Cavia_porcellus Locus DKC1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus DKC1
Cavia_porcellus
DKC1
GeneScaffold_7905
SNORA36
5385..5511
10530
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTAGCAATTACTTTGCCAAAGAAGC
ATAAGAAGAAAAAAGGACCGGGAAATCACTACAAGAAGAAGATGTGGCCGTGAGTAGGAT
GTGTTTTACTTTGCTTATTACAAAATGAAGTGTACTTAAATAACAGCTGAAGAAAATAAG
TGGTTTTGACGTTTCCAAGAAACGAGCTGTAGAAACACATCAAAGTAGAAAGAAGGCACT
GAAATGATAAAACCTTGGACAACCGAAGTTGCCAGTGTGCTGTGTAGTTTCCGTGGTGCG
GGCCATACCAGCAGTTCTCCCAGGATTTCTCTTAATTTGTCCCACCCACAGCCATACAGT
TATCCTTTTGTAAATATTTGGGCCACTTTCCCTAATGAGCTCCCGGTTGCTGCCTTCTCT
TTCTTGCAGGCTCTAGTGAAGAGGCATAGAAAGCCTTATTTTCAGTTTGAAAGGCATACA
CTTTGGTAGTAGTAATTGTTCAAAATCAAGTGAGAAGGTCTAATAAGTTATGTTTCTATC
CTGTGGAAGGAAATACAACATGCCGAAGAATTTCTTATCAAACCAGAATCCAAAGTGGCT
CAGTTGGACACATCTCAGTGGCCTCTGTTGCTCAAGGTATGTGCCATGTGCATCAGGTGA
ATAGCTTTTGGAGTGTTCACAACTGCTGAACTTAGAGTGCTTTCTGTTAACATCTTTGAT
TTTAACAGTCTAAAGCACCATTCCTTAAGGTATTTAAAGTGAAAGATCATGTTATTCAGT
GTTCCCAACACATTTATAGAACACAGTGTATTAACTGCCACTACAGTAATAAGTTGCTGT
CAACATTTGTAAGCAGCATGGTGTCTGATTTGAAGATGAAATGCATCTTGTCAATTTGTA
CCAGTTTGGGAATCACACTTGAAGTAGGAATGCTGTGCTGTTTAAGAGCTTCAAAGCTTG
GCTTGGGGATTTAGCTCAGCAGTTCAGGTGCTTGCCTGGTAAGCATGAGGTCATGAGTTG
ATCCAAGGTACAAAAAAAAGAAGAAGAAGAGGAAAAAAACACAAAACCTTCACAGCTGAA
CCGTTTGGGTCAGGTTGTATGTGTGACCTTGGACCATTCATTTACCTTTTTGAGGCTGTT
AGCACAAATCTTAGATGTATTGAAGGTTACAGAACATGATTAGCCCCAGTTCCTGGCATG
TAGTGTATCTTAAATTACTAGCTTTTGCTAGGGGGCTTAAATGAGATATTTGAGTAATGG
GTTGATTATGCTATTTTTTGTAATTTTTACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNTAGACGTGGCCTATGTCCATCATCTCAGTCTTCATGGCTCAAGTAAAGAATCCCATT
CTTCAGCCAGGGATGTGTGTACTCTGGAAACCAGGTGCCGCTTACTTTTTATGTGCACGT
TTGTGTCTCAGGGATCTTTTGGGTGAGTTGTGAGGCTGGCACCTACATTCGGACGCTTTG
TGTACATCTTGGTTTGTTGCTGGGAGTTGGCGGTCAGATGCAGGAACTTCGGAGGGTTCG
TTCTGGAGTCATGAGTGAAAAGGTATGCCATTATGGGGCTAGAGGTTTTCATATATACCA
ACCCTTGGTGGGATTCCATCTGCTGCACATCCCGTGACAGGTAGTTTCCAAAGTGTTGAG
TTCAGTTCAGGGCAACTTCCCTGGTCTGATAATTAAACTTTGGGACATTGAAATGGGCTG
TGGGTGACAACTGGATAAAAAGTACTCCAAGTTCATCTCTGAGCATACGGAATTGCCGGA
TTAGGTTGGATGTAGCAACAACTAAGGATAGAAGAGAGGCAGCTTGTCCTAGCAGACGAG
TTATAGGTCTGTTGGGTATTTGAGCTCTGAAGACCCTGAATTCTTTTTATATGTGGCTGT
TTTTCAGGACCACATGGTGACAATGCATGATGTACTTGATGCTCAGTGGCTGTATGACAA
TCACAAGGATGAGAGTTACTTGCGACGAGTTGTTTACCCTTTGGAAAAACTGTTGACATC
TCATAAACGGCTGGTTATGAAAGATAGCGCAGTAAGTCTAGGTCAAGAGTCTGTTCAGAT
AGGATCCCAGTCCAAAAATAAGATACGGTCCGTGTTCTGAAAGCTGAATTCCTTTTAAAT
GAAACTGGAAGTGCAAACTTTTTATGTATCATCTTCTTTGGGGATACTTCATAAACATTT
TTGACTCCTATTTGCATCTGGTGAATGGTAGATTCTCTTTGTTAATGAAAATATGACTAA
AATTTATTACTCTAAAGTAAAAACTTAATTCCAGGCCTACTTTTATTTTTAAATAAGGCA
AATTACTAACTTTAGTTCTTAAATGACTTGGTTCGAATAATAGACTTATTAGTGGCACAT
AAAAACTTCCCTTTTAGGGAAAACATTTCAAAGATATAACAGTTGTTCTACAGGAATTTT
GAAAAAGTTGCATTCTGTTCAAGTAATTTGTAGCTTGAAACAATACAGTCTAAATTTAAA
ACTGAGCCTAGCAAGCCTTTTTCTTAGCATATATGCTACATCGCTTTATCAATAAGAACA
GTCCTGTTAATAAATGCAAGTAGCTAGGGCATGGTAGTACATGCTGTAATTCCAACATTA
GGGAGGCTTGTAGTGACTGGCTGCAGCTGTAGATGTTCCCTGGGGGAAGGAAGGCTGGAG
GATGAGAAGATAAAGAAGAGACAAAGCAGGGGTCAGGTGGAGCCCTTAGCCTCCTGATGG
GAGAGAAGGGACTACTCAACCACTGTAGCACGTTTATACACTTAGAAGGATGATGTCAAT
TTTGTTTTAACTCTGCTAAGAAAAATATTTAGCTCTGTGCCCAGCAACTTGTTTGCCTGG
CTGGCTGGGCCCCTTGCGTTCTTAGGAGCTGGAACAGCTTGTTTACCTGGCTTGTTTTGG
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTAC
CCTCGGAAGTGGGGCTTGGGGCCAAAGGTCGATGTGGGAGTGGGCTGTGAGGCTCCGCCC
TCCACAGCTCTGGAGTGTACTCCCCGCTGAAGGGGTCTGGATTGTTGGTTGCTGATAGGG
AGAGCAGACTCAGGCCCCACCCTGGGTCTCGGAGATTCTGTCTTAGTGGAGGAACGGTTT
GGTGTTCCTTAGTCACACAGTGGGGTGGTGAGTTTCTGGGCCAGGACAGGGGCTCTGAGG
AGCTCAGAGAGGCACCAGGCAACTGGGGAGCCCACAGTAGGGAGTGGGGCCTGCTCCTTG
GTGTGGGCAGGGTCTTCTCTTAAGCAGGTGTGGAGGCTGGCTGAAGTGAAGAGGGAAGAG
AGATCAGGGAAGTTCTGTGGAGGAGCTCTAGTCCCTGCTGAGCATACTCAAAGGAAAAAG
ACTTAGCTGCACTGTGTACTGGTGGGGCCTGTGTGAGCCATGGTGTGCAGTTAGTTTCCA
TCTCTTCCACTCTAATGGCGAAGCCCTGATGTTCCTCTAGGCAAGTCAGAAGAAGATGAT
GATCAAACAGGGCCTTCTAGACAAGCACGGCAAACCCACCGACAGCACCCCTGCCGCTTG
GAAGCAGGAATATATCGACTACAGGTGAGAGGAGTCATCTGGGGTTGGGAGGGTTGCAGA
GCCTGGGGGTGGGGAGGGTGACTGAGCAGAACTGCCTTGTGACACCTTGACTGCCCAGGC
CAGGCCTGGGAGCTCTGGAGGGAGCTGATCTGGGCACTTCTGTCCAGTGTCAGCATTTCC
CTGCTGAGCGAATATAACTGCATGATGGAGGCTACAGCAGAGCCACTGGCTGAAGCTGTT
CAGTGGATCTGACCTATTACTGCCTGTCTTTTCTTAGTGATTCCAGCAAGAAAGAAACAG
TTGCTGAAGCAGTAAAAATGCCACACTTAGTTGCTGAAGTGGCAAAATCCCCGCAGGTAG
TTGCTGAGGCAGTCAAAATCACAAAGGTGAGTGGCTTGCCGTGATCCTTTGGAATGGGCG
GCATCAGGCTTATCTTGGTGCTGCAGTCTAGCACAGTGCTGTTCAGGACAGTTGGCTTCT
TGCCCACACCTCACTGGGCTGTGCACACAGACGTCTTGGATTGTGGGCTATTGGACTGAG
CTCTCATGATCCTGTCATGTTGGCTCCCACCTTGGCTGTGGCAGTGACCCCAGGCTAGCG
CGGGTGGCACATGTTATTTCCAGCTCCACCTTGGGTTGGGTGTACCATGGATCTTTACAT
AATGGGGTATAGAGTTGCCAGAGACCAGCATTTCTAGTCAGCATCAGTGCCTTTAGGGTC
AGAGCAAAGCATGTCGTGGCAGTGTAGTCCTCCAGGGTTGGGGTCTACTGACTGGAGCCC
AGAATAGTGTGTACTGAGCGCCCTGAGCTGTGTAGGTGGAGCTTCTGACTTGGGAGGTGT
GAACTCCAGCTCTGCCTGGCCAGTGTGGTGGGTACTTGAGGGAACATTCCTATGTCCTGA
TCAGAGGAGTTTTCAGGGAAACAACTGTTGGGTTCATTTGGGGTATTTGGTGACTTCTGC
TTTGTGACTTACTGAACTTGGCTTGTCTGTTACTGCCCAAAGTGTAACTTTGGTCATTTG
TTTTTCAACACAGCGTAAGCGAGAGAGTGAGAGTGAAAGTGATGAGACCCCTGCAGCAGC
TCCCCAAATTTGTCCAGAAGGAAAAAAAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1037, 1040..1068, 1509..1595, 3262..3353, 3454..3638, 3739..3803, 3904..4030, 5171..5301, 5647..5790, 7634..7754, 8728..8846, 9340..9443, 9697..9716, 9747..9805, 10453..10504, 10506..10528
1001..1037, 1040..1068, 1509..1595, 3262..3353, 3454..3638, 3739..3803, 3904..4030, 5171..5301, 5647..5790, 7634..7754, 8728..8846, 9340..9443, 9697..9716, 9747..9805, 10453..10504, 10506..10528
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved