Cavia_porcellus Locus RPS8
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPS8
Cavia_porcellus
RPS8
GeneScaffold_3929
SNORD55, SNORD38
1226..1305, 3094..3162
3898
atacttgaagcacaatgatgctcaactgaactctaagcacttttcggttgcaccaaccc
tggtgcaagccttgacacgatctcgttttgctgccatgtcgcccagcctgagctcaaact
ttatttgcactacccgggatgaaacccagtgattcggcacggagctacgcctccagacct
ttctcatcgcagtacgtgaggagtctacctaaaccacaaaggtgcccagactgtggattc
tctgctgccctaagtgcggggatacaggcgtgtgccacccacgcccggtttaaaactttc
tatcctcctacctcagcctcccagagtgctggattacagaagcgcaccactacgcctgat
ttaaaacttttccgcttctatttagtgcggcgtgttcgccctctcatcccgccgaagatc
gggttgtacaggacgcccagccagcaagtcccgtgttatccctctctaaacactaggtcc
tgcgccagaaagcgcgagcttcatctggtctccacaatgcccggaagagacgcaaaaggg
gcggggcaacgtctcacaaatcgaaccgtgagcctttgcgtttcctctttccagccagcg
ccgagcaatgggtgagttctcgtttgctttcctgcggcagggggtgagtttaatccggtg
ccatccttacccgcgccaaaatttaggagtgcaaacactcaggtccctggctgcgaacaa
ctacgagggatgataggccttcgtgttttggcttccggggcccactgtggggtctccaag
ggacccggggctgccctctgtgctaacatggctgccgctgcaaacagcaggccaggccgc
gcgtgtatgatgacacctcggtaacgctgcgtactcccgactgagcggtggggaagcaaa
ccttggagagctgagcgtgcggcgggccggtgcggggggctccggaggaggtgagccgcc
gtcgccgaggccgatggctccagctgtcttacccgctcccgCATGCAGGCATCTCTCGGG
ACAACTGGCATAAACGCCGCAAGACCGGGGGCAAAAGAAAGCCCTATCACAAGAAGCGGA
AGTATGAGTTGGGTCGCCCTGCTGCCAACACCAAGgtgggtgctgtgtcgacccttacgt
gtggctattatgggttttaccttgggcctgtggtttctttgttttccccactgagtagtg
ccgaataaactgaagggacaagatgccttgtgcccctgccgggagagcttaacatcaaaa
ggagaccctgtgcactgggactcaggagggcttctggtcaggcatcttccccgggataat
tagaattgtggtatttttgtgataatttttccgcatttggggacaggttttcctacttac
aggcaacaaacgtgatgaaaaaagtatccttaggtgtggttgtggccgtcttggtcacta
gtgtgccacttgccaatgcgaggacttgtcatagttacactgaaccgttgcctccgtcca
gcacatattcccctcctgtgacctgcagtacttgataaccaagttcttgtgtttcccagA
TTGGCCCCCGCCGAATACACACAGTCCGAGTTCGAGGAGGCAATAAGAAGTACCGAGCCC
TGAGGCTGGATGTGGGAAACTTCTCCTGGGGCTCTGAGTgtgagtggggcctgtggaagt
gggtggtttcctaactcctgaagcctgatgggttggagttgattctggaggcttggttgc
caaatacctctgaaaaggtgaggtaatataaaaaaagctgatcctctgtggttgtgtggg
gtcttgggaaagacgcgggagggcaaaacagttgtcttgtggtttacttgacttgattct
aaatctcctgagcagGTTGTACTCGAAAAACAAGGATCATTGACGTTGTTTACAATGCAT
CCAATAATGAGCTGGTCCGCACCAAGACCCTGGTGAAGAACTGCATTGTGCTCATTGACA
GCACACCGTACCGACAGTGGTACGAATCACACTATGCACTGCCCCTGGGCCGCAAGAAGG
GGGCCAAGCTGgtgcgtgttccttctgtttggggctgagggtactgtggcctgagccttc
tcgtgatgaagactgttcagttctgctgctgaagggggagtgatgaaaccttttagtgct
gaggaaggcaggcatgagggtgtttggagtttgagaaagttctgatatcaggtcttttct
gagctagtcaatgtattctctctactcagACTCCTGAGGAGGAAGAGATTTTAAACAAAA
AACGATCAAAGAAAATTCAAAAGAAGTACGATGAAAGGAAAAAGAACGCCAAAATCAGCA
GTCTTCTGGAGGAGCAGTTCCAGCAGGGCAAGCTTCTTGgtgagacagcctttgtgctgg
ggaggtgggactcacggcaatgtgcaatacacactttgtcatatccttgccttaaagttt
atttgactgccagttgtgtggtctagaggacttggctgctgggttccaggagtatttcca
gaagtccattctcaagttgatgggggccgtcttaatgatgaaaactttgtccagttctgc
tactgacttcaagtgctgataaagtatatctgacaagattgtgggcttcatgcctgcccc
ctagggtgccaaggaccatcatggatttttttttttaaaggatacagttgggtggggttt
ttttgtcattttggtaagggccacatattcttttgcagCCTGCATTGCATCAAGACCAGG
CCAGTGTGGCAGAGCAGACGGCTATGTGCTAGAGGGCAAGGAGCTGGAGTTCTATCTGAG
GAAAATCAAGGCCCGGAAAGGCAAATAAACCTTCCCTCCTTGATTAGTTCATGTAATAAA
GGTGTTTATTGTTCTATGTtcatgttgtatgaagtctgtaagtttgtaaagatcctgtgt
ccctttcgtttgcatacaaacctaggttgtaaatatttgggtaagattatatgtgtgtgc
tagaggtcaaagccagggccttgtgatcactaagaatattctgtaccaccacactacatc
cccagcaggtaagtgtataacctgaatttgtggatggtatggaaaccttgaagttgtatt
gaatctactgcattggtgaaagcaggttaagtccctataccccttgccagccagaatttt
taaatgtctaggatactagtgatttttgctttaagaaatctttgttctcaacttgccgtc
atcagcatccaagtgttatggtttgctgggtgctatttttagcgtacacccataatcttg
gcccttgggaggctgaggcaggatcacagtgatttttgaggccagcctgggttacatagt
gagaccctatctcaaaataccaaaaacaaaaaaaatttcatctttggaaagtttgcctaa
acttcaaaattgtctgatttgaacttggacttctcaaggcttgttgaaagattcatctac
caccagcctctcaactttaccatcaataccaaagagttatcgaaatacaattgctctttt
gagatgggatttctgtgtattccagggtggccctgaattcactatgtaacctgtgacagt
cctgccttggtctcctctaagctgagactgtaggtttgtgctaccacaccaggcttctga
acatactctggaattccacatgtaatgttgccaaatgttggttgaacttgggtcttgatc
tttattttggtccctttttttgcagtgacatcatacttacatacttgtcacttaaaaacc
ccttttttaggtgatgctaggaattcagtgaaccctagggccttcacactgaactgtata
tctctaatactttcttttttagtacccaggatttaactcacaaccttgtgcttaccagg
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1114, 1559..1658, 1875..2050, 2249..2378, 2738..2898
1002..1114, 1559..1658, 1875..2050, 2249..2378, 2738..2847
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved