGGGCAGGTCTGGTGGCGGGTCGGGTTGGGACCTCAGGTGTTAAA
GGAAACTGCAGTTCCGCTGTTGTGGGGTCGGGGGAGCCTGGAAAAGCCGGTGTTAATTAA
GCTCTCTGAAGACTTGTGTGAAGACCGCGGTTAAGATTCTCCTGGCCAGAGAGTCTGATT
TTCAGAATTGGAGCGGGATATTCAAAGGGTCCTGCACTACCACGGACTCAGGATGCCTGA
GGGGCGGGTCGAACACGGAACCCTCCCTGGTTGTATCATTTGTTGTGTACCTGAGCTTGT
ACGATCCGCTGGCCGCCGGCTGCTGGCACGAGATTTTATAAACAGTATCGCCAAAGACGT
GTGAACTGTCTTTTGTCTCTAACATTAGCACATTATGTATTGCAATATTGATACGTAATA
GGGTTCAAAATTTCATTATGTGTCTTTGACACATAATGATTCAGTACTAACCAAGAATAT
CTTTATTTTTATTCATTTATTTTTTTGAGACGGTCTCGCTGTGGAGTACAGGTTGGCCTT
AAATTCACTTTGTAGCCCAGGCTGGCCTTAAACTCGTGGGATTACAGGCCTCCACACCTG
GCTGCATGGTTATCTTTAGGAATAGCGTTGTTGAGTTGCTTTAATGTACAGTCTAAGGAA
AGGAAGGACCACTTTTTTCAGAACGATGTGATGCGTTAAATATTTTATTTGCTTTGGCAA
AGATCCCCAAAATTAGGAATCTGTTTATGTGTGCTAGGGAAGTACACTAATTGAATGAAT
GAATTCTGAAGTCTCCACTGCTGAGTTTTTCATCTTGAGAGGCCTTTATTAGCTAGTGGC
ACCTAAAGAGCTCAATTAGTCTGAGTCAACCTAGTGGCTTTAGGAACAACAGTAGTATAA
ATACTGCAGTTAATGGGGATTCTTAACTACCAACATACAAGTAATTTCTCTGCCACTACG
AGTAACACACTACTATGACAGGCTTCTAATAGAAGTTGTCGCAGCAGAAAGTTATTGCTA
TCAATGTGGTGGCCATGGCTTGTAATCCCGGCACTCNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTGTGAGGCTGGACCAGATCTGTTAAGCCTGTAGCAGTCAATGCACCCACC
TTGGTTTGAACTTGGTTCCCTTCAAGCTCAATCCAGGCTCCCTGACATCCTGATGATTTG
AACTTGGCTCCCTTACCCTGACATGGGAATTTTGAGATGGAGTCAAATTCCGTGGCCCCT
CTCAGCCAATCACCCTCTGCTGGGGCTGTCTGAACCTGAATAACTCACCAGCCAGTGCAG
TTAGCTACATTCACTGTTCCATTCCATTTGTGTGTTTTTCTGTGAAGGTCTCTGCAGTCT
TCGGCAGTCACTGTGCATCCGTAGGTTCAAAGCACCCCTCCCACATAGTGAGTTGGAGCT
CAAGGAGAAAGCACTGCCTGCCACCTCCTTCTTCATTGAAGTCTCTCTCTTTGCTCTCCC
CATGGGCTTCAATTCTCACTTCAGATCTTTCCTCAGTCCTGCGGACCCAAATACCTCTTT
GTTTCCTCTTCACATTGCTATATTCCAGTGTCTGGACATTAAATCTCAGAGAGGCTCTTT
CTCGCTCCACTCTGTATTAAAACTAAAAGTTTTTTTTTTTTTTTTGGTCTTTTTGAGACA
AGGTCTTGCTATGTAATTCAAACTGGTCTTGAGCTCATTGTGTAGCTCAGGCTGGTCTCG
AACTTGCAGCAGTCCTCCTGCCTCAGCTTCCTGAATGCTGTGATTACAGGTATGTGCCAC
CATGCCCGGCTCTACCAATCATGTTTTAGTCCCTTCTGTTCACTTATATTAAGTGTTTCA
AGAATTATTTGCATTTGCTCCTTTAGAGTAGTTATAAATAGGTTAGTGCCTAGTGCACAA
AGGACATTATCTTATGTTGAATTACTCTGAGAAAGTCTTTCTGGTCTTTCTCTTTTTTTG
GTGGTGGTGGGGAAACCAGGGATCGAACTCACAACTGTGCGCATGCAAGGCAGGCGCTTG
TGTCTCTGAGCTAAATCCCCAGCCCTAGTCTTTCTAGTCATATGTGACTTGAGGTTGAAC
TTAAGTAGCTGTCACTGATTTTGGTAACATTGGCAAAATATTTTTACTGTGTATTCAATC
CTAATGCCATTAAAGATTCTGAGCTGTCCAACGTGGATACCCTGGGAGGTCACTCTCCCC
GGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGCCCCATGATGTACAGTCCCTT
TCCACAATGTTAGAGAAGAAGCTGGGCCTTGTGTCTGCGCCTCCATATTCCTACAACTTC
TCAGAGTCCTTTGGGCAGTGACTGAGGAGATAAACCATGCAGAAAACAATATCTAGTAAA
AATAAATAAATAAAGGTTCTGAGCTCACTGCCAGTGATTTGTGTGATGGTCAAGCAAAAA
ATATACTGTGGATTGACTCTGGGCCTTGCACATACTAAGCATATGTTCTATGACTTAGGT
ATCCTACCAACTGTGGTATTATAATTGCTTTTGTTTGTACAGGCAATCTGATTGTTTTAA
TATTAACAATTCCCCATGCTAATTTCATTGCTATATATGATACCTAATTTTAAATGTGAG
AGCCACTTAGAAGAAGTTGTGCTAAATATATCCATGAGAATTTTGATCTTCAACTTTTCT
CCTTTTTGATACAATCTTGCTGTGAATGGGAGCAATCGCTGAAGCATTAAAAATGATGAA
AAAAGCTTCGTGAAACGTGAAAAGGCGAAAAGTAAGCTAGGAACATTAGGAGCATTAACC
TTACCTTTGACTGCTGTGTAGCCTCAAATCTCAACCTTCCTCCCTAATGAAATATATGGC
AATGACATTTTTTTGTCTGGTTTTTTTTTCTTCTTTTTTGAAACAGGGTCTTGCTATGCA
GTTCAGGCCGTCTTTGAACTCACTATATAGCCCACGCTGACCTTGAACTTGTGGCAATCC
TCCAGCCTCAGCCTTCTGAGTGCTAGGATTAAAGGGATGTGCCACCATGTCTGGTGACAT
GGTGTTTAAAAGTTACTATTTTGGGTGCTGGTATGCTAACCTGCGGCCTTGAATATGCTA
AACAGATGCTTTGACCCTGAGCTACTTTCTCAGCTCCTCTTCAGTGAAATGTTTGGATAG
ATTCTTGGCTAAAAATTTCATCTGAGAATATATTGCTGCAACCCATGCATCCCTTGAGGT
TTTTGGGGTGAAGGACCATGACAGGATGAGAAAATAAGAGACAAAGCCGGGATAAGGTGG
AGTACTTATCCTCCAGATGGGAGGAAAGGTACTGCTTAACCAATATAGCATGTTTTTTTT
TTTTTTTTTGCATATTTATTTTTATACCAAGAAGGATGATACCAATTTCATAGGTGGTTG
TGGTGATGCACTCCTATAATCCCAGCACTAGGAGGTTGAGGCAGGCAGATTATTGCAAAT
TTGAGATAAGCCTGGGCTTACAAAGTAAACGCAAGGCCAGCATGAACCACATACCAAGAC
CCTATCTCAAAAAGACAAAAAAAAAAAAAAAATCCTTAACTGGTAGTCGGCTACCAGTCT
AGCTGGCAACTGTCAGGAAAATGGTTACTGATTTGANNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTTCCTCATCACTGTGACTCACTATTACCTGTGTTCTTAAAAGTT
ATTTGCACCTATTTTATCCGTGGAAGAAATACCATAGAATTGGGCACTACTTTCTGACTC
AGGTTTTAGTGGTATCACAGTTTAGTGGTGATATAGGGAAATTAAACTCCCAACCTACTA
TATGTCTGATACGAGTTCATGCTCTCTAAAATCGAAGAATGAATTTTAGGAACAACAGAG
GTTAGGAGCAGAATATATTTATTGAGGGAAAGAAACCTTCTGTCTGAGAGAGAGAGGGTC
TGGAGGGGTTGTCAAAGACTATCTTTTTTAGGGACTTATATCGAGTAAAACCACGAGGTG
AGACGGGTCCAAGACGGGGAAAACTTGGGAACTTGAAAGGTGGGCATAAGGTGGACAGAA
CTATGGTCAACCAATAAGATTAATTGCTCAGGTAAAATTACTAAATCGGGGACAAATGGG
GAAGTGAGTCACATAGCAAGGGTATGCTTAAAGAGCAGTGACTTTTTCTGTAGGGGTTTG
GGATGGTGACTCCTGGCTTTCTCAGGGTGATAGAGATCTACTTAGAATATCAGTTCTTAG
GTTGCAGGTGCATTTGTTTGATCGTTTGTCTTGAGGCCTGGCCCACAGCAGGAGATGTCT
GTCTCCCCTACAGTTGCAAGGGCTTCTGCACTGGCTCCCTTTGAAGACCTAGCCCTGTTC
TGTTAAGTCACGTATGGTTTTACTCTCTTCCAAAAAAAGTAATAAGAACTGTGGGAGCAA
TAAAACCCAAAATGTGTAATAGTCATTGTACGAAAGAGAGGAAAAGGGAAGTGCTCTAAA
ACGGGTATAACTGCATGTATATTTAAGTGTATGAGATAGACAATGATAGTACTGAGTTTT
TTTGGATCACTGAACAGAACTGTTTGCAGTCCTCACTGTTTGAATGTCCACTTTATATGC
TTTAATTTTGTAACTTGAACAACTATTTCTAAGATGACAATATGTCATCTATTAACTAGT
GATTTCCTACTGTTTATTTTTCTGAAATTCTGTATAACTTGTATCCTTTTCTATTTTTTT
TTTCTTTTTTCTCCTTAAATAAAATGAGCAAAAAACAACAGTGGTTCAAAACAATACAAA
ATAAACAGTGGTTACCATAATTCCTCGTCTTCAAAATAGCTGCAGATACCTTCAGACATA
GTAGAAATCAAACAAAATAGAACAGAATAGAACCAATAAAAACAAAACAATGTAATAAAA
GTCTTCAAGACAATAGTAAATCCAAAATGGCTATCATATTTTGCTATCTTTGAAATGACT
GCCCTGCCATGGTATATAACAAAATCAAACAAAACAACACAATAAAACCTAACCAACAAA
ACAATGGAAATGATACAAGAGAACAAAACAAGACAGTAGGGAATTTACAGTGACGGCCAT
CTTCAGAAGGAGATCCCCCATAGATGCCACACTGCATACCATCATCCTCTGAATAGGTAA
TTAGACCACTAGCCCTAAACCTATAAAGTTAGTGAAAACCAAAACACCACAAACATCAAA
TTGCATTTCACCTCAGTACCTGTCTTTGCAGCCTATGTTTCTCTAGATCACCCTGTTGCT
TGGCAGGGTGATGGTGGCTCTTCTTGTTTCCCAGCCCATGGTAGCGGTGGCAGCCTGTGC
ATGGCGCTGGTTCCCAGGGATGGCTTGCTTCTTCAGTACTTTTGTAAATTAACATACCAG
TTAATTCAGTTAGTTGAAGGTTTATAGCAGAAGTGGATTATCATCCTAGATCATAATCCT
ATTTCAAATCTCGTATTAAAATGACTTACGTTTACATATGCTAAGTATTTTATTTATATT
TCTTTAATTTTCTTTATGTTTATAGATTCTTTTAGTTTTTTAATTTTCAATCCAATAAAG
TTATTACTGATATTGTCATTTTATGATAGAAGAAACTGAAATGCAGAGCGGTTAAATGAC
TGGCCGATAGTCCCAGAAGCAGGCATACAAAACCTGTTTTTTTGTTGTTGAGGTATTTTT
TTATTCTTGGAAATTGAACCCAGGACTTTTGCACTGAGATACATTCTCAACCCCTTTTAT
TTTGAGGCAGGATTTTGCTAAGTTTTCAGGCTGAGCTCCAACTTGTACTTCCTGTTTGCA
AAAGTACTGGAATTACAGACATGTACTACCATGTCCAGCTGCAAAGATGTTTTTGTTTTT
GTTTTCTTTTTGAGACAGGGTCACAATTCAGGCTGGCCTTGAACTTACTTTGTAGCCCAG
GCTGGTCTTGAACTTGCAAAATCTTCCTGCCTCAGTCTCCTGAGTGCTAGGATCACAGAC
AGGTGTGCACCACCACATTTGGCTTATATTCTTAAATGTATCTGTAGAATTATTTTTATT
GTATTGTTTTATTCTGCAGTTAAAAAGTATTTTTAATCATACCCAAGGAAAGATGGGAAA
CAGAGCTCAAGGCTTGCACTTAAGACCACTCAGCCATCCCAACACTCCCAAGGGAAGATA
ATGGAAAAAAATATGTCCCTTATTCTTTGTTTTTTTTTTTTTTTTTTTTTTTTGGTATCA
GATTGAACTCACGACCTTCCACTTGCCAGGCAGGTACTTGTGCTGCTGAGCTAAATCCCC
AGCCCTGTGTCCCTTATTTAAATGAATGTTTCCATTTTCCTGCTATCTTTAGCTTTTTGA
GGTCACATAAAAGATACTGTACATTGTATTTCAAATTAGTAGTACAATACAAATGAAGGG
TAAAAAAGTTTAGTGTGGAGTATTATTATGCTAGTGTGGTTTTTTTATTTTCAGAGGAGA
ACCATTATGTCTCATGCTATCATACATCTTATTTATGCTGAAGATACTTCAGGTATTTGT
ACTTTAACCATGAAGCAAAAATGCTGCTAGGAATCTTATTCATAGAGGAGACTCTTACTC
AGATCTCATTTAGTGCTAATTCAGATAGTGCGTTGGTGGTTTGTAGATTTCTGATTAGAA
GCAACAAATTTGAAAATGTAAGCAGGCCATTACAGACAGAAAGGCTGACAGTTCCAAGAA
GTGGGAGTGTAAAGCTGTTAATGGCAAAGGAAAAGCAAACCTATAAAAGAAGACAGAATT
TTAAGTTACTTTGAAATTCTTGTGTTTAGGTCATACCCCAGGAATATCAGATCATGGTAT
ATGAAATCATATAGCATGCTAATTAATTATAATAGTAACCTTTAGTATTTTTCAAAATAA
ATGATGCTAGCTATATTTTTAAAAGATAAGGGTTTCCATTTATAGAAGATGACATTTTAA
GTGAAACATGGCCATACCTAAAATGTTAGCTGTAATATTTTTGTATCTTCTAACTTTGTA
GCAGATATCTCTATCAGAGGTTTTTGCTGTTCAAGTTCCCTTGGCCTTTTAATGTTACAG
ATTCTGGAGAAAGCAAATTGTTGATGATTCAGATGTGTGGTTATGTGCCTGTGTGGAAGA
AAACCCCTGCATCTCTGCAGCCAGGACCTCTTTGCAATTAGCTTGTGGAACTTGATTTGC
TCCTCAAGCTGTTGCAATTGCTCTGTACATTCTATAAATAATTTATACCCTGAGGATACT
GCATGACTACATTAATGGCACCTCTGGCTCCACATGATATTAAGAACTTTAATAATTTAT
CATTTATTACAGCTGTATCCCTATAGATTAGAATGAGTAGGAGCTGAGTTTACAACACTG
AGGTAAAGCCGTCTCTGAAACCTTTACTCCATAATTGTCATATTCATAAATACTCAAATA
TTTCGTGGTATTAGGAAATAAAGGAAAGTTCTTAAGTACATTTTGGGATATTTCGAGAGA
AAATACTTCAAAAAATACAGAAAACAAAAGATAAACTGTATCTTTAGTTTATGCAAAATA
AATGGAATTAATGCTTGAACATAGGGGAAGAATAGTGAGAAACTTCAACTTTTAAAAGCT
ATCAATCCCTTTTCTCCAGTCCTGGGGATTAAACAACCCAGCCACTCTCCTACTGTGCTT
TATATACCCTCCACCCTTATTTACTTTGGGACAGAGTTGGCTGAGTTGCCCAGGCTATTC
TTGAACTTGTCATCCTGCCTCAGCCTCCTTAGTAGCTGGGATAACTAGTGTGTACCGTCA
TGTCTGATTTAAATTCTTAATCTAAGAAACTTCAAATTTCAGTAAATTGACACTTCTTTT
TAAAAAGAGAAACTGAAGCTGGGCATAGTGGGTGTGTGCCTATAGTCCCAGATATTTGGG
AGGGCTGAAGTGGAAATACTAAACCCATGAATTAATATTAAACCCATCTCAAGATCAGCT
TGTGTAACATGGTGAGACTACATATTAAAAAATAGAAAATGCAGCTTAGTTTATCCATTT
TCAGTGAAAGGGAAGAGTCAGATGGATGTTGGTTTTAGTGTTGCAGTGACTCTGAAAAAT
AGAGAAGGATTACTTTTTTTTTTTTAATCTTTTTTGAGATAGGGTCTGCTATGCAGTTCA
GGCTGGCCTTTAGCTCACTTTGTAGCCCAGGCTGGTCTTGAACTCACAACGATCCTCCCA
TCTCAGCCTCCCAAATGCTGGGGTTACAGGCGTGAGCCACCACGCCTGTNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTAGTTAGATACCTGCTATTTTAGTAATAA
CTATGATGATATGTATGCTAGTTGCTTTTTATGGTAGTACCATGTTGGGAGTGTATTTCA
ATTCATCTTTCCTGTTATTCAGTCTCCTTCAATGTAGGAGTTTTTGAGGAGGTTTTGTGG
GATCTGACACATGAGGCTGTATATATATATATATATATATATATATATATATATATACTT
TTTTTTTTTTTTTTTTTTTTTTTTGTATCAGGGATTGAACTCGCGACCTCGCACTTAGCA
GGCAGATGCTTTTACTGCTGAGCTATATCCTTGGTCCCTCAAACATATATTAAGATAGTA
TTAGGTTACATCGCGGGTCCAAAGTATTTCAAGTATCTTTTGTGCTCCCATGAATATCAC
GCTTATAATTTCTTCAAAGATAGAAAAAATTATTCTTTCCCCAGGCAGAGACTGGGCAGT
TTTCACTCATTCTATGAAGTTTTTATGATACATAAATTAAGTTTAATTTTATTGCTTTAG
ATTTATTTAATAATTATTTCCTGTAAAAATCATTATCGGTATTTGTGCCCCTGCCTCCCA
AGGGATCAAACCCATGACATTATGCATGCTAGGCAAGAGCTCTGCCACCAAGTTAACCCC
GACTCCAATCAATAGGTCGCTCAAACACTCATGAGCTTGTGTTCCCTCTCACCCTCTCCC
TTTTTTTCCCTCTTCTCCCTTTCCTTTTTGTCCTCTTCTTTTTCTGTATTAGGGATTGAA
CCCAGGTCCACTTTTATGCCAGGCAAGTACTGCTGAACTGTAACCCCAACCCTATTCATT
TTAAAATAGGAGCTCCCTAGATTGCCCTGGCTTTGAATTTGCAGTCCATCTCCCTCAGCT
TCCCTAATAGCTGGGAGTAGGAGGGATCACAAGCATGCACCTCATGCTATTTACCATATG
TTAATTATGAGTTAATACCCATGGAAGAACTCTTGGGGATGAGTACAGTCAAGAGTTATA
CTGCTAGAGGTATGTAGGGGTCAAAAGGGCATTATGAATATTTATAATAGGTATGCACCA
CCAGGCCCAACTTAAATTTTTAACTCAGAATTTTTTTTTTGAGACAGGGTCTCACTATGC
AGTTCAAGCTGGCCTTGAGCTCACTTTGTAGCCCAAGCTGGTCTCGAACTTGCAACGATC
CTCCTGCCTCAGCCTCACGAGTACTGGGATTACAGGCATGTGCCATTACGCCCGGCTCTT
TAACTCAGAATTTTTAAGATTTCTTTTGGTGGTGCTGGAGATCGAATTCAAGGCCTTGTG
CATGCAAAAGCTCTACCACTGAGCCACATCCCCAGCGCTCTAGAATTTATGATTAAATTG
AAAATGATTGTGATTAAGATGAAATCCCTGAATCTGTAAGAGGGGAAAATGCTAAATTTT
ATGAGTTAATGAAATATAGAATTAGATCATACTGTGCTAGCCTGCTACCCAGATGTTATT
AGCTCTTTATTTAGGATAAAAACAATAAAACCAATCAAAACAAACCAGTGTGATACAGGA
CTTCAAGACATTATGAAATCAACAGTAGTTAACCATAATGCCTTTTGTTGTCTTCAGAAT
GGCTGCAGATAACTTCAGACACAGTAAAAATCAAGCAGAATGGAATAGAATAGAAACAAT
AAAAACAAGACAAAGGACTTCAAAACAAGTCAATAGTAAATTCAAAATTGGTACCATAAT
GTATCTTGCTGACTTTGAAATAGCTGCTCCTGCCATTAGATTTAACATAATCAAACAAAA
GAGAATAAACCCCAACCCAACAAAACAATGGAAATGATATAGGACCTGAAAACAAGACCA
TAGCGAATCAATAATACCTACAACCTGCAGGAGATCCCCCCTAGATGTCACACTGCATAC
CACTATCCTGTGAACCTATGATCAGGCCACTGGCCATAGATCTGCAAAGTCAGTGGAACA
CTAGAGCACCACAGACACTCAATTTCATTTTGCCTCAATAGCTACCATTACAGCCTGTGT
TTCTCTGGATCAGCCTGTTACTTATGTGGTGGTGGAGGAGGGATTGGTATTTCTTGTTTG
CCAGCCTCTGTGCCAGAAAGGGCTGGGATCTGGCTGTCCACAGACTGGCAGCAGCCTGTG
CGTAGTGCTGGTTCCCAAATGGGGCTTGCTTGCTGGAGTGCCCTTGTTAGCTCAACCCCC
AGTCCGCAAATGGCACTGACTCACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNTCACTTTGAGTTTGTGAGTTCCTTACTAGGTTTGTGACCTTGGATCAAC
AGATTATTAATCTCTCTGTGCCTGTTGCCATAGTGGGAAAGTGAGGATTATAAAAGCGCC
TTGTAAAGTACTTTTTGTGTGAATTTAGCCAGCTAATATAAGTAAAAGCTAATGTACATA
TAATGTATAGAGGAGACTATCTGACACAATAAATTAGTTACTATTGTTGTCATTATTAAC
ATAATTTAGGATGAGATTAATTTCCCTTTGCTAAAGCTATAAAAGATACTGGTGTACTTC
AATTTTTAATATAGATGCCCTGTATTTTGATTTATAAAATCTACCTTCAGATTTATTTAC
AGCTAATGTAATACTATAATCAGTACAAGAAATGAAAAAAAACAGACTCTCTGCCATGGT
GCACTGGGGTTCTTCCACGGTAGCTAAGAAACTTAAGGTTAAGTGAAAAACAGGTGAAAT
AATGTATAAATTCTACCTTTTTTAGGTAAAGATTTACTCAGTGTAGCATAAAGTATCTGG
AAGACTACACAAGACATAGTATAGATTTAAAGAAACAGTATACAGTATTTTTGGTTGTTG
TTGGGAAGGGAAACTGGCTGGAAGCAAGGGTGGGAAAAGTTCACTTTCCACATTAAGAGT
GATATTTTGTCCTTCTTTAGGGATTTGAGTCATAATCGGTTATCTAACTGGAACATCAGC
TTGGAATCACAAACATTACAGGAAGTGTAAGTTATTTTTATTTTTTTAATACTGTTTGAA
GTGATTTAGTATATTGTGAATTGGGGATATTCAATCCAGGGATGCTTCAAAACATTGAAG
AAAAAATTAAATTGTTTAAAAACCTAAACTGTTATCTTTGGCTTAATTATCACAAAGTCT
CTGGGCATGATTATTTCAAGCAAACTGTTGAAATATTATTCTGCTTCCTGGGGGCTAAAA
GTAAGATTTCTTCCTTCAGAATAAATATGTTTTGTATTTTTTTTGGCCAAGTTTTCAGCC
AGTAAAACTACCTTGTGTAAACTCTGTCAATGTCTTGATGTGTCATGTAAGATCGAAGCA
TCATGTTTAAAGTAAGTTTATATGAAAGGATATTTTGGATATGATTTGAGAATATGGTGT
TGATATAATCCAATTTTTTTTTTTTTTGGTACTGGGGATTGAACTCATGACCTTGCACTT
GTCAGGTAGGTATTGTGCCACTGAGCTAAATCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTTGTTATGGAACTGAATAAACAGTTGCCTTAGTAATGGTAGGTGAATGAGG
AGGGGCCAAGTAAAGACAAAAAGGTGCTTTACTGGGCGACACATGAGCTTTATTGGGTAG
ACTTTGGTTGTTTTTTTTTTTTTTTTTGGCTCCAGAATTGCATAGATTTTGCAACTGTGA
TTGGTTTCTTAGAGACAGTATACTTTAGTTTCTTATTTGTAGTCTAGATTGTTGAGGTTA
CTCTGTGATTTAAAAATGGTTAATGAATTGTAATTGTATTCGATTTCTTCCATAATCATT
TGAGACAGTCTGTTAAAGGGTCTGCTGGGAGCCAAGGATTTAGCTCAGTGGCATAAGCAC
CTCGCTGGCAAGCACAAGGTCTTGAGTTCAATTCCCAGTACCAAAAAAAAAGGGGGGGGG
GCGGGGCTGGGAATAGATGTGACATGTCATGTCATGTTATGAGTTTGATCTCCGGATGGA
CAAATTTTTCATCTGTGGTCCTAAACAACATTCCTTCACTTTGAATAGCTTTAGTGTGTG
TGTATGTGTGTATGTGTGTGTGTGTGTGTCTGTGTGTCTGTGTGTGTCTGCACACTTGAG
CACAGGTAGAGAGATTGAGATGTGGATGAACTCCTTTTAGGGACTCGAATTAACTGTCTT
CAATTTTTCTGGAGCTACAGTTACTTAATGTGCAAAATATTTCCTGTCCTTTCTTATATT
GATATCAGTAGTAGATCAACACTATGGAAAGGTTTATTAAAATCTCTAATTTCTCATTTT
TATCTTAGTCTAACTCTTTCTGAATAATAGACGTTTTCAAACTTAGCACCTACCCTAAAG
AATACATATTAGCCAGAAACCAGAATATAAGAGGTAGCATGTCCTTCTTTAAGTTTTAAA
TATGTTTTTCCTCTGGCCTAGGAAAATGAATTACAATGAATTAACAGAAATTCCATATTT
TGGAGAACCAACATCTAATATTACTCTGCTTTCACTGTAAGTAATTGAGATTTCAGATCT
TTCTTTTTTTTTTTTTTTTTTTTTTGCCACTCTCAGAACCTCTAAATAAAGTTTTGTTTT
TTTTTTATTGGTACTGGGGATCGAACTCACGACTGTCTGCTTGCAAGGCAGGTGCTTATG
CCGCTGTGCTATATCCCCAGCCCTCAGATCTTTCACTTAAATTAGGAATAGTATGTATAT
TTTTTCTTTCTTTTGTTTTTTTAGTGCCCATATTGTTAATTTTGATTATTTAGCATTATT
GTGGCAGGCATGGATTACTGGCAGCTATTTCAATATAATCTTTGTTTTTGTAGANNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNATAGACAAAAATGATTGTAAACAGAACAAAAGTTACA
GAACTCACACATTCTAAATTCAAAACTTACTACAAAGCTATGATAATCAAGACAGTGTAG
TATTGGCATAAAGATAGACATGTAGAACAATGAAATGAAATATAAAAAGTTCAAAAATAA
AATATTTATGATCAGTTGTTTTTTAACAAATGTGTCAAGACCATTCATGAGGAAACAGCA
GTTTTTTTCAAAAAACTAATGTTTGTGCAACTAGATATACATATACCAAAGAATGAAACT
AGATCCCTAAAGCGTATGATATACAGTGGATCAAAGACCATATTATAAGAACTAAAAGAA
ATTTTTTGGGACTTCATTGTAGATTTTTTTTAAGCACTTCCCCACTGAAGTATATTTTAG
CCCTATAATAACTAAATTTGTAGGTGAAAAAACAAAGCAGTTAAATGATTTGTAAAATTG
TGTGTAGTTAAGTATAGAGCTGGGCTTTAGTAGAATTTTTATTTTCCTAAATATTTCTCT
TTTGCTGTTATCTTGCTCGTCTTAGGAATTTGAGTAATAATAGGATAACTACCTTGGAAG
CTGGTTGCTTTGATAATTTATCAAGTTCCTTATTAATGGTAAAGTTAAACCGGAACCGAA
TTAGTATGATCCCACCTAAGATCTTCAAGCTGCCTCACCTCCAATTCTTGTGAGTAACTA
AATAAATTGATTACAAGAAAATAGTTTCTCCTTACAGTGTTTTTTTCTTTTTAATTATTG
TTAGAGCATTTGAGTAGACTAGTTTTCTGATTGTAAAACTTTTTGTTTAAGGGAGCTTAA
AAGAAACAGAATTAAAATTGTGGAGGGCCTTACATTCCAAGGTCTTGACTCCTTAAGATC
TTTAAAAATGCAGCGGAATGGAATTAGCAAACTTAAAGATGGAGCATTTTTTGGCTTGAA
TAACATGGAAGAACTGTAAGTACTAGTAACTTGTCTTAATCCCTTTCTCCTTCCTGGAAC
AAAAGGCTCAGGGTTTTTAGTGGATTTAGTTACACAGTCAGGTGGCTCCAAGATAGGAAG
GGTATTGTGGAAGGGTCTGGGGAGGGAAAGCTGCTCACATGGCAGCCAGGAAGGGGCCCC
AGGGAGAAGAGAGGAGAGAAGGAGAACTAAGGAGGAGAGGAGTAGGGAGGGCCATACTCT
TCTAGGTCACACCCCTAGTGACCAACCCTTTCTGACCAGGCCAGGGCCCACTACACCCTT
TCTGACCAGGCTCCTTTAACTACACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNAGCAAAGATATGTGGGTCTCTGAGAAATGTATAACGAAGATTTGAAACTGCTTGCCA
TTGAAATGCTTCATTTTGAAATACTTTTTCATCTCATTCTCTAATTCTACAGGGAACTAG
AACACAATAACCTTACACGAGTGAATAAGGGGTGGTTATATGGCTTGCGAATGTTACAGC
AGCTGTATGTGAGCCAGAATGCTATTGAAAAAATCAGCCCTGATGCATGGGAGTTCTGCC
AAAGACTATCTGAACTGTAAGTGTTGGGTAGTGTTTCATCAGAGGCTGAGATTAGAGTAG
GTTGGAATAAATCATTCCTATGACTAGTAATGAATGAGATATGTTGTCCCTCTTTCCTAG
AAGTTTTATTAGAAGCTTTAAGTTAATCATGTAAATATAATAAATATTTAAGTTGACCCA
AAAACATAATGAATTCCTTACCTTCCGTATTTCCTGTTTTTAGTGATTTGTCCTATAACC
AGCTGACCCGCCTGGATGAATCTGCCTTTGTGGGTCTCAGTTTACTGGAGAGACTGAATT
TAGGAGACAACAGAGTCACTCATATTGCTGATGGTGTGTTTAGGTTTCTTTCTAATCTTC
AGACATTGTAAGTGTATCCTTTTATTTTTTGTTTGTTTGTTTGTTTGTTTTCTTGCTCTG
CTAGTGGTTGAGCCAGGGCCTTGTACATGTGAGGCAAGTGCAACTGAGCTACAGCCCAGC
CCCAGTGTGTAACTTTATTATGGTAATGCTGTTGCCTTGTGCCTCAGGGCAAGACAGTTG
TACTTGTTTATATCCCATAAATAAAAATCTTAGGCCTAAAGTAGGCACTTTCTGGGTTTT
TTTTTTTGAGACCAACCCTTGGTATATAGCCTCTTGAATGCTAGGATTACTCATTTTTTA
TTTTAATTATGACTTAGTGACATAAACAGTAAGGACTGCCTTATTTTGCCAGCTGTATGA
AATACAGCTGATAGTGTCAAGAATGCAATAATGGACCAGAGATATAGCTCAGTGGCATAA
GTGCCTGCCTGGCAAGTACAAGGTCCTAAGTTCGATTCCCAGTACCAAAACAATAACAAC
AAAAAAATGCAGTAATTTTCTTGCTTCTGGTCTTGACAGTGTACCAGAACAATTATCATT
CAAAAGGATGTAGGAGATGTAGTGGGAGCAGCTGTGTTCACTATTAATAGTTTGCTACCT
GACTTTGGAAAGATTTTGATACTTATTAGGTGATATGTACCAGGTGGTTTCGAGTACTGG
GATGGTACTATTTCTTTTCCTACTAGGTTGAGGTTTAGGAGAGTAAAATAATTTCTTGGG
TTTTTTGTTTTTGCTTTGTTTTTGAGATAGGGACTCTGCTATACTGTTCAGGTTGGCCTT
GAGCTCACTTTGTAGCTCACTCTGATCTCGAATTTAAAACGATCCTCCTGCCTTGACCTC
TGCAGTGCTGTGGTTACAGGGCATGTACCACTATACCCAGTTTAAAATAATTTCTTAAAG
GCACATACCTTATAATAGTGTTTTGGATCAAGGATTGTAATCTAAATGTTTGATACAAAT
GCTAAGGTGCATTTTAATACCATCAAATAAACAAAATTAACTTATAGCTCCTCCTGATCA
TCATTTTTCTTTGTTTCTTCACTTATGATTAGATAGATGGTTGTTAAAGGCAATTTTAAC
TGTAAAATCCTGTGGTTTGTAAATTGAATATTTTGCCCAGTCATGGAATATAATTTTATT
GAAAGTTGAAGAGGTTTTAAATACTAGCAGTTCCAAATATGAAGCAAAATGAGAGGAAAG
AAAGAAATAGTTAACAGAATTTGTAAATTTGTCTATTAATTTTTGTAATATTAGAAATTG
AACTCAGAGCCTTCTCACTGAGCTACATTCCCACACCTTTTAAAGTTTTTTGTTTAACCT
GGGCATAGTGACACACACCTGTAATCCCAGTATTTGGGAGGCTGAGGTAGGAGGATCACC
AGGAGTTCAAGACCACCCTGAACTATATAGCGAGACTCTGTCTCTCAAAAAACATTTTTT
TTGCTTTGTTTTAATTTTGAGACAGGATCTTGTAAGTGACTGGGCACAAACTTGTGTTTC
TCCTGTGTCAGCTTCCCAGCATGCTGACATTACAGGAGTATGCCACCATGCCTGGCTAAA
TTTGTAGATTTTAATGGCTCCTTAGTAAGAAACTTGGTAGTCATCAGGTTCATAATTGAT
AAATGGTTTCAGAAAAGAGGTAGTCTCCCAACTTTGGTACCTAACCAATGAGAAGGAAAC
ATGTATCTGTATACACATAAGTGTATGTTTTGATTTTTCTTTTAGCTTTCTTCAGATTTG
GCCTTGAAAAATTAAAAAGTCATCCTCTTCTTTCTACATCATCAGGTGAAACTAAATCAG
TGCAAACTCAGAAACTACATCAGAATTTGCTGCAGCCTTTTGACAGTTGAAGGGATGGCA
AGCAGGTTTTTTCAGTATACCCTAAACTGCTTATTACTTTTAGAATTAAAGTTTAGGAAA
GTATCTAAGGAAGTAAATAGTTGTTTAATATCATAGAAGTAAGGCAGAATTAGGATCAGA
GTTGAAACTCTGGCGCTAGCCCAGTACTCTTGTAAGAGTAAACACATCTTTTACTGGCTT
TGTGAGTGACTTCTGCTTATGCCCTGCGGTGGAGGAGGGAAGTTCTGAAGTGACAAACTG
CTGGTAGTTATTCCTTCATAAAATAAACTGTAAGCTTTCACTTCAGGGAAAGATAGCTCA
GCAAAAAGAGGGATTTCCTGCTTCCTTACTGTTACTGACATGACGTTATGTATGTTTTAC
AAAGAGAAAAGCTTTGCATTTTATTATTAGATGGCTTAAGGAAACAAAAGTGATTAAATA
TTTTTAACTTGTGTTTCTTCCATCAGTACATGATGTGGTACAATTGCATTTCCTCTGAGA
ATGGAACAGTGGATTTTAAATGATCCACACTTTCTCTTTTAAAGAAGATACAGTGACTAC
TCTAACACATGGGTGTATCATTTTTGCTTCCCAGGAGGCTTTTTTAATTGCTTTTGAGCT
GTGAAGCTTTGTATTGGTATTACTCTTTGTCAGCCATTTTAAGGGCCCAGAGGGAAGCTT
GGATAACCTGAAATCCCATTAGTGTGAAATCAGATTGTAATCTTTATCTCCTATATTTTG
AAACCCTTTTTTCTTTCTGAAGGGACTTGTCTGTAATTTTTAATAATTGCTAACNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTTGTAACATGATAAGATTGTT
TATTTGATACAGCCAAAAAGTCTGGAAGTGTTTTGACCCATTTTCTTTAATGAAGGAGCT
TTGTTGTTTATCAGTGGTTTGTTGTTAGTAGGACACTTTTTATTGGTAAAACACTCCTAT
GGGTTCTAAGAGAGAAGTTACAGAGTCTTTTGTTAAGAAGAGAAAAAAAGAGGAATTTAA
CTCAGTTTATCTCAGTTTATTAGTGGTCAGACTGGTTGTTCACTGAGCTCCAACACCATA
GTAGAAGCCTTTATGCTGTTCTTTACATTGATTAGTAAGTTCTTCAGTTTATAGCATTCT
TAGAAATGAATGTTCTTATCAATTATAATCTAAAAAATCAATTATACCCCAGTAAACATG
ATAGAAGTACATAAAAAAACACTTTAAGCTTATTTTTTCCTTTTATAGGTGAAAGTTTAA
TGAATTTATTTTTATTTCAGAATCTTACAAGGAAACCAGATTAAGTCAATTACAAAGAAA
GCATTCGTTGGTCTTGAATCTCTTGAGCATCTGTAAGTACTTTACATAGATTTTCACTGT
ATAAATAATCTCTGCTGTTAGCCGAGGTTGTTACAAGCATAAAAAAAGTGTTTATGTGAC
TTAGCTGGGAAGAAGGTGACTAGTAATGTTCCATTTCTCTTCATTTCAGAGATTTGAACA
ACAATGCTATAATGTCTATCCAAGAAAATGCTTTTTCTCATACTCACTTGAAAGAACTGT
AAGTAACTTACATTTTCTCTTTTTTTGATACCAGATCACTGTGTGTGCTTTTGTGCTTGT
ATTGTGATGAAGGTGACCCAGATGTTTCTAGAAGTATGCAGTTTAGGCAGAAAAGAAAAC
AATCTATTAATATTTCAGTGATATTAGTGACTGACTGAAATTTTAAAATATCAAACATTG
ATAATGTAGTTCTAGTGCACATGTTTAGGAAACCTTAGCACTTCTGCCGATGCTTTACAT
ATATGCTATTTCTTTTTCCCCCCTCTTCTCTGTTGCTTTTTGGACCATCACAGTGGCACG
TGTGCACAGCCAGCTGTTCATTATGATTGGAAACTAAAATGTTGCTAAGATTATCAGAAA
TGTGTTCCCAGGTCTTACCCTTTGGATGGGTTAAACTTTAGGTATCATCTGTGATTTTTT
GTTTTTAGTTTGTGAATTGATCTAGAACTTTCAATATAAGTATCAAAGAGAATGTCTCTA
GTCTATTCAAACTGCCAAATTGTTGAAGAACAGTTAGTACTTGTAATAGAAAAAAGGTAT
TTTTTGTGGTGGTGGGCTTTCAACCCAGCGTCTTTCCCCTGAGCTATATCCCTAGCCTGT
TATTTTGGTTTTGTTTTAATTTTTGAAACAGGGTCTTGCTAAGTCACTGAGTTATTTAGG
CTAGGCTCAAACTGGGAAATCCTCCTGTTTCAGCCTCCTAGATCGCTGAGCGTATAGGCA
TTTGCAGCCATGCCTGACAAAAATATGTAATTTTTTACCTTTTAAAAACTCGATTTTTAC
TGTTATTATTACTGTTATTATTACTGTTATTATTTTGTCATAGTTTTTAAAACCACTGAT
CTAATAGTTAGAAATTTTAAAAACTGCTTTATACCATAGATAATCTGAGATGCACTGGAC
ATGTGTTAGATTTTAAACTGCCTAGATTCAAATCCGTGCTCCTGGGGCTGGGAATTTAGC
TCAGCAGCATAAGTGCCTGCCTGGCAAGCCTGTGGTCATGAGTTCGATCCCTGGTACCGG
TAAAAATACAAAAATACAAAAAAATACAAATCCTTGCTCCTTCCCTTAGAGTGTAACAAT
GGGCAGATTGTTTAGCCTGAGACTCAATGTTTTCTATCAAATGAGAATAACAGCTCCTTC
AAGATTATATGCTGGTAAACATAAGATAATTTGTTTATTGAAAGTTATTGTCTACTATCT
GAGGTACTGTCCTAAATGCTAAAAATGCAAGAATAAACAAGATAAAGTTTTGTAGCATAT
AACAGTAAATTCTAAGGAAGTTGGATAATAGGCAGATATAGGATCTCTTATCAGGTAAAT
AGTTTTCTTAAAGAAAAAGTAAAACCAGTTCCAGAGTTATAGAGTGACAGGAATACTTTT
TTAGATACCAGTTATGGAGAAAGAGACTCTTCCTGAAATTACAAGCCTTTGAATTAAAGA
CCTTACTGAAATGAAGTGGCAAAGCATGTGAATATTGGGTAAAGAATTGAGATGTAGTCA
GAGTTAAGCAGGAGTCAGAGCGTGTGAAGCCAAGTAAGCCATGAGGAATTAGATACTTTG
GTTGGATTTGGTTTGGTTTTTCTGTCTTTTGTTTTTCTTAAATCATTAGGAAACTTGGAG
TGTTTGAGAAAAATGCTGTGCATGGCACATAGCAAAAGTTGAATACTATTAACTATAAAA
ATGGAAATGTTGGCTGGGGGTTTAGCTCGGCAGAGTAAGTGCCTGCTTGGCAAACGTGAG
GTTGTGAGTTCAAACCCTGGCACCCCCCCCCCCCGAAAAAAAGTTATAAAAGCCATTATC
AGTATTTTCTGCTAGTTTGTTTTGTAGCACTGGACTAGGGATTGTACTCAGGGCCTCATG
CACGCTAGGCAAGCACTCTACTGCTGAGCTACATTCTTAGCCTTTTGCTAGACTGACTGA
TTTTTAATTTTTATTTTTTGTTTTTTGAGACAGGGTCTTACTCTTCAGTTCAGGCTGGCC
TTGAACTTAATTTGTAACCCAGCCTGGCCTCAAACTTGTAGCAATCCTCTTGTGTCATCT
GCCAGATTGTTTTGTCTTTTAAATTATGATTTTCTGGGTGTTTTTTTGTTTTTGTTTTTT
TTTTTTTTTTTTTTTGTCTTTTTTGTTGTTGTTGTTTTGTTTTTAGTTTTTTGTTCCAGG
GATCAGACTCAATCTCATGCTTGCCAGGCATGCACTTGTACCGTTGATCTATATCCCTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTGACTGATTGATGGG
GGATCAATGGTGAGTCAGACTGGTGAACCATTGCTCTGACAAATGTCCATTGAAGCTGAT
AAGGAAAGATTGATTCCTAATATTATGACTATACTTTCTGGAGCTAGGATAGAGTACCAG
GCTTCTTTTGAGAGGTACTTTCTAGCTGGAAGAATTCTCCCTGGGCTTTATTCCTGAATG
CACAGTAGTCTCGTACTCTCTGCGCTGAATGTATGTCCTGTCACCGTTTGAGTCTTTTCT
GTTAACTCTGCTAGACTCTGTTTCTCCCACTGGAACTGCGGTTACCTTAAACCTGTTTTG
AACTCCTGGTGACTACATGTTCTGCTAACTTTTTTTTTTTGGCTCTGTAGTCCAGGCTGG
CCTTGAACTCACTATGTAACCCAGACTAGCCTCAAAGTCATGGCAGTACTCCTGCCTTAA
CCTCCCAAGTGCAGAGATTACAGGTGTGTGCCACCATGCCTGGCCAGCATGGTCTGTTTT
TCTGATATGAGTATTCATTGCTATAAATTTCCCTTGTAGGGCCACTTTCATTGTGTTCCA
TAAGTTCCAGTATGTTGTATTGGCAGTTATCACTTAATCATAGAAATTGTCTAATTGCTT
TTTAAAATTTCATTTGTGACCCATTGGTTGTTCAAGAGGCTGTTATTTAAGTTCTATGTG
TTTATGAAGTTCTTATAGTTTCTTTTACTGCTGATTTCCAGTTCATTGCACTCTGATCTG
ATAATATGCATGGGATAATTTCAGTACCTTTGCATGCACTTAAGCATGTTCTGTCAGCTT
ATGTGTAGTCTGTTTTGGAGAATTTGCTGAGTACAGTTGAAAAAATTGTGTATTCTGTTG
TGAGATGGAACATTCTGTAGACATCTATTAGGTCCGTGTGTTCAAAAGTTTGGTTTGGTT
CTGGCATTTCATCGTTGATTTTTGTCTAGTTAATCTATTTGTCACAGTGAGGTCCCCCAT
TGCAATTGCATTATTGTTTGAGTTTTCACATGTTCCTTAACATTTGTTTTATATAGTTGG
TTGTGCTGGTATTTGGTGCACATATATTTATGNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATGCATTTTTTTTAGAAAAGTTGAG
CAGAAGATTACATGTTTCAAGACCAGTCTTTAAATTAGTGAGACACTGTTTCAAAAGATA
CAAAAGGCTATGTCTACTTATTTTTCTGTTGCTGAAACAAAATATACCATACTCATATGT
GAAAGAAATCCCAGTATCACATACCCTAATCCAGCCACCTTCAAAACTCTCCACCTATGA
CTCCATGAGGCTTTGGAGAATACATCTAGATACAAGCCACAGCAGGCTGTGTTTCCTTAT
TTATTGCTTGCTTGGTCCAAATACACAAGCTCTGTCAGAGCTGTCCTTCTTTTGCGGGGG
GAGGGTTGAGATAGCATCTCACTATGTAGTTCAGGCTGGTTTTGAGCTTACTATGTAGTC
CAGGCGATTTTTGCATTTAATTGTCCAAACAGTATTAACACAGACCTGTCAATGAACTCA
GAGAAATTCAGAGAAATTAGTGATATATGTAGTTTTTTTTTCTAATCAAAGATCATCTGT
GACATTTGGTTGTAATGTCTCTTAGCCAATTTGAATTGAAAATGGTTCCCTTGCTCTTGT
TTTCCCTCTTTTGATTTTTTTCATTTGGAGAATTGAGGATGACAGTTGGAATTTTTTCTT
ACAGTTAAGATTAAACAAAAAATTTGGTGAGAAAAAGGCATAAGTTTGTATCCAAATTTT
AACACTGAAGAAACTTCAAATGAAGAGCAAAACAAAGGATAATTTTCCTCTTTTTTTATA
TAGGATCCTGAACACAAGCAGTTTGCTCTGTGACTGTCATCTGAAATGGTTACTTCAGTG
GCTGATCGATAATAACCTTCATCATTCTGTAAATGTAAGCTGCGCCCATCCTGAATGGCT
AGCAGGGCAAAGCATCCTGAATGTGGACCTAAAAGATTTTGTCTGTGGTTTGTATTTTTG
GTTCTAAAATTTTTAATTTTTAATTTCTAAATTTATTACAGAATTAAAATTTTCAAAATT
TATTAATACATGTTTGGCAGTACATAATGATTACNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNGCACAGAGGCATCTATAGTCAGTATCTGAAAAATACCAGTACAAAT
CTTTCTCTTCAGTGAACTCAGAAAAAAACAAAGAATCTAATGCAGATTAAATTCTGCTTA
TATTGTCACTCATGGTTCTAAGTGTAGATGCATTGTATATTTTATTGTCCATTCCAACTT
TTATAGCCCAGTGAAGTATTAGCACTGAAAGTACTAGATAAGAATTCATAAACCATCTCT
GAGTCAATCCAATAACATTGTATTTATGAATGTAGAGTGTGTTAGCCAGTCTTAAACTAA
TGTTCATTTGTACATTTGCTACTTTTGGAATTCTTCACTGTTTTGGAAGTTTTAATCCTC
ATTTGCTACTGATTTAATATCTTTGAGCAAGCCATTTGACTTTTCTGGGCTTCATTTTCC
CCATCTTTAAACAAGGGTATTAGGTGGTAGCTGTGTAGTCTCCTTCAGCCTACACATTGT
TTTCAGAACTCTTCAGTTTCATAGTATTTGTTTTAAAATTGAACCTTAAGCAAAAATAAA
TAACTGACTTGACTACTACTGCATTTTTTCCTCTCAGATGATTTTCTGAAGCCACAGATA
AGGACTCATCCTGAAACCACAGTTGCTCTAAGGGGCATTAATGTGACTTTGATCTGCACT
GCAGTGAGCAGCAGTGATTCACCAATGTCCACAGTGTGGCGCAAAGACAGTGAAATTCTG
TATGACATGGATATTGAGAATTTTGTTCGTTATCGGCAACAGGCTGGAGAAGCCCTGGAA
CATACTAGTATTTTACATCTTTTCAACGTGAATTTCACAGATGAAGGAAAATATCAGTGT
ATTGTTACTAATCATTTTGGATCCAATTATTCTCTGAAAGCCAAACTAACTGTGAATGGT
AAGGAATTATTCTTGATTTTTTTTGTTGAAACAGGGTCTCATTATACAGTTCAGGTGGTC
ATCCTGCCTCAGCCTCCCAAGTGGTGGGATTATAAGCATGTGCTGCCTTACCTGGCTTTT
TTTCTTTTCTTTTTTAGAAGGGTTTTTCATGATCAGTTTTAAAATCACTTAACCAAAAAG
ATCAACAATAAACCTACATTTGAGGGAAAGAGGGGAAACGATTTTTGGATTAACTATGTA
TCTACTTATCCCTAAATGATCTTTACTTAAGAGGTAAATCCTGTGACCCTAAGAGATGAG
CTACTTTTGTGCTTTGGGGATCATTCTTTTCAAATTTTCAGTTTTCTTTCTCATACCATA
ATTCTCCTCTGAAAACTGAAATTTATTCCTGGAATTATTCACACAGCCATCTAATAGAGA
ATTTAGGACATTTCTGAGTCCAGTTATTAAATGTATTTATACTGAATCATTTTTGAAATT
TATTTTTGAAATACTATGAAATCTTATTTCCTGTGGCTGCAAAAAACTTCACAGCAGCTT
GATTTATTGCCTGTCAAATGAGTTAACTGCAACAGTTTAGGCTTTATACATCCAAAAGGT
GGGTCTTGCTTCTGTGTTTTTGTATTTTTGTTTTTGAAATAGGATCTTACTTTGTAGCTC
AGGCTGGCCTTGAGCACTGCAACCCAGGCTGCCCTTGAATTGACGATGGTTTTCTTGTCT
CAGCCTTTTGAGTGTTGGGAATACAGATGTGTACTACTCTGCCTCGCTGCTTCTGAGCTT
TTAATTGAGATTCTTTTAAAGACATAGTTTTTTTGTTTTTTGGTTTTTTTAATTTGTTTT
TTGGTACCGGGGGTTAAACCCCTGGCAGGCACTTAGGCTGCTGAGCTCAATCCCCTCCCC
CCTTCAATATGCATTTCCTTTGACTACTGTGCTGATGTTTGGGAAGTACTATATAACTTT
GTAAGGGAATAGCATTAAACAGTAGGTTGTAAAATAAGGAATTCAGAATGACTTAGGGCC
TTTGCTGTCCCTGTTTCCATCAGGATGATCAGATAGGCATGTTGTACATTCTGGAAGAGT
TAGGTGTCACCATTCAAAATACTGTACTCTGAGGTTCTGAGATAAAAAGATCATCTCTAA
AGCTGTTTCCACTGTTATTTCAGGAAGCATGTATTCTCTAAGAAATGGAGCATTGTAATA
GTTGTTATTTTGCTGTGTGTGTGTATGTATACCCTCTTGCCTACTTTTTCTTGATGATCT
TTCTGAAACAGAAATGCCATCTTTCTTGAAAACTCCAATGGATCTAACTATTCGCACTGG
TGCCATGGCCAGATTAGAATGTGCTGCAGAGGGACACCCTGCACCTCAAATTTCCTGGCA
GAAGGATGGTGGTACTGACTTTCCAGCTGCTCGAGAAAGACGTATGCATGTCATGCCAGA
GGATGATGTCTTCTTTATTGCCAACGTGAAAATAGAAGACATGGGAATCTACAGCTGCAT
GGCACAAAATATAGCCGGAGGCCTCTCAGCAAATGCTTCACTAACAGTGCTAGGTATGTT
TATACTTTACTCATGACCACACACTTGTAAGGCAGATGCTTATGCCACTGAGCTAAATCC
CCAGCCCTGTTTATGCTTTTTAAGAGTGTCTAATTTTTTGGCAACATTGAGATGTACTGT
TGGTCTTTATGGGCCTGCAAAATAATTTAAAGTTCAGTTGTCACTCTTACCTTTGTTGGT
ATTTTGCTACTTTTTGGAGAGTTTTATCAGCATAGGACATCAGTGGGTCAGATATTTGAA
ATTTGGGAAAATGTTGAGGGCAAAACTAGGGTTGTTTATCACATAAATTAAAAATTCAAA
ATCTTTTATCACTGTATTCTTGTATGTATGTCTTTCTCTATTACGATTTCTTTTTCTTAT
GTTTTTCTACTATCCAGTGAGCTTGTGTTTCTTAGAAGTACCCAGCTATTTGATGTTGCT
TCATGCACTGGTTCACAAAGAACCTAGGCTAAGTTTGTTTTTTCCCTAGCTAATTAAAAT
AATACAGAAAATTTTTTGCCTGCCTTCTGATGAGATTTTTCTGTTTTCCTTCCAGTGTGG
CTCTCATAATCCTGTTTTTTTTTTTTCAGAGTTGCAATTAAAAACATCTTTTTAATTGAG
TATAACTAGCAAAGTTGTATATATTTAAGGTGTGTATTTTTGTTTGTGTGTGTGGCACCA
GGGATTGAACTCAAGACCTTGCGCTTGTCAGGCAGGCGCTTATGCTACTGAACTAAATCC
CCAGCTGTAATTTTTTTTTTTTTTTTTTTTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNATTAAGGAGAAAAAGAAAAAAAAACAGAAAAAGGGTATAAGTTATACA
GAATTTCAGAAAGAATAAACAGTAGGGAATCACTAGTTAATTACATATTGTTATCTTAGA
AATAGTTGTTCAAGTTACAAAATTAAAGCATGTGGACTTTCAAACAGTGAGACTGCAAAC
AGTTTTGTTCGATGATCCAACAAAACTCAGTAATATGGTTATCTATCTTATATACTTAAA
TATATATGCAGTTATATCCTTTAGAGCACTTTCTTTTCCTCTCTTTTGTACAATGACAAT
TACACATTTTGGGTTTTATTACTCCCACAGTTCTTACTAGTTTTTGAAGAGAGTAAAACC
AAATGTATCATAACAGAACACAGTCAGTCAAATCAAAAGGATGGACATAATAGATAATGT
AAAAACAAAATACCAGGTGATCAACAATGGTTACTGTACTGGCCTAAGGCAATTCTTAAT
TTTCTGCACTTAGAAACTTTCTTTTTGGTACGAGAGTCAAACTCGGGACCTTATGCTTGT
CATGCAAGCGCTGTGCTACTGTATCCTTGGCCTGGAAACATTGTATAAAAACACAAGTTA
AATACTTTTAAACAGAATGATGTGCTCAGCATATTATTTCTAGAGACAGATTAAAACAGT
TAAGTGAATATCGTGATAGATGATTTCTTAATGCATTTTTTTAAAAAATCAGCAATGCCA
TAAATGCTGTTGTAACCTGCTGTTTCATGTAAGGGAGTATCATGGATACCTTTTCAGCTC
AATAAATTTATTTCAATACGATATTTTAATGACATAATAGTTTTTACCGTCACCCTCTTA
CCTCCAGTACCCGCCTTATAGCCCTTTCCATCCATATTCCTTTTCAAGGAAAATGTCTTT
TCTTTAAAAATTTCTCTGACTAGCATTTTTGTTGTTCTGTCAGGGGTTCTTTTTTATTTT
TAAAATTTTTTTGTTGGTATGTGTGTATCAGAAAAATAATTCATTGATGTAAAATTCTAA
GGTATAGAAAATTAGAGTAAGATACTCAAAGATTTTAGCATAGTCTAGATTCCTTTAAAC
TCATTTTTGTACATATAATTAAGTATACATGCTTCTTTTCCTGTTTAATACTATATTGCA
AGAATTACCCTGTCATTAAAACAAAATCCTTATAAAACACTGTGTGACTCTCCTATAATT
CACTTAATCATTTTCCTGTTAAAACTTGATATTTTCCTTTGTTTCTTTTCTTTTCTTACT
TCTCTTTTTGAGAGTTTCACTATGCATTTCAGGCCAGCCTTGAGCTTACTTTGTAATCCA
GGATTGCCTTGAACTCACTCACAGCAGTCCACCTACCTCAGCATGCCTGAGTGCTAGGAT
TATAGGTGTGCACCACCATGCCCCATGTTCCTTTATTTTTTTTATATGTTATGTTATCTT
TATTCTGTTACGTTATTGGTACTGGGATTGAACTCATAACATTGCGTTTGCCACACAGGC
ACTTGTGCCACTGAGTTAAATCCCCAGCCCTTGCTTTACATTATTAAAATAAACATCTTT
GTATATAAATTTTTGCACTCCATGAGATAACTTGCCCAGGGAGGTTATTGAGATAAGATT
TGGGGCTTTTTTTTTTTTTGCTCTATTTTATCTGTTTAGGTTATTTTGGGGGGTGATACT
AGTGCTTAATACAAGGGCCTCAAACATGGTAGGTAAGTGCTGTACCATTTAGCTACACCT
CTAGGCTCAGAGTTAGGTTTTTGCATTTTTCAAGTAGAGTCTCACTATGTAGTTCAGGCT
GGTTTTAAACTCAGTGTGTAGCCCAAACTGGCCTCCAACTCCCAGTGATCCTGCTGCCTC
AGCTTCACAAATAGTGGGATTACATGCGTGTACCACTGTGCCTGGGCTTAGATTTAGGTT
TTCATTTGAGGCTTTTAGTTTTCTGAAACACCTTCCAGTCCTTCCATGAGTATATGAAAG
TGTTCATTTTGTCATGGGTTCAGTAGTCTTAATTCAGTAGGATTTGGGGAATAAAATTGC
CTAACTTGATTTTTAAAAATTATTTCTTGTTAGAGACACCCTCATTTATTAGGCCTCTGG
AGGACAAGACAGTAACTCGAGGTGAAACAGCCGTGTTACAGTGCATAGCTGGAGGAAGCC
CCGCCCCTCGCCTCAACTGGACTAAAGATGATGGCCCACTGCTGGTGACAGAACGACACT
TCTTTGCTGCGGCCAACCAGCTTCTCATCATTGTGGATGCTGGGCTGGAAGACGCAGGGA
AATACACGTGCATTATGTCTAACACTCTTGGCACAGAACGTGGCCATATTTACCTACATG
TCATTTCATCCCCCAACTGTGATTCTTCTCAGAGCAGCAGTGGGCATGAGGAGGATGGCT
GGACCACCGTTGGCATTGTCATCATTGTTGTGGTCTGCTGTGTTGTGGGCACCTCTTTGA
TTTGGGTCATTGTTATTTATCACATGAGAAGGAAAAATGAAGACTATAGTATCACAAACA
CAGGTGAGTAGTTCCCAGATGTGGCTCATACTTGAGTTAAAATATGGGATAGGATTTATT
GGAAAAATGACACTGAGGAACTGTGATGCATTACCTGATAGGAGGCATAAGGAGGTTTTT
CTTTTAAAATACTAACTTCCTTGAAAGAACAGAACCTACTTAAAATAGTTTTAACTATTT
TAAGAATTTATACTGCCCCCAAACTGCACTCTATGAACTGTTACCTATTGCATCTTCTTT
CTTTAACATATTCACAAGGGCCGAAATGTGTGTGTCTCACTGGTGGCGGCTCTGATTTGA
ATGTGTTAGATGTTGCCTCCAGCTTGAACCACTGGTGGTTTGTGTATGGCTGTCCCACTT
GGTAGCATGGGAAAGCTGCCTGATGGGTCAGTCATGCCTGAAACCTCAGTACTTCAAGTG
ACAGGAACCTTCATGGCTTAAGTCAGTCTTTTACCCTCCTCACACTGAAATCTGCAGGAG
AAGAAGATCCAGTCAGCAGGATTGTGGCTCTAGGTAAACTTCGACTTTAGGGTTTGTTTC
TTTTGGTAAGCCCCACCCCTCCTTACTACTGGAAATTGAACCCGGGGCCTGTGCATGCAG
GGCAAATGCTGTTACACTGAGTTATGCATCCCCAGTCTTGGTAATAATCCTAATGTGAAA
CTGAGGACTCCAGTGTAAAATAGTTTTAGGGAAAGTATGAATACCTTGTGGTTCTAAGTC
CATACCATTTTCCTAGGCAGTTGTATCACAGTGGAATATGCTTAGAAAATCGTCTTCTGA
GTGTTAGCATCAGCTGCTCACCTTGAGAGTTACAGTTGTCTCTTGTTACAGAGGAGCTCA
ATCTGCCTGCAGACATTCCCAGCTATTTGTCTTCTCAAGGAACGCTGTCTGAGCCACAGG
AAGGCTACAGCAACTCTGAGGCGGGCAGTCATCAACAGCTTATGCCTCCTGTCAGTGGGT
TCATGCACAGAGGCACTGATGGTAAGGGCTCTTTGTTCATGTTTACAACTTCACCCAGGC
CTCTTGGGTTTATGTTTCCGCATGTAGTTTCCACATTAACCTTAAGTAATACTTTAACAG
TAAAATATTCAATGTAAATATTTGACCACATGCAAAATTAAAATCTTAACAAGTGAAGAA
GCCCTCTTACAGAAGGGAAAAACACATTGTCCTTAAAGAAGGGTTTGAAGTACACAGCAG
AATTTGCTAAACCTGTATTAGTATGGAAGGGCTACAGTGCTTCTCAGCATAAAATGAAGA
CATCTGAAAGATATAAAATGTTTCTAGTTAAATGAATCTGAGCTAAGGCATGCAGAGCTT
GTCTGTAGTCCCCATAGAGTCTGAGGCAGGAGGATTGCTTGTGCTTAGGAATTCCAAGAT
GAACCTGAGCAACATACCGAGACCCAGTTTCCAAAAGAAGAACCCGACTTTCTCAGCACT
CCTTCACGCCCTCACTTCTTAGGAGAAATGGAACATAGGGAGGTGAACTAAGGGATAGTA
ACACTAGGTTTGATTCCTGATACTTTCCCTTCTTAGACTGTAACTGTAAACAGGGTACAA
GATCTGCACTTCAGTTGACTCATTCTTGAATAGAGAAACTGCTTTACTCAGTAGGTCCCT
GAGATTACCACAGATCCTTTCTCAACAAACTTTTGTGATACTTCAAGTAACATGTTGATA
CAAGATTTTTTTGCATTTCTTCAAAGATTTCTTAGGCTGAATTAACATAGAACTCCTCTA
ATCGATAAATTGGATTTTATTGTGGCTTGTCATAGAAAAGGGTGTATTTCTAGGCAAATG
CTGTACCAATGAACCAAATCCAGAGCCATATCGCCTTTATATATAAAAAAGGGATATTTC
TGACTTTCTGAAGAATATTTAAAAGCTTTTATTCTTTGAAATCTGTAGGAAATAACTTTG
CTTTCAGGATTGAATGACATGATTTCTCATTCTGTCCAGTTCTAGCATTCTATTGATCGA
TGATGAATAAATGACTTGCTCTTTATTGCTTACATTTTTTCCTTCATCTAGTTTTCAAAG
TACATGACAGTCCAGGGAGCTTATTATTAAATTCTGTTATCTACAAACTTGTCAGACAGG
ACTCTTGACTGGGGATTCTTTCAGCAGTAAGTGTTGCTTAACCTTTTGACACATGAAAGT
AACAAGTCTTATGAAAATGAAATCATCAAAGCTTGTTTCCTACTTTAGTCTGCTTAGGAG
GCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTTTGTAGCTCAGGCTGGTCTTA
AACTTGCAGTGTTCCTGCCTCAGCCTCCTGAGTGCTGGCATTACAAGTGCACACCACCAT
GCCTGACTTTTTTTTTTTTTTTGGTACCAGGAATCAGGATCTTACACTTTAGCCTGGGTT
TAAATTTTAGCTCCTCATTCTGATAATATTGCTTCAGTCAAATTACTCAGCTTCTGAATG
CTATACTTACTGTATTTGTAGAGATCACTGTATTTATTATTCCTATCATAGTACCTGCCC
CAAAGGAAAATTGTGAGGATTAAATGAGTTAATTCACAAAAAACATTGAAACTTCACACA
GTTTATAAAATACATAGATAGCTAGCAATGACAGTGATAACATGATTGAAAAACTATTTC
CTTAACAGAAAAAATGTTTTTGTATTCTTTTCCCTGTTGTCATTAGGTGGCACTGGTACC
CGGGTGATCTGCTCAGATTGCTATGACAATGCCAACATTTACTCAAGGACTCGAGAATAC
TGTCCATACACCTATGTCACTGAGGAGGATGTTCTAGATCAGACACTGTCCAGCCTCATG
GTCCAGATGCCGAAAGAGACATTTTTGTCATGTCCTCCCCAAGATGCTGCTGCCCTGGAG
AACTTAGTATCATTGGCCAACAGAGAACTGTCTGCCTTACCCACCAATCATGAGAGGATA
AGTGAAAAGAAACTTCCCTCCACACAGATAAGCAGTGGTAAGGAGTGCTTCAGTTTTGTT
TTGCTTTATTTTGCTTTCACCTCACCTACTTCATCTTGCCTTTTATGATATAGGTAACAT
TCTCATTTGACAAGAAACAAGCAAACGGATATACTGAAATAATTGCCTGCTATTAACTAG
TATAAACTAGATCCAGAGACTATTTTATCTGTTGGAGTTATAGTCTTCATCAGCACGAAA
AAAATAAGTTCTATGAGATAATAAGATCACTCTACTGACAGTTCAGAGGCAACACAGAGA
ATTTAAAAAGTTTCATAGATGGTGTTGATATTTTCTCTATCTTTATTTAAATGACAAAGG
TTCAGAATCCTGAGAATATAACTTGGGCATGATTCGAGGAACATTTTTATTGAAAAGAAT
TTAAACATTTGATTTTTGGGGCCGGGGATTTAGCTCAGTGGCATAAGCACCTGCCTGGCA
AGTGTGAGGTCGCAAGTTTGATCCCTGTTACCAAAATAAATAAATAAGTGAATGAATGTC
TGTATGTATGTTTGCTTTGGTTGCTTTCTATTTGGCAAATACTGAATCTTAGCATCACCT
GGCAGATATTTCTTTGTGCTGCGCTGGTTAGGGCTATAATTGGGAAGGCAGTTTTGGGAT
TGTGTTTTCTTTCCTACCTGGCCCAGGAAGATAGCATTGCACAAGTATAGGTGATGCCTT
TGATAACAGTAGAGTGAAATAAGAGTCCTTCCTAAACTCGGAAGGATGCTGTTGAGCGTG
TCTTCCTAGCCATTGGGGTTTTCATCAGTTGTCACCTCCTGTCAGCCTGAAGTGGAAGAA
CACTGCACATGGGGCAGGGGCAAGAATTACAGGTGTACAGGAAGATAAAGTGTACAGTGG
TGCTTTCAGGTATGGTTCTGACAGAAATAATAAAATGTAGCATGAGATATAAGATGTGCT
CTTTTATTCTTGAGACCAGCTCTATAAGCATTTCTTAGGAGCATACAAATCAAAGAAAAG
TACTAGTTTTGAAGTTAATTTCTTATCTTTACATTGAGTATCCATGAAAGCAGTGTCCCA
GCACCAAGTCTATTTTGCCAAGTCCTGGAAGAGTTACACAAAAAGAGTTTAAGAACTAAA
AGTGCAGCACCTCTTGTTTTAATTCAGGGCTAGAGATTGAAAAAAGGGTCTCATATATGA
CTGCTAAGCACACAGTCTCCTTAAACTGTATGCCAACCCTGGTACATCTTTTCTTTACCC
TTGAGAGGTTTCACATTTTGAATCTAGCCTGTAAGTAATGAAATTAGGAAATGTGAATGT
TTCGGTCCGTTTGTCCATTTTTTACCTCAGGTACTTTAGATTCTTTCTATATGAAGTGTG
GCCTAGAGTCTTATCAGTGTCATCATTAATCCTAGAGTTTGTTAGAAATGCAATCATGTT
TCCTCCATAGATCTAGTGAATCTAAATCCACATTTTAACAAGATCTGCACGTTATTCATA
TGTACATTAAAGCCTGAGTAATCCTACTAGAGCTTACTTTTCACATGGAATTTATTTTTA
TTTGTTGGTGTTTATTTTCAGAATGTTAGGCTAGCTTTTTACAGAATGTACCCCCATGAA
ATTAATACATTTTTTAATAAGCAGTCTTAGGGAAAAGAACCCATTAGTGCTGTAAATAAG
AATGAGAAATGCATATTTTTAAAACCTAAGTACAAGTAATCTGATTTCATGTAGCTGTTT
TTAATTACTGTTTGTTGGTTATCATTTGTTTGGTTCTTTTTGTTTGTTTATATAACTTGA
TTGAACTCAAGGACTTTACATTGACATACATTTCAACTCCTTTTTATTTTTGATTTTGAG
ATGGGGTCTTGCTCAGTCGCTAAGTTGCCCAGTCTGAGTTTGAACTTAAATTCCTCCTGC
CTCCGCCTCCCAGAGTGCTGGCTTTATAGGCATGCAACATCATTTCAGGCTTGTTTGGTC
TTATTTACTAGAAAGTTGAAAGAGAATGGTTGTTTATTTTTAAAACAATTTAAGAGCATA
TTTAAGAATATAAGTAGCTATACTTAATCAATCATTATTATCTATGTGTCTTGAAACTTT
ATTACAATATGGATACCATTAAGTGTCTTTAGTATTTTCCTATGGATTTAAAGTTTTATT
TTTAAATTTTTGAAACAGCAGAATCATGAAAATAACAAGTGAAAGAACATGATTCATAGG
CATAGTTTTAGAAATTATTTTATTAGTACATTTTTTCTAGTATATACAGTGTACAGTCAT
CTTAATGTGTACATACCCACAACTTCCTCTTTTTTTGAGTTCCCTTTCCCTTCCTTCCCC
TTCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNTCATGGTAGTGAGAACACATAAAATCCACACCAGAATGAAATTTGGGCAGT
GACTCAAGTTAATCTTGTATTTACTACCTCATAATTCAGAAGAAACCCCAAAGTCAGCAT
GTGCTTTACTCTTAGTTTATGATTACATCTGACCACACCAGGGTAGGCCTGCTATTTGTT
TGGGCTTATACTTGACAGGGAAAGGGTAGCAGCTGGCGGACATGAGTGTATGAAGTTGAA
GATAAGTGGCACTGGCAGAGTACTTATGTACAAGTGGAAGAGGAAGACGTGGAGCAGATG
TGTTTCCTGATGGTTCCACAGGAATGTGCCCAGATGTGTATTGCCTATCAGGAAGTGTCT
CATTGCTGCTTAATCTGCTGGACTGTCCTAATTCATGGATTGATCCTGCAAAAGCTCACT
GCTTTGATGTTCTAACTTTGCTTTCCAAGGAACAAAAATAACTTTGGAGCCCTCTGAGAA
GTGTACCTGGGGTCCTTCAGTGGGTTTACACAGGTAGAGACCAGGGCTTTGATATTCAAG
GTCCTTGGCAAGATCCCAGGTTTGACTAGCTGGTATCAGGTCAAAGGTTTTTGTATTCTT
GTGAATTATTATTATTATTATTTGTCCCTATTGCCTAGGGATCTCATTGTAAATATATGT
GCATTTATAAATAATTTTTCTATTCTTCAACTGTGTGTGTTGGTGGCAATGTAAATATTT
TTGATATGCCAAAATTATATATAATGTCTAGTTATTGTCAGTAGCTTCTTCAAAAAAAGT
TTATATAACTTAGTCAAGTGAGATATAAAAACTTTGTTTAAAGAAAAACCGCTTAGAGTT
CTGAAAACTTACTGTTAAGAAGTATATGTGTAGAGGCAGGGTACATAGTAATTGCATACA
CACAAACACAATCTTGGTATACTTAACTGCTTCTTTCAAGCATAGAGATTCATTTACCTA
ATCGTTTGTCACTTGTATACAAGTACCAGGCAAGATTCCCTTTGTGACATAAAGCCTGAC
AGTTTGTCATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1236, 13280..13345, 15861..15935, 17371..17505, 19165..19308, 19431..19574, 21112..21255, 21463..21606, 24515..24595, 25340..25411, 25549..25617, 46503..46666, 47437..47757, 49031..49312, 52233..52682, 53511..53660, 55606..55896, 58542..58748, 58751..58770
1001..1236, 13280..13345, 15861..15935, 17371..17505, 19165..19308, 19431..19574, 21112..21255, 21463..21606, 24515..24595, 25340..25411, 25549..25617, 46503..46666, 47437..47757, 49031..49312, 52233..52682, 53511..53660, 55606..55896, 58542..58748, 58751..58767
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved