Cavia_porcellus Locus KIAA1333
snOPY snoRNA Orthological Gene Database
Cavia_porcellus KIAA1333
Cavia_porcellus
KIAA1333
GeneScaffold_1052
SNORA28
34458..34582
39458
TTTTTGAGCACGCATACATCCACACACATGCATGTGGCCCTCTGGATTCTTTAGTATAT
GTGGAATTTTTCAAAGTGCATATTTCCTTCGCCATATATTTCTTTCTTCCAGCCTCTTTC
CTGTGCTTATTCTTTCAGCAGCTTGTTGTCCTTTGCCGTAGGATGTTGCACCTAGTATAG
TTGTTTCAACCCTGAAAGAGTTCCCAGGCAGGCAAAATAAAGGAAGACATATGCTAGGTG
TGGCAGTGTATGTTTGTAATCCCAGCACTTGCGAGGCAGAGGCAAGAGAATCCCTGCGAG
TTTGAGGCCAGCCTGGGTTATATAATAAAGTCATGGCCAGCCTGAACTACACAGTGAGAC
CTTGTCTCAAAAAGAATAAAAATAAAAAAGTAAAGTAAAACAAAGACACATGAACCTACC
CTTCAGAGTGCTGTGACTCAGATTGAAACACTTCAAATCACATTTTTTGGCAATGATCTG
CATGTGTTACCTCCTCTTGAACCAGCAGTCTGTATAAGGAACACAGTCTACTCAAGGCCA
CTGCTCAACTTGTGAGTGAGCAGTAGTAGATGGGTAAGTTAAAATATTCTCATGAGAATT
TAGCAACTCATTTCTCTATTAAGCATTTTCCTAATTTACAAAAAAAATTTTTTTGAACTT
CATTTTACTCCAGAGCTTCTGAAAAGTTGATTGTGAGTTTTTGGCATCTCTATCACTGCT
TTAGTAGAATACAGTTTTGAGGTTTCCTAATTCATTGTTTTCAGTGAGGTTACCCCGATA
GTTTGCCATTTCAGGCAAGGAATTTATCCTTGAAGACTGGTGAAATACACAAAGTCACAT
TAATATAGTATTAGAAATAGGTTTTGAAAATTTTAAACTACTGATAGCAATCAAATGTGA
TTTGCTCTTTCAGAAAAAATTTAAAATCAATTGAAAAACAGTAATTACATAATTATTTTG
AAATTTTAAAATATTTTTTATATCTACTTTTACACTCAGCTTGTGTTTTCTGTCGAAAAA
ATGATGACTGTGCTAATAAATATGGAGAAAAGAAAACTAATGAGAAATGGAATCTCACTG
TGCATTACTATTGTTTGGTGAGTATTATTTGTAATTATATTCTAGAAATTTGATCTCTAA
AGAGAATTAGATGCTGACACTGGTTTCTCATAATTGGATAAAATTATTTAACTTTCGGAT
TTTGTTTTTCATTTGTGTAAAAAATAAGATTTGGGGAGAATATATCTAATTTTCTGAGGT
TCTGAAATTACTTGATAAATACAAAGATCTTACCAGCATTACCTGTTTGCTTTTGTCTAG
TTTAAGAGTGGAGATGGGGGCTAAACTGGTTTTACAACGAAAGTATTCTTTTTAACTTTT
TCCTTTGTTGTTATTGATTAATCTCTGGAAACACTTGTTTGAAGGTTTAGGGAGTAAAAG
AAAGTGTTTTATTTCACAGAGAACCTGGAGGAAAAAATTGTGGCTAAAAGTAGTTCATTT
ATTAGTGGAAAAGAATGAGGTTACAGTGCTGGTCATTCAGATGGAGGTGATTTGATCCTG
AGCATCAGTCTCTTTTCTTCCATTTACGAACTTTTTATTCCACTTGAATCTGTGGCATCA
TTAATACCTTATCATACCAAGGGTTGTATTAATATACATTATTTATACTGCATTAGGCAT
CTGTTTTTTGCTTGACAAGTTACTCTGAATTGAGTAAGTCAAACTAACATTTATTATCTC
ATATATTTTCTTTAGGGTCAAAATTCTGATTTCAGCTACACTAGATGGTTCTGGCTCAGT
CTCTCTCATGGCATATAGGCAAGATGTTAACCCATCTGAAAACTTTACTAGGCTTGGAGG
ATCCTTCTCCAAAGGCTCACTCATGTGTTTTTGGCTACTGTTTCTACTAGCAATTGCAGG
GGACCACAACTCTTTACTGTCTAGGCCTCAGAGTAACTGGCTTTCCCCAAAACAGGAGAT
AAGAGGATGAATGTGTTACCTAGTCTTCAAAGCCACACACCACCTTAACTTTTGCTTTCT
TTGGTTAGAGGCAAATTAAGACTAGCCTGTGCTTCAAGGGGAGGGTTCCTGCCACCTTCT
AAAGGAAGGAGTAGTGATACATTTGTGGAGATATTTTGAAGCTTGCTATCATCCAGGCTA
AAAGTTTTTCAGTGTTTCCTTGAGAAACTGTCTAAAGTATTCATTTGAGGCTTTCTGCTT
CACAGATACTTTGTGGGTTAAGTATACTGGTAGACTGGGCTAAGAATTTCTTAATACTTT
CTTATTTTATTTATGAGTGTAAGCCTTTTTTAAAAAGTACCAATCCCACACTCTCTCCTT
TAAAGATTCTGTTTTATTATGTACAACAGTAAAATATTGTAATTTTACAAGTGGTAATGT
AATGCTACAGATGAAAGAGACTTAGAGGCAATCTGCTCCAATATTTTTATTTTCATGTTT
AAGGTCAGTGACATAATAGGTAGTTTAAAGTTCCAAAACTAAAAGGTACTTGTTCACAAG
CTAAATTTTTTATTCCAGTCCATGGTTTTTCTTCATACAGTTTCTTTAACATCTTTCAAC
TATTAAAGATTTTTTATAAAAGCCCCTTAACTGTGACTCAGTAGTTGGTCCTTGTAAGTA
TTCTTTTTATGAATAAGAATTCAGATAGATTTAAAGTTAGCCTAAAATAGTATTGTTGTT
ATTACATTCATAATCACCTGTAATTACTATCCTTTTTTTCTTAAATTAATTATATATATT
CTTTCTTTTTTTCCTACTTCCCAGTTATCTGTGTGTGCTACCTTCCTACCTTTTTTCTGT
TTTTCTGTTACTTCCTGAAATACTTTTATAATCTAATTTGGATATATGATCTGTTAGTGT
CTTTCAAATCTGAGGACATGAATAGTCGTTTGTTTTGACCATGAAAAATGATTACAGATA
GCTGCTTGGAAATTTGAGTTTTATTGGAGTGAATATTACAGATGGATATACATATATCCA
GATTAGTTTCTTAGAATTTGTTTTCTAATTGAGAATATATTCATAGTTGATGTCAAGTGG
AATTTGGCAGAGAGGTGAAGAAGAAGAAGGAGTTTATGGTTTTCTAATAGAAGACATCAG
AAAGGAAGTGAATAGAGCTTCTAAACTGGTAAGTAAATTATTGTACTCATTGTCAGTACT
TGAGAAATCTCTTGTAGTTTCTGAAGAAGAAATTTATGGCTTTAGTTTTATGTTCTAATG
TATATTTTTGTCAAGCATAAGTTTTAGAATAACGTTCTGTACTGTTTTGCACATGAAAGC
TTTACTGACCCTGTATGATACATGTGACAATAGTGATTACTGTATCTTATTTATCCTATC
CATTATTTCATCCAGTCTTATAGTTCCACTTCTGCAATCAGCAAATCCTTCAGTAAGCCA
ACCATTTACTTTTTAAATTCTTATGCCTTAATTGCTAAGATTGGAATGATAGGTGGAAGT
AGAAATTACATAAGTGTGATTTTATGATTTCCACAACTCTTATGACTATTCTGTGACATT
TTTTGCTTGTGTTTAGTGCTCTCTTGTTGTCCGTCCTAGATATGCTAAACTTAGTATCTT
GTTCATTTATTTTTTTATGATTTTTTATATGATTGATTTACATGCTAGGTACCCCAAGGA
ATGGACTGTAGAGCTCCATATAGTCTGAGTAGAACTATTGATTGAAATTTATAAAATTGA
AAATATTCTGTTCAGAGAATGTAATACTAAAGTTGATGTCTGTGGTAGAACAGTTTGAAT
GATGAAGGCATTCATCATTGCACTGAGTGGAGATAAATTGATACTTGAAGTCAGAAAAGT
TGTTTTATAAATGCCGGAGTTATTTAGAATGATGACAAGAATTAAAATACAGAGCAAGCC
TCAAGGGCTTAAAGTTCTGAGGGTAGAAAACTGACTGGGAGGTTTCTAGATAAAAAATGA
ATAAATGCCAGTAAGTGATTAGAATTTTTTAAAGTATAAAGATAGGTACATATAAAAGAT
ACAATAGTGGCTTAAAATCTCCAACAGAGAACTATAATAATACTATTTGTTTCCCTTCCT
GCTCCCTTGTATGTCTTTACTCTCATCCTGTGCCAAATCAGGAAATTAACGATGTGAAAA
AAAGAAGCTTCACTCAAAAAATTTTACCAAGTAAAAATAAAAACCTTTTAGATAAGGCAA
AGAAATGTAGGTAGTTAGTTTTTAAAATGTCAAGCAGGGATGAGAGTTGAGGCTCATAAA
ATACAGAGGCTCTAGGGCAGAGGGAAAGCCTTGGTTGAAAGGACCATTTAAAGACCATTT
GAAGACACCATCAATCTTATTTCTGGAGAAGAGTCCTCATTTTTATATTAAACTAGAATT
CCTTTGCATAAGTTCACTGGAAGAGTCTCTGTTTGGTGTAGAATTTTCCTATTACTTGGG
TGGTAGTTGAGGCATTAGCAATAAACTTGCAGTCCTAAATCAGTGATCATTATAATGGCC
ATATAAGTGTTCGAGCATTTTTTATGTACCTCTATATTTTTAAGTTATTGATAAATTTAA
TAATCTTTCTATTTATGTGATACTGTTAATATTCTGTTAGTGGCAGTGTTACAATATTTG
TTCCCTAGATCTGTCATTACAAATAACAGAAATTTACTCTTTAAAAGTGGAAGCCAGAAT
TCTAACTGAAGTTGTCAGAAAGGTTGCTTTCTTTTAGAGGGTCTGAGGTAGCATTTATTC
TTGTGCTCCTTCGATAGCTTCTTGTGCCTGTTGGGAACCCTTGGTAGCATAGCTACAATC
TCTGCCGCCATCTTCAAATAGCCTTTTTATGTCTCTTCAACCTGCCTATTTTTTTTTCTC
TTTTTAAAGATAAAAGTCATTTGATTTAAGGCCAACCCTAAACCCAGAATGATCTCATCC
TGAAATGCTTAATTTTATCTGTAAAGACCCTATTTCTAAGTAACTTAGAGTTCCATGTAC
TGAGAACTTGAACATGTGATTTTTAAGAATGCTGTTCAACCTACTATGAGTATTTCAACT
GTTTTTCCTTTTGGTGAGGATTGTCACCTTAGTCAGGTTTTAACAGATTGGTTTGAAATG
AAGCTTTCTTGTATAGCTGTTATGTATATAAATTCTTCAGTTTAAAATGTTGTAGCTGGT
AGGAATAAAAATGGGCTTCTTATATCAATGAATCCTTGAGGCTTTAGATTGTTTCTGGGG
GGAATAATCTACTAGGAAATTTCATTAATGTACTGTCATCACAACTATTATGATGGAAAT
AATTTTCATTTTCCTCACAAGTAAAATTTATTAATACTTTGATCATGTTATACTAGTCAA
AAATTTTTATATGGCTCTATTTTGATACTTTCTTCTAGAAATGCTCTGTTTGTAAGAAAA
ATGGTGCTTCAATTGGATGTGTAGCACCTCGATGTAAACGAAGTTACCATTTCCCATGTG
GGCTTCAGAGAGAATGTATTTTCCAGTTCACTGGCAATTTTGCGTGAGTTATTTAACTGT
GAAGTATGAATGTTAAAGAACCATGGCAAATGGATATCCCAAAGATACAATTTCCCTGTA
AAATAACTTTTTAAAGTTGAACTGAATTTGTATACCTACATTACTATTTATATGTATACA
CAATATAATTATATATATATATATATATATATGCANNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNTTTTCTCATTGCTGAGAAAAAAATACCTGACGTGAAAAGTTAAGG
GAGGAACAGTTTATTTCAGCTCACAGTTTATAGAAGTTTTAGTCCATAATTGGCCCAAGG
TGGGGCTTCCCATTATCCATACCCAGAACTATGCCAAAACAGTCAGTGGACTAGCATAGT
AATTGCATACCCTTAAACCATCACATACTATAGATCCAGCAACCTCTGAAAAGCCCCACC
TATGACTGCATGAGGCTTTGGGGGGACATCTAGACACAAGCCTTAGCATATACTCTGAGA
ACATTTGTTTCCTGAATGCAGCTTCAGACATGAATTTTGGCATTTGATGTCATGAGTGTT
CTGTTTATTTAAGTTCTTGTATTTTGACTTAATAAGTCATTACCTATGTAAGAATACAAA
AATCAGAAGAACGTAAATTAATACAAGTACAGTGCAAAAACTAAAATTAGGGCTACCATT
TGATCTACTTACCAGTCCTTGTTATATTAAGGCACAGTCCACAATAACCAAGATGTGGAA
CCATCATAGGTACCCATCATGGATGAATGAATAAAGAAAGTGTGCAGTATTATTTAGCCA
TAAAGAACAGAGTTTTGTCATTTGCATAAAAATGGATAGATCTCAAGATAATTATATTAA
GCTAATTAAGCCAGACTTAGTCAAATATCACTTGTTGTCCCTAATATTTGAGATCTTAAA
AAAGAAATGATGAAATAGAAAGGAGATTATTATTAGAGGAGACAAAGGGAATAAGAGGCA
TGTATGAATACAGCCATGCTATGTTACACACATTGAAACCCTCTCCAGAAATGTAAAACT
TGGTGGAGGGGCAAGGAGTGTGATGAGGGTGAAAATGATCGCAGTATGTTATGTGCATAT
ATGAACCAGCCAAGATGAAACTCATTAATCTGTATAATGTGGATTAGTAAAAAAGATGTG
AAAATTAAGAGGATAGATGTTAATTGCTTTTACCACAATACTAAAGTAAATATGTGCTAA
ATGAATAAAATAAATATAAAAAAATGCAGAAGAAAATAAAATGGATTAGGAATATAGTAC
TATTTGTATGACATGTTTATATGGTTAAAAGATTCTTTAAGTATAAATTGTTGGCTCTTT
TAACTTTATACAAAGTAGAATACAATAGTGTATATTCAGTTGTTGAAAACTAAATATATA
TACTCCATTGCTAATATTATTACAGAGGATATTCGGTATTAGTTGCTGAAATTCTGTTGG
AGGTCTTAACTACCTAAATGTTTTCATTTTGAAGGGCGGGTTATCCTTGATCACAAGGTA
ATTTCTACTGCCAAGGCTGTAATCTGTTGTACATTATAAGAAAAGACACAAATGAATTTT
CTCTTAAATATGTCAATTACAATGCTAGCCTAATTATATTTTATAATTTATTAGATACTG
TTCTTAAATTTTTTTACATTTTTAGGTCATTTTGTTGGAAACATCGTCCTGTTCAGATTA
TTACAACTAATAATTACAGAGACTCTATACCATGTACCATTTGTTTGGAATTTATAGTAC
CTGTTCCTACTTATAGCGTATTACGAAGTCCTTGTTGTAAGAATGCTTGGTTTCATAGAG
ACTGTGTACAGGTAAGGTATATTTTGTAAGCTTTGATTAAAAAATATATTGCTTGTTGAT
TTGAACTTTAAATTGGTGTTGGCATATACATTAGCTCTTATGTTAAAACTGTATATAGAG
CATTCAATTAGTAGCATATTTTACAGTAAAAGTTACCTGATTCAAGTTTACAATTAGGAT
TTTAATATTATGTGTGCTACCTTAAGTGTATATTTATGCTTATAAAATTTTGTTTTAACC
TGAGAATTTTGTATTTCACAATGAATAACATACTGATTGTAATTCTAAATTCTATTTATA
TATTTAAGCTAGATAGAAGGAAGTGATAGTAAGCTTGATATTAAGAAATCTTTTTTTCAT
AATTTCACAAAAAATTTATCATAACTGCTTGACAGGGAGCTGACTGTCAAAAAGTATGAA
AGTATGTTCTTTAGACTTTTGTGTATCAACCTGGTGACCAGTTTTCTTGTAGATATTGTA
AAACACACAACTGGGGCTGGGGATCTCAGTGGTGAGTATTTGCTTGATGACATAGATTCA
GTCCCCGCACTGAAAAAGAGAATTTAAAAAACCCACACACATTAAACAGAATTTACTATT
TCTTTGATTGAAAATTCTTGACTATCTTTAAAAAATGCCAACTCTTAATAATATCAAATA
TTAATATCAAATATGTAATATGCATGTATGAAAGCAGTACCTATTAGACTAAGAATATAC
TTCTGTTAATACTGTTTAAAGTTTAGATTTTGATTACTCTTGTATGAACCTTGAACTTTT
ATATTTATGATTATTCAGATAAAAGTGAAAATAGGAGCCTATTTTATAGGGAGAATATTA
GAAATTCTGTTAATTCTTACAGAGAAATATATATAAATAATGGACCTAAGAGTACATTTA
ATAAACATCATAAAGTGTTATCCTTACCTATTGAGGAAGAAGTTCCCATTAGATGAGACT
CTTTAAAAAGTAATTTCTTAATTTAAGAATTTATATTTGAATGAATGTAATTGCTCCCAA
ATGTATCATCTTGTTAATTTTGTGGCAAAATATTACTTCTCGGGACAAGTAAGATTTGCT
TTATTTATATGTTAGGAATTTTTTGGTGAACACTGATAATACTGTTTTAATTGTTACAAA
TTAGAAATGTATTTCTGATGAAATGGTAAGGCTGGCAGGTATGAAGGCACATTCCTGTAA
TCCCAGATGCTTGGGAGGCGCAGCCTAGAATATTGCAAGTTTAAGGCCAACCTAGGCAAT
TTAGGGAGAACCTGTCTCAAATAATGTTATAAAAAAGGGCTGGGGATCTGTCCCAGTTGA
TAGGCTCTTGATGGACTCCCTAGTTTAAAAAAAGAATTGTTACTTTATGCAAACTAATGT
AGAATCATAGCAACATAAACTCTTGTTTGTGATAAAGTGTCAGTAAGCAAATTATTTCAT
TAGTGCAAACTGTGAGAGGGCTACTTTCTGAGTTACTTTTTTAATAGAGTCTTCAAGAAG
CTTTTCTACTCTAGTGCAATCTAACTGAAATATTATTCATAGTCTGCCCAGTCCAGGTAG
CTACTATAGGTGGTTAAACAAATGTCTTTTATGTCCTGGTGAAAAAAGACTAGAAATTAG
AAACAAAGGAATTAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCC
AGTTGCCTAATTCCATGTTTTGCTTTCTAGCTGTGGAGTCTACAATATGCATTCTTTAGT
AGGTCTTTTGTCTTCATTTTTCTAGCAAGCCTCTATTTTTTCCTTCCAAGCTTAGCTTTG
GCCTCAGTATCCTTCTGAAATTTTTGTCATTATAGAATAGGAACTTTTCCTTCTTTCTTC
ACTGTATTTACTTTAAAAAAAACATTGTTTCATAATATTGCAGTAATTATATTGCCTACT
CAGTAGAATTCCATGGAATTGAGTCTAAATCACTTGATGTTTCTGTTAGATAGCATGTCT
ATATTAGGGATTTGTCTTAGTTCTCTTGTTGCTGAGGCAAAATATTTGACACCCAAAGTT
AGAGGAAAGGTTTATTTCAGCTCACAGTTGGTAGAGGTTTCAATCCATAACCAGTTAGCT
CCAAGGCAGAGGGGCATCTCAGAGGAGAAACAGTTTGTGTCAGGCAGATGGCAGCAAAAA
CATTCAGGTAGCAAGCAACAAGCCATGACCACGGTTCTTTCTGTACCTTCTATTTTACCC
AGGCTACTCTTGGGTAATACTCAGACCCTTAATCCTAGCATCGCACCATGACTCAATCCC
AGCAGCACAAACCTTAGATCTTAGCTACCTCTGAAAAGACCACCTATAACCATTTAAGGT
TTTGGGGGAACATGTAGCCATAACAGGACTAAAATATTTTTAAATGAATCTGTCCTACTA
GTTCTTTTGTATTGTTTTGTTTTGAGACTGGGTACTTTTTCTAGTAAGATTTTAGTGTCT
TGTTTCTTTCTGAGTAACCTCTGCCTGCAGCTTCTTTCTTTGTATTTATTGTACCATTGA
TAGCAGGTTTTGTATTTCTTTTTGGGGGGGAAGAAAAGTCAAATTAATAACAGCCAGAAA
TGATTTTAACAACAAAGTATTTTTTCTTGATGAATTAACTACCGATTTTCACTGTTTTTT
CATATAGTATGGAAAATAACATATTTAAGAAGTAAAATAACATGCGATATCAGAGGCTGA
GGAATTAGGTATGATAGTTGTAAAGCAGATAGTTGTCTAATTGTTAGGTTTTTTTAGTTT
TTGTTTTTTTACTGTGGAATAAAAAGCTTTCTGGATGTTAGCAGTGGAGTAACTTGGTTT
ATAATATTTGAGAACCATGGGTGTAGAAAATAGTTTCATAACATATAAAGTAAAAAATAG
CACATGTTCTGTTAGTTATATAATTCATAAGCTGATGACAGATTTAAGTTGTTAACAATA
GATTTTCCATTTTTCACTGTAGGTTCAAGCAATAAATGCAGGAGTATTTTTCTTTAGGTG
TACAATATGCAATAATAGTGACATCTTTCAGAAAGAGATGTTGAGAATGGGAATTCATAT
TCCTGAAAAGTGAGTAATATTTAGCATTTCAGAAAAAAGACACTTCAAATACAAGATTTA
ATAACAGTAGAAATAATCATTTATGCCTTCTTAAGTTATCAGTGGACATTTAAGCATTGC
AAATATTGAAATGTAAAGCCTTCTTCCTAAATAACTAGTTCACAGAAAGCAGGGAGTGTA
ATATAAATGTCTCATTCAGACTGGGGATACAGCTCAGTGGCATAAGTGCCTGCCTGGCAA
GCACAAGGAATAAATATCTCGTTCATTGATTTAGATGGAACAGTGTTGGTGAACCTATGG
CATGCATGCTACAGAGGGCTGTTTGGTATCATTGAAAGCACTAAAAGATTTGCCATCATT
GATAGAGTCTCTTAAGTACCTCTGTGGTGTTCAATTTTGATTAATTTATATGTAACTGTA
ATCATCTTTAAAGTGATATTTATAAATTAGGGGAATCAAGATGGATTTAAAATGAATGAG
AAAAATTTTCTTAATACTTCAAGGTGAGGAATCCAGAAGTAATGATACTAAATTTGAAAT
TAAAAATTAGGAATGAAAAGTTAGAAAAATATAAATTTTAGAAAATTTGCTTCATTTTTC
ATTTAGCATTTGAAATTTTACTATGAGACCAATTGACTGTAGTATAAAATGACATACTAG
AGTTTATATTAAGGAGACTATCTTAAAGCAAAGTTTTTATCCTTGTTCTAAAGTATGTAT
TGGACAAAGAGAATATACTAAAAAGGATGAAATTTACTTGTTCTTAAATATGTGAAAGGT
TTTTGTTTTTAGATTCTTTACTAATCCTTTTATGTAATATAATTCAAAGCATATTTCATT
TCTTGTTTTACTTATAGAGATGCATCTTGGGAATTAGAGGAAAATGCTTATCAAGAGCTT
TTAGAGCCTTATGAACATTGTGATGTACGAAGATGTCGTTGCAAAGAAGGGCGAGACTAT
AATGGACCTGACAGGTATTTGTGAATGTTGAGTTGTGCTTATTTAAGCTTTGAACTCGGA
ACATAACAAACATAGTTTTGCTTTTAGGATATTTGAAGTTTTAATTTGAAAAGATAAAGT
ATATTTGTTAATCTTTCATTTACATATGTGTAGAAAGAAATTTTTCTAGTTACTAGAGTT
GTAATCTGTGAGTGTCATATATTTTCATGAAGGTCTGTTTTCTAGAGCTAGTTTCTTAAA
ATGGTAGGCATAGCCACATTTGGTTACTAACCCTTTAAAATATGGTTATTCCAAATTGGG
AGGGTGCTGAAAAACACACCAGTGACTAAGATCAACAAAAATTTTAACAAAATACCATAG
AATAAGTCGTTTAAACAAATTTGTTTTCTTATAATTTGGGGGTTAGAAATGTCAGAACAA
GATGACAATGCTGCCCTCTAGCTGTATCTTCTTGTGGTTGTCCCTCTGTATTTGTGGTGT
GTGTGTGTGTGTGTGTGTGTGTGTTTTCAATAAAGATTACTGATCACATATGATGCCATT
TTATTCTGATTACCACTTTAGGCATTTTCTCCAGGTACAGTTATATTCTGAGTCACATTC
TAGGTGTTAAGATTTACCTCAACATGAATTTGGGAGGTAGGCACCAATCAACCCATAATC
TATGGGGAAAAAACTTAAAATAGCTTGTTAATTTTTTATATTGTTTACATAGTGAACAAA
GTAGCACATATTGGAAATAAAATATATTTAGAATAATTTCACCTGTTCTTTCTACATTTT
AAAATGAAAGTATTAGAAGATTTTTTGTTATGTATATATTGGCCTTGTACTTTCTGCTGG
ACAACACTGCAGTGGGAGATAATTTAACTAGATTAACTCACCATTGTTTCTTTTGGAGCA
GTAAAAAAGGTTTGGTATTGGAAATTTATTGTTTATTATGTTGTAATGTGAATATATAGT
TGTTATCTTGTACCTTTTAGGTATAGTATATTACATTAGGAATCGAGTCTTCATTTAAGA
AGTAAGAAAAAGGAGCAGATCAATTTTGCTGGAACTGATGTAGAAAATTTGAGCAAGTTG
TTATTCCTAATATGTAATGTTCATTAACATAGTAAACTTAAGAGTGCAGAGCAGACTATT
GGGAGTCATGTTTTTCTTTGAAAGTGATTTGACTGGATCAGCTACTACTAATTTTAAAGA
ATTAGCTAAGGTCTTGGCAGTTTTGGGAAATTTCCCTCGAGTAGCTCTTTCTACAGATAT
CCTTCATGTGTGCTTCTTACTATATAATCATTACTTAAATTTAATGTTATTAAACCAAAT
ATCTTTTAAGGACAGAGATAATGTTGAAAGGGTCAATGTATTGTTACCTGGTGACCCTGA
TTGTTTTTTTTTCAACATTTACGAGTACTTCCTGTAGAGTTTTGCTGTAAAGCACATCTG
AAATAGTGTATATATACAGTTTTAAGAAACAACACATTCACTACAGTTGATATTTCCTAA
ATTAAATGTAGGTTGTTCTTTATATGGCTTGTGTATTGTTGATCACCAGATCAGTATCTA
CAAAACTTCTCTTTGCCAGTTATTTTTGGGATTGCTATCACTTTTGCTCTTTCTTCTGAG
ACACAGATAACTGCTGTCCGAACACTTGTTTGTAATTTTATTCCCTCTCATCCCAGTAAA
GTCAGTATTGGTAAAAGGGAGCAGAGTGTAGCAATTAGGGACATGGGCCTCAAGCCAGGT
AAACCTGGATTGAAAACCTCACTGTAGGGTTTACTCAGTGTGAGCTTAGTAAACAAGAAA
TATATCCCACTCAGCTTTGGTTTTCTCTTCAGAATAATAAGAGTAACAAAATTGTAAGGA
TTAAACTTTCCCTTTAAAGAGTAAGAACTAGGCCCTAAAGAACAGGGGATTATCTACCTA
CCTCTCTTGTCACTCACATTTTCATTTACTTAGGAGCTGTTTCCATTTTTATACAAAGAA
AATGATATACCCTGTAAAGAATGAGGAGCCTCCTAACACAACCTATATCCATATCCACAC
AGAAGATAGGAACATAAACTGCCACATGTCACACACCAGAGACAGGTAAATGAGAGAGAA
TGAGTATAACACAGGTGGGAAATCTGGACCTGGTGGTCACACACAACACCTGAAGTGACT
GAGCAAGCTTATTCTAGAAAGTATTACTTTACCTTGAAATTTACTGAGTACTTATTCCAT
ATCAGACACATTGACACAGTAATCTCTTTGTGAGCATAGCCATCTCCAAATACAAGTTTA
CACACATAATAAATAGAAAAAATACTTCAGAAAAAAGTAATGCAGGATTTTAGCAGATAA
TCTGTTTGCCCTGTGGTAAAAGGGTTGATTTTGAGGATCTGGCCTATGGTCGCATAGGTA
ATTGGAATTAATTTAATATCAAACATAAGCATCTACTTTTCTTTTATCCTCAGCAAATGG
GAAATAAAGCGCTGTCAGTGTTGTGGTTCTAGTGGAACACATTTAGCCTGTTCTTCACTA
CGATCTTGGGAGCAAAATTGGGAGTGTTCAGAATGTAGAAGTATTATCTACAATTCGANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGGCCATTAGCTGATCATAAGTAATCTAGAAGTATTAATAGAGTTCAGT
ATTTGATCATGAAATCAATGCAACCATTTTTTAAAAAATCAAAATGGAATAGACTAGAAT
GTAAATTATCAGATTGTATTGCACATAGGAAGAATAGATGTGAACTCTTAATCACTTCAT
TGCATAACATCACAAAGTATGTGAGTTATAGATCATTTTCAAGATAGTTTGAAAAACATT
TGTTTAAAATGTCTGATTGTAGATTAAGATAGGAAGATGAAATATCAAGCATACTGTGTC
ACTTTGAAAAGTGAAAGAAGTCCTGTTTAATATAGAGATGGGTTATTTTTTGGTATTACA
ATCATTGTTTGCTTATATATTCACTGTCAGTGTCAGAAATCTAAATGTCAGCTTTTCCCT
TTAGAAAATTTAAGGCATACTTGTTAAATATTAACATATTCTTAACTATTCCACAAAATA
GCAAAATAAGTAACTTTTTAAATCTTTCTTAAATATTCAAATATGACTGAATTTACACTT
TTATAGTATATCAGGTATTTGTTAAATTGTAGTTACGATTTTTAAGTGTATACAACTTTG
CACAAAAGCTTTTAGAGCCTTGCTTTGCCCAATAGGAAAAAAAATAGAAAAATAATATTA
ATATCTAAGCTTGAAGAAGTACTGTCATGTTTCAAATTTAAGAACTTGGAGGATATAAAA
GAGAATTTTTCTGAAAGTATTTGGATACTTCATTTTTCAGGTAGGTAGAATATTACTTGT
CAAACTGTAAGGAATTACAGTTTTAAAATGCCACTTTTGGGGGTCCGGCTGCAAGTGGGA
GTGCAAGCACCAGCACAAGGTGGCTGCAGCTGGCAGCATGGCTTTCGTGGCCTCGGAGAT
CATCACCTTCATGGTCTCAATCTGGCTGTGTACTGGTGTCCTCTGTACTGCACACCTACT
ATTGGAAGGTGTCTACCATCGACGGCACGGTCATCACCACCACCACCTATTGGGCCAACT
TGTGGAAGACTTGTGTTACCAACTTCCTGGGTATCTACAACTGCAAGGACTTCCTTCCCA
TGCTGGTGCTGGACAGTTGTATCCTGGCATGTAGAGGACTGACAATTGCGGCTATCAGCT
TGGGTTTTCCTTGGTTCCCTATTTGCACTCTTTGAAACAAAGTGTACCAAAGTTGGAGGT
TTAGATAAAGCATAAGTTAAAATTGCTTGTTTAGCTAGAATTGTATTCATAATGTTAGGG
CTGTGCTCACCAACCAGCTGTTCCTTGTAAGCAAACAAAATCACCACAGAATTCTTTGAT
CCTCTCTTGATGGAACAAAAATGTGAATTAGGAACTTCTCTGTTTATTCAATGGGCAGGT
GCCTGACTGCGTGATTGATGGTATCTTGTTTTACTTTTCAAATCGCAATAACAAAATATC
TGGAATGTGATACACTACAAGAGGGCCACATTTATCATGTTTTCCCAGATAAAATACCAT
GAAAAGGAGACTGTAAATCATCTTTCAAAACAGTTTGATAAAAATGCTTGTCTAAAAGAA
TTCTACTGGCAACCTTGTCTTGAGTGTGTTATCAAAGCGGACTGTTCTAAAAATGAAATC
CTGTGAAAGTCCTCCTATAATTAACACTCAAACTATTTCTAACATAAGAATGTGTTGATT
GTACAAATGTGAATGTTCTTACATGGTTATGTACTAATCATGTTCTGTTATGACTTTCTA
TAAAAAATAAACAGGTTTATATATTTGGAGGACATACAAAACATTTAAAAACAAGGTTCA
AGAAGTATCTGTAACATAGCTCTTTTGATTATTCATACTTTGAGATGTTTCTCCCCATTC
CTTAATTCATTCATGTAGTACTGGAAACATAAGAAGGGTGTCTTCTTGATGGTATAGGGA
TGATCTGAGACTGAAGTTTAAAACACGTTACTGACTGCTACATGGAGTTGTCTTGTAGTT
TCTTCCACCCTTTCTCTCATGACAGTTATTCATGAGGGTGGTTCAAGGAAGAGCTAATGA
GGCCAAAGTGTTACTGCTGTTCGCGGGGTTTATCCCCTTAACTACCTACTTAGTCTTCAC
TGATACAGAGAGCAGAATCTACAGAGAGAAGGGCATTGACATGAGCTGAGCCGAGACCCC
TGACTGTGGTTAACTCTGAAGGCAGCAAAAGAAGTCCCGGAGCCAGCATGGCTTGCCTTT
CTTAGAACTGATGAATTGATTGTGTCTTGCAGGTCTTATTTAGGTAACTAACTGGGTAAT
TAAGACACTTGTTTTTCAAAACATGTGACTTGCTTCAGTGATTTCTGAACAAAGATGCAG
ATTTATTCCTAGGGCCATCCCTATATACAACATGCCCATGAGGGAAATAGTCATCATTGT
TAACACAAAGCTAACATACCCTACCTCGCCACCTGCAGCCACCGTATGCAGCATTTACTT
TTGCAGAAAAAGAACCACAGCAGAATTTAAGTAATTTGTCACAATAGTGACAGAACATGA
CTCTGAGGTGGGATACTCTAGGGTAAAATACAGTTTTAGTACATAAGCATTGGTATGAGT
GAGGGCTGAGAGTGTCACTCCGTGGTAGTATTCAGGAAGCCCTGGGTTGCGTCCCTAACA
CCAGAAAAAAGAGAAGAAAAGGTACCAGTGTGGGTTGGGAACACAGCTTAGTGCTACCTG
TGTTACCTGTAAGAAGCTACGTGGATGAATACGTCATTTTCCTGAAGTGTAAAAGATATA
AAATGAAAAATCACATTGTTCAGAGGTACAAAGGAAACAAGTTTGTTTAAAATTCATGCT
AGTTAATTCCATGTTAGTACTTGAAATATCTTTTCTCTAGAGATACTAATTAATTAAAAA
ACATAAAGGTAGATTAGGTGCTTCAGGCTAATGTGGGGGCAAGATTGTGTGGGTTTGTAT
TTAAAACAATATTTTTTAAAAAATTTTAAAGCTAAGATGGTGAAAATAATCTACAGAAAA
ATTTCAGGTAGGGTGTAAGGTATGAAAAACTATTGGTAACCAGAAACATGTCAGCTTGGC
ATCAGGGAGGGGGAGTAGATGACAGTGGTCCAAATAAAATATGACTAGACAGATAAAAGA
TTGGCTTTTGTGACACAAATACTGACTTAAATACTGGGTTTATTTTATAACATAAGACCT
TTATTTTCCTAGCCTTTCTGCTCAAGACTGAAGACATAGAACTTGCAAGATACTTGGTTT
ATAGACTGTACTTATCACTTTCTAATTATAAGTATGATCTTTGGCAAGTTACTTAAAAAC
TTTTTATCACATCTTTAGGATGAGGGTTATAAAAATGACCACATCTCAAAGTAGTTCTAA
TTAAATGAACTCAATATGGGTTAAAAATAAGACCAAGTGATCAATAAATACCTGTTTCTG
AAGCGACTGGATAAACAAAGCAATCCATGCTATCTCTGGCACATTGGTTTTCTAGGTTAT
CTCTCTTTCACATAAAACTGATTCGTCATTTAGAAATGTTTTTAGAAACAAAGTGAGTAT
AATTGTATTAAAATACCCCTGCAAGAAGCTGGGAAAAATGTTCATAAGTTTAGGTATAGA
CAAGGACTTTCTGAACAGAACCCCAGTTGCACAGGAAATAAGTGCTGACAATAAGATCAT
ATCAAATTAAAAAGCTTCTGGACAGCAGAAACAAAACAAAAAAAGCAACCAACCAATGGA
ATCAGAAGAGAACTTACAAGATGGGAAATTTTTTTTTTTACCAGCTATTTCTCAGAGAAC
TTGTATCTACAATATATACAATCTCCAAAAATTTAGACCCTGCAAAAGACCCAATCAAAA
AACTAAATGAGCAAGTGAATATTGAATATGACACTTCAAAGAAGTACAAATGGCTAATAA
ACACATGTAGAAATGCTCAACATTGCTGGTCACTAGAGAAATGCAAATTAAAGCAACACT
AAGATTCTTTAACCCCAGAAAATATGGCCATTATCAAGAAATCAAGTAACATGTTAGTGA
AGCTGTGGGAACAAAGGAACCCCTTCTATATGTTGGTGGGAATACAAACTAGTATAACCG
CTATAGGAATCAATATATCTACTCAGAAAACTAAAACATTCACTTGACACAGCTGTTCCC
TTTCTAGATAACTTCCTAAAAGAGGAAGATGTGTGTATACCATGTTTATAGCAGCACAAT
TCAAAATAGCTAAGACTTGGAAATGACCTGTATATCCATCAACAGATGAATGGATAAAGA
AAATGTGGTATGTACATATAGTGGAATACTACTGTGCTATATAAAAGATAAACTAGTCAT
CTATGGAAAATGGGTGTGCCTTGAGACCATAGTATTCAGTGAAATAAATCAGACACAAAT
TTAAATATCCTGTGGTTTTTTTCTTACAAAACAAATTACAAAGAGCAGGTTTTATAAAAG
AAAGCAGGGAGATAGCTCTTGCTGTACTGGATTAAGAGATGGGGGATTTAGCTCAGCGGC
ATAAGTACCTGCCTTGCAAGCAGGCAGTTGTGAGTTTGATCCCTGGTACCGATAAAAAAA
GGAAAAAGACAAAAAAAAAGGGAGAGAGATGGAGAGAATGGGTGGAGCAGAGGAAAAGGA
TAAAAATAGGAATTAAATGTGTATTAACTTCACACAAGGAACATAAACATTTGTATACTG
CAAATGTAGTAAAAGTTCAGGGAAAAAGTAAACAGGACCCTGGGAAGGATAGAGGCAGAT
TTATTTGGCATCCGGGATTTTATATGGCATGGCTACCAAGCCAGCTTCTCCTATGTTTAA
GTCCCGTGAAAGTACAAATTCAACTCAGAAATCATCTCTAATATTCACAGTCACAAAATT
CTGGTAGAGGCTTTACTGGTAAGCTTGATAAATCAAAAGATCTTTCTTTGGAACTAAATG
CATAGTAAAGTATAAAAAAGGCAAGTAACATGAACTTGCTGGCCTTTAACAATTTATTGC
TCAACAATATGAATTAGTGCTGAGGTAATATATGATAGGGGTTGAGTTTTTAAGTTTAAA
ATACACGTGGTACAGTAATGAATCTTTTCTACTCACATTCTGATAATTGGCATTTTAAAT
AGGTGCATTATATTTATAAAATGCAAGAACAAAAGAATAACACAGAAACCTAGTGGCCAT
AGCGTTCTCTTAGTGGCAACATGCTTACAGCGCCGAATATGATCTAGGTAATTTAGGAAG
ATATATTTATTGAGGGCCTAACTATATTACTGTAACCCCTCATGCAGTATAAGCATCTTA
CGTTTGAGATCTCACTGCCAAGTAGTTCAGCTTTGAAGACTCTACAAGAAACTCCAGTAT
CAGTATTTCCAGTGTGAGCATACAGAAGATATGTAGAAAGCTCCATAGAGGATACTTGCT
ATTACGTAAAAAACATCTTTCACTGTGAAATTAGTTGAAAAAACTCGCTCCTCTACTAGC
ATCTGAAGAATACACTTTTGATAAAATTTATGAGCATCTCTTTAGCTGTGGAGGTGAAAC
TCCTTACGAACTTACAAATCCCCTAAGTATTCGTCTTCCATAGTAAAGCGCGAGTTAGGA
AGGCTTGTTTTCAAGCACCAGAGGCAGAGTGCCACCTGGCCTAAATCCGCTTGAAGAANN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCAAGGTAATCACTTTTTTTGTA
TGCGTGCTGAATATTGTATATATAGAAATAAAATTAGAATTAATGTTCATTCACTGTAGT
GTAAATATATAACTTACTAATAAACTACTGATAAAATTGCAGGAAAAAGGGAATGAAAAG
AGACATCTTTAAGGCTAAGTTTTGTTGGGACCAGAGTTACAGCTTCATGATATTACCTCT
CTATCATGCATGAGGTCCTGAGTTCACCCTGCAGCACTCATTAAAGAAAAGAAAAGAGGA
AAGGAGAGGGGAGCAGAAAGGTTTTGTAGTGAAATATTTATATATAAATATATAAACAAT
TTCAATATTTTATATAAAGTATCCTGATTTCATAATTAAAGGTAACTTCATTTAAACTTT
ATGTTTATTTAGATTTCACTTGAATACAGTGGCCAAATGGGACAGATAATTATTTGGATC
CTTTTTGTAGTCATATACTTGAAATTTGGCGTTGGCGTAATATTTGCATTAAAATAGTTT
CCTAGTTCAAATACAATAGTTATTTTTAATATAATGTGTTAAGAATTTTTTAATACACAC
TTATATAGGAGAGAACTTATTTCATTACATAGGAGTTTTCTTCTCTTTGTTTGCTAGACG
TTACTCAGCTTGCCTGAAGTATTAATATGTGTATTGCAAAGAGCTTATTAAATATGTTTA
AAAATCATCAGTAATTTTAAATTCCTTTTAAAATAAGCAATAATGTTAACTGAAGACAAC
TTTGATACAGTAAAGAATTGATTAAGTCACAAAATCTGAATTCAAGTTTGTACACATTTA
CTTTACTTGCTTTACATACTTATTAATTATCCTGTCAGCATCTGTTATTTTTTATCCATA
AAATATAACTAATGAAGTCATCATTGAAGAGATTTTATAACAGTTTCGAATACTAAAAAT
TTTACTGATAAGTTGATTTAAGCAATTAATAGAAAAACAAAGAAAATTTACATTTTATCT
TTTTGACCAAAGTTACTAAAACATTTTGAATGACAGTTTAAAAAATTTTAAGACTATGTA
AAGCCAGGAGAGTACAATAAGATAGCATATACTGTTGGGAATAAGTTTGTACCTTTTAGA
AGGATAAGTTTGGTATACATCAAGAACCTTAAAAATATGCACATACCCACTAATACAATT
TAAAGAATCTATCCTAATCAAATCAAATATATAAAAAAAGTAGATGTTGATTGTAAATTA
TACAATCAAAATGTCACTCAACCTGGATAACCAATAATAGGGAGGTTTTACTTTGTCATA
CATCTTAATGTTTATTTTAATGGATTCTTTAGTTATAAATGAGTAATTTTGAATAGTATA
GGAAAAATTAGATAACTGGAAAAAGGCAGAAATTNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNCCCGGTCAGAGTAATTACCCTTTCCTGTAGGGAAGTGTGAAAGACAAGATGGAAAG
GCCACATTTAATTTCTTTGTTAGGGAAACAAGTGTGGAGTCTTAATGCTTCCATGGAATA
ATAGTTAACATTTGTTGAGCACTTACAGTGAACCTGTACTGCATATGTCATGTATATAAA
CTCCTTTATTATATTCCCCTGTGGAATAAGTATCACTGCCTGCGTGTTACTGATTCTTTC
TTAACTTCCCTTTTACTTTGGGTACACATACGCTCTCCATTAACTAATCACAGTATAGTT
TAATGATTAAAAGCGTAGGCTTACAAGTGAGATTAATTTGAGACTCAGTTCATGTAAATG
CTATAAGCTGTGTGTTCTTAAACATATTAAACTTGTTAAGCTTCACTTTGTAAACCACAA
AGTAGGCACTAAGACAGTGTAAATTGTTGTATATTGTGATTGTTTATTTGGCCTAATACT
GCTCAACCTATAATCATACTTTAAATTGACCCTTTAATGCTTTATTCTCTTTGCTAAAAA
ATGTTAACTTCATTGTCTCTATTTTCCATTTTCTATTCATTTCTTAACTTCCTATAATCA
ATATTCTGTTCCTACCATCTGACTCCTAACTTGGCTTGTTCATACTTTCTAGCAAGGGAT
CTAAATCTTCAGAGCTATAGTCCTTTCTTTTCTTTTTCATTTTTCTCTGACAAATGTAAT
CAACACTTTCTTAGAATTCCTCTCTAATGTTTTAATATTGTACTTCTGTTTTTTACTGCT
ATCTTCCTTAATGCTCTAACCTTTTTCAGTATTGTCTTACTCTGTATCCTATTTTCTTTG
GAGATCTTTTGTCTTACTACCTTTCTGAATGATTCATGAGCCTGTGTTTTGAGGACCTTT
CTATCTGAACCAAATTTCAAAGTATGTCTAAGGGGCCAGGGATTTAGCTCAATGGCTCAA
GTGTTTGCCTGGTAAGCAGAAAGTTGTGAGTTTGATCCCTGATACACCCCCCACCAAAGG
TATATGTAGGCTTAGACAAAATAGTATATTCTAATATTAAGAATGACTCTTCCAAAAGTT
CCATTTTGACGATATTGCTTTATTTCTCAGGAATAAATGGATTCTAATTGCTTTTCTCTA
TAAAGGCATTCATGATCTTTACATTTTCTTTCTTTCTTTTTTTTTTTTGGTACTGGGAAT
CAAATTCAGGACCTTGCCAGGCAGGTGCTTTGCCACTGAGCTATATCCCTGTCTCAACCC
TTTTTCATGGTTTATGTACTCCAGTACCTCCTATCTAGTGTTTGTTCATATATTTAATCA
ACAAATACTGATAACCATTCCTTTTTTATCAAAATTTACATTTTAGAAGAAATACAGAGG
AGAAACAAAAGAACAAACCATGATGTAGCAAGCATATTATAAATATAAACACAACAGAAT
AATTTTAAAAAGGGGTTGGGGAATGGGATACATGTAAGGTTCAGTTTAAACTATGCATCT
TTAGCAAAGAAAAAGGCTGGAAAAAGGCAGATGCCTATATTGCCCTCTAAAATCTGTTAC
CAAGATTAGGTCTCAAAACTTTGGCCAGCTATCTTTTGTATAAGTGGTGTTATTGGAACA
CAATCATGCCCATTTGTCACATACCAATGTCCTACATACGTGGCAGAATTCAACAGTTGG
AACAGCTAAGTGATTCATAAAACATGAAATGCTATCTGGACCTTTATAGAACTGGTCTAT
AGTTTAAAGGTAGAGTTGTGATATAAAGTCATCTAAAAAACTGGATACCTTCTGCTTATT
GTCTAATCATTTAGAATATTGTCTTACTATTATTGAAAGTGAAGAACAGGGAAGTTTGAC
ACACTGTTTTGATTCATTTTTCTATTAAGAGATTATTACCTGACTCATATTTTTAAATTT
CTCTTTCTATGTCACTAAGAGTTAACCTTTATGGTGTAACCCAGCACTTGGGAAGCAGAG
ACAGTCAAGGCTAGCCTGAACTACATAGCGAGACCCTGTGTCTCCAAATAAAAGAATAAA
AGAGTTAACCTTTATGAAAGTGTCTGGTGCATGATTTCTTTGTTTATATTGTTTATTAAA
ATATTTAAGTCTTACCTGATCTACTTTCTGGTTCAGGAAATCTTTTTAGATCATTTCTCT
TACCTCCTCAGTGCATGTAACTTTTCTGTTTCATTTCTTTTATATCAGTAACTTCCTGTA
CCAAAGTGATGTTACATTCTAAGTGTGTTGAAATCAGAAGTATACAATATTTGTTGAACT
GGATTGTCAGGCATTTATTCTAGAAAAATACTTCTTAATGTGCCTTGAGTCCACAGTGAT
GTATTCAGAAGTTGAGTAAGAAGTACTTTGTCATTTGAGATGTAAATATCATTCACAAGA
ATTGGGTGAAGTAGGTATATTTTCTCCTTTGTTACAGATAAAACTTCAAAAATATGGATG
ACTTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATGTGTTTCAGGAA
TATTTAAATCTTACTTTTTATAAATAACACTGGAGAGCTGGTCCTGCTGGCTCATGCCTG
TAATCCCAGCACTTGGGAGGCTGAGGCAGGAGGATTGTTGTGAATTTGAGACCAACCTGA
GCTACAAAGTGAGCTCAAGGCCAGACAGAACTGCATAATGAGACCCTGTCTCAAAAAGAC
CAAAAATAAATAAATAAATAAAATAAGCTTGAAAACTTCTTAAGGATGATCACTGTTCTA
ATCATTCTATAAAGAATTATATTAATGTATGATGCTCAGCAGAAAAAAATCATTACTTGA
ATTTGTATTTCTAAATTTAAAAATTATTTTAAAAACTCAAACATATGGCTAATCCATCTC
ACTTACTCGTTTAATAAGTATTTACTGAGCACCTGTGGAGTAATAAAGATCATAACTATT
CTTTGGTTAACAAAATATATCTGATTCTTGCCCTTCTTTATTTTAGAGTATTGATTAGTC
TTCAGACATTTAATTCCAGTAACCTTTAAAAGAAATTTGACAGCTTACATGTCTTCAAAC
TTACCTATTTTTTATTTTATTTTATGTTTTAGAATAATAAAAAATATTTTACTAAAATAT
AGGGTTTATAGAAGTTTCCAGACAAGCCATACAAAATGGTCACAACCATTTTTTTTGAAG
AGAGGAAAATATACTTGATTGCAAAATTATTAGGAGAGGGCTGTGAGGTTTGTTAATGTT
CCCATTTTGGTTCAAACAATCAGCTTGTCCATTTATAGTGTCTAAATAAAGTTAGACTTA
GCTAGAGAATGTAGCTTAGAACTGGTTAGCTGCTTTTTAACCAGTGCATTAGATCACCAT
AAAGTTGGGGGCAGGGAGCCTATACATTGTTTTTTTTATCGGTACCAGAGATCGAACTCA
CAACTGCCTGCTTGCGAGGCAGGTGTTTATGTCACTGAGCTAAATCCCCAGCCCCAAGGA
GCCCATAAAATTTTGAAACTATCTTTCCCCTCAAAAAATAAAGAACACCCATATCCTTGC
AGGCCAACCCTGACAACTACCTTCCCTCACAGTGCTTTATTCTTACACCATGATGGGGGA
AATGAATAAAAGCAGAGGACCACTGCTTTTCAATATTTCACAACATTCTGGATGAAACTT
TTAGCCCCTGCTCATTTTTTACAACAGTGAGTTAGGGCAAGACATAGATTTGCTAATATG
CATTTAATCACCAAAGGACTGGAAATGTCTGGGCTTTTATTCTGTAATGTTTCTAAGACT
GTGTCCATCAAATCAAACAAAAAAAGGAAGAAGTCTTGGCAGAACAAGAGAAGTGACACA
AACTTGATGATCAGATTGACTTAAATTATTATTCATGGCATGTAACCTAGTCTGTGGCCC
ACCTGTTTCTATGGCTTGGACTTTGTTGGTCTTCCACAGCTCCACTACGTCATTTGCTAA
TAGGCCATCTGAATTACGAGCACTTAACAATGCCTGGGTAGATAGCAGAACTGTGCGGAT
CTGCAGTGCTGGCAACCATTTTCCTTTCAAAATATCTAAACATATTCTTCCCAACTTGCC
TAGGTTAGGATGATAAATTTTGGGTCATGAAATGTACTTTAGGTGCTGCCATTGGGTGTT
CTGGCAGAAACAGTTCAGATGTAAAAGTACTTCCTTTACAGGGGGAATCCTGGGGACCAG
CAATGACCATGTGAAAATAACGGGCGTTGCCATCTTCTGGTTCTGCTCTAATTCCAGGAA
CCGACTCTGCTAGCACACCCTGGGTTTCCTTGATGACCCTGCAGGGCAGCCCAGCCATCT
TGTCACATCCTGAGTTAGGCCTCTATTTTTTAAAAGTAATGGAAAATATTAAATATCTGT
GAAAGTAGCCTGTATGTCATCACCTAGAACTATTATCAGCTTGTGTCCAATCTTAATATC
ACATACAGGATCATCTCAGAAGCAATAGAGTCTTTTTTTTAAAATAATTTCAATATCTGG
GCTGGGTATATAGCTTAATATAAAGTACTTGCCTATCAGATACAAGGTTCTGGCTTCAAT
TCACAGTACTAGATTTAAATATAGTTGTTATGTTTAAAACCATTATTAATATTCCTTACT
GAGGTTTATATTGTCTTACGGAATAGATAAACCTTTTTATATTATTTCTTTTGAGTTATC
TGGATATAATGCTTTAAATATCTAAGCCTTTCAAGTGGACCAAAATTAGAAAATATAGGG
CTCTTTTTTGCTTTGAATTAGTTTTTCAAGGTAAAATACTTAATGAGTCTGTATTGATTT
CTAGTTCAAATTTACTACTCTATGATTTTTACTTTTTTCTTTAAACCATATTGAGAATCC
CACTTCTTAAAGACAAAGGTGAATTAAGCTATAAAGTCATTAGTCACTTGATTTATTACA
CATTGCATAAACAATAGTTCAGAATAACAGCACTAACATTTTTACCAATAACCTATTATT
GAAAAATATTAAAATCATTTTTCTGTTATATATCAAGTTAGTGTGCTTTTAAGGCTCTTG
GAATATTTTCTTTGTTGTTATACTATAAACTAAATACACATTTCCATTTCATTTTTTGGT
GTTTTTAGAGATTTTATTTAAATGTCACTTACAGATATACAATATATTTTCATGGCTCCA
AAGTCAAATATAGTAAAAGCATTTTGAAAGTGGCTTGCTCTGTGATACAGTATATTCAGT
GAAGTATACCTTTTATGTTTATCACATCTACCTTCCATCGCCTTATGAGATAATCATTTT
GGCTTTTTTAAAAAATATTTTCTCATTCCATAATTATTCTTTTTAATGACAGAGTAATGT
GTATGAGAAAAGTTAGTCCTTTTGTTAGATAACTATCTTTTTTTCTACTTTTTTTAAAAT
TTGACATTCTATAGGTCACCTTGGTAGTAAATAGGCATATTCTTTGTTACTTTGAGAATT
TCTTTGCTTTGTATATATTATTGTTCTTTTCAACCAATTTTCTGTTAAAGGACATTTGAG
ATGTTCCCTAATCTTCTAACATGTATTAATAAAGTGTATTAATAATCATACTGTTAAATA
CTTACAAGGATATGGTTTCTAATTTTTTAAAATTATAACTTTAAAAACACAGTTATATAT
CCCTTTTAAGTATACTCAGATTTTGAGTTGAATTACTATTTTATAATTAGGATTCATAAA
TAAAATATTAAATTGAGTATAGTTAATATAATTTTATTCAAAATGCATCTCTTGCTGGGA
GTGGTGTTTTATGCATATCATCCAAGAACTTGGAAAGCAGAACCAGAGATCTGGCTGAAT
CATGAGTTTGAGGCCAGCTAGAGCTGCGTAGTAAGTTCAATGCCAGGCTGTAACACACAG
AGAGACCTTGTCTCACAAAACCAAAATATAGCATTTCATATGAGGCAGATGTACACAGTG
TTTTTTTTTTTTTCTGCAAGTATTGTTTTTTTATAGACGGGTTTTTCTCACTGTTAAAGT
GGATTTATTGTGATTCACTTGTGAATTTTCACTTTATTTTTATAGATATGAGTAATCTAG
AGGTCAGGAAAGCCTTCCCCATAGAAGGGTGTTTAAATTAGAATCTGAAGGTTAAATAGG
AGTTAAGGAAGGTGAAGAAGAAGAGGAAAGAAGAAAAATTGAAGATTACTATCTACTTTT
ATTTAGAAGATTTTTTAAAATTAGCAAGATATATAGGGAGCTTTAAAAAAAAATAGGTCT
GCAGATATCAGACATAAGAAGACCAAATGCTAAAATACCCTAGCTCTCATGTGAAAAAAA
TCAAAAGCTTCCACTTGTCCCAAATTTGTTTTGGGGTTATGGACCCAAATTTGAGACAGA
AATACTTAACAAATTAATTGGTCTTGGAAGTCATCGGTACCTATAGAAGGCCACACATAA
GCAAATACATAGTAGTGGTATAGGAAAATTTCTACAGTTCAGGTCTCCTGGGAATGCTGA
AGAAAGAGCAATCCTCATAAAAGTGAAGCTCCCACTTACAAAAAGGACAAGACTTACAAC
CTTGCAAAAAAGTCAGAATTAGCAGATAAAGCACAAAAAGTTTTGAATAACAGAGCAAAC
TGAATGAGACAAAATATTTTTAGTTATTGAAAAGATTTTTTAAAGGAAAAGATAGAAAAT
ATGAACTGAATCAAATAGCATCTCTAGATTAAAAAATTATTATGAACCTCTGGTTCTGGA
TAAGATGGAATAGACAACTCTTATTTCTACTCTTTGCTGTAGGAATATTAGTCTTGAATC
TGCACCTAAATGCACAGTTTCAATAAAGCAGAACTCAACAGGATAATAAGAAATTGCTAA
ATGTATGGCAGAATCAATATATTTAATACAAGGACCTGAGGAGTTAGTAGTTTAAGCATA
CAAAATGAGTTCAGGACCCAGAGGAACAGTGAATAAAAGCGTCAGTGGTGAGACATATCT
GAAACAGAAAGCAAGGTCAGTGCAACATCAGATCTTACTGTAATATACCCCACTGATCCT
TTAAAAGAGAAAAACCATATGATTAACAAAGAACCAGAGACCCAAAAAACCATATGCTAC
ATTTAAACATTTATACCTAATTTAAGCTAACTTTTAAAGAATGTAATGCATAATTTTAAT
CTCATTAAACGCAAAATTTAATACTCCAATAAATAGAGATCTCATTGAGCACATATTATA
CATATGGTAAAATGTTATAGGCATTCTACTGAAGGCTGTCACCACTGTAAGGAACACAGA
ATTAGTCCATTCTTTTAATCGATATATTTGTGGGTGAGGTCTTAGCCAGAGCAGCAAAAA
CTTACTCTGAAAAGTAAGCATTTACTAATGGTTATAACTAAAATCCATTACCATTNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTAA
AACATGCAAACTGTACCAGCATGTTAAGTCCTCTGAGAAAAGGTCAATAGAAGGGGACGC
AAATCAATATATGCAGATTATGTGAAAATGGTAGGAAATCCAGAAAGTCAGTCTTACAGA
CAAAAATGTTATTTTTGTTCTCTGCTTATTAGAATGTTCATTGAAAAATATTCATTTATT
TATAAAAGTATGTTATATCCCTATACATGTGCCACAATGAAACCCATTATCTAATTTATG
TACTTATAAAAGTAAATAAGTATTTGTTATTTGTATTTCTTCTGTTGTTTATTCATATTT
TTTGCTCATGATTTCCTTTTGAATGCAGTTTGCATTGAGCTACATCCTCATTGTTTTTGA
AAATGTTTTATTTTGAAACAGAGCCTCACTTAAGTCTGTAAGTTACCCAAGCAGGGCTGC
AACTTGCTATCCACAGTCCTCCTGCCTTGGCCTCCTAGAGTGGATAATTGAGCTTTTAGA
AAAATTGTTTATACCTTTTGTAGATGAAAGAAGTTCAATTTTGGTCATGTATATTAAAGT
ATTTTCACATTTTGTTATTTTTAGCATTGCAAAAATTTCAAAGTTTTATGTATTTCAGGA
TTATCATTCTTTTTGTTGGTAATTTCTAAGAAACCTTTTGTTGGTGGTGTGGACCTTTGT
GCTCAACTACATCCCTGGCCCTATTTTTAAAAATTTTGTTTTTAAGGGAATAAAACAAAA
CAGAACAATATTGGATTTCAAAAACAAGACAGAAAGAAATCCCCCACAGTTGTTATATTG
CATATTGTTAGGCCTGCACAATCAAACAATACAAACATTAAGTTGTTTTTTTTTTTTTAC
TTCAGTTGCTATCATCTCAGCCTGTGTTCCTCAGAATCAACCAGCCAGTTGCTTGGTAGA
GGTGGTGGTGGGGTAGTGGTGGCACTCTTCTTGTTTACCAACCTACAGGAGGTTGGTCAC
AGGAGGGCATAGATCAGCTTCTTGGTTCTCTTCCCAGCCCATAACTGCCACTGGCTCATG
GGAGGGCACCAGCCCAAACTGCTGCTCCAGCCTTATTTTTAAACTTACAGGGTTTTGTTT
GTTTGTTTGTTTTTTGAGACATGGTATCACTGAATTACCCAGGGTAGGCCAGAACTCTAC
CTGAGCCTCAACCTCCCAGAGTGCTGAAATTATAGGTATGCACCATCTTGCTTGGCTTTC
TCAAAAACTTCATTTCTGTAATAGCTTTGAGATTTAAAATACTTCAACTGTTTGCTGTTT
CTCTTAGTAAGACATTGTTAACTTAATTGGAAAACTATACATACAAATGGGAGCTATAAA
AGAATTTTAATGCATTATATTAGCTTAAGTAAACGCAAAAAAAAACACTACAACCATTTT
GTTTTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGTAGCAGTTATA
GTAAGTAAAAATTACTCTGAAAAACAGCAAGTTACAGTAAAAATAAATATGGTGTGAAAT
CATTTATAAAAAGTTCCCAAACAACTAGCTATTACTTAGGGGTACATATATAGAGAAACT
AAAGTGAAATGCAGACTGCAGAGAGATTGCAGGGCTGTTCTTAAGGCACAATTTCTAATA
ATTTTTAGAGAGAGGGACAAAGGAAAATAATGAGTAGGTAGGATTTAAACAAGTTGAACA
GATTTTTCTTTACAAATTCTGAGCAATCATGAAAAAAATTACTTTTAAGTTGATAGTGGT
TTTATTTTCTAAGTTTTATGTATTTTATAATTAAAAGTAAATTTTGAAAACTGTGTGTGG
TGGCATATGTCTGTAATCCCAGCACTCTGGAAAGTTGAGACAGGAGGATCATTAAATTAG
AAACTTCTTAGTCAATTTAGCAACTTTTTGAGATCCCATCTCAAAATAAAAAATGAAGAG
CTGAAAATGTAGCTCAGTACATAGGCCCCAAGTATTGCTATAAGCAAACAAGTAAATTTT
TTGAAGGTAAATTTAACTTTGAAATATCCTTTTAAAAAGAGCAGAAAATGAAAGTTAAAA
GCTAGAAAGAAGTACAAATGTTATGCTTGGAGGACTTGGAAGCCCTATGTAAGGAGACTG
TTTCATGGATAGTTTCCTGTAACTACTGTAAAAAAAATTATCACACACTGACTAGTTTTA
AACAACAGAAGTATTTCCAAGCAATACACTGTAACAGATTATCAAAATAGTTGGCACAAT
TTGAGCTTGCTCCAACAAAAAAGTCAAACCTATTTGGGCATTCTCACCTCTGTGACACAG
GCCCTTGCATATACTTAAACAGGTTTAAAAAAAAAATTTGGCTGGGCATGGTGGTGCATA
CCTGTGATCCCAGCACTCAAGAGGCAGAGGATCACTGGAGTTGGAAGCTAGCCTGGGGTA
CATAATGAGTTCAACTCCAGCCTGAACAACATAGCAAGACCCTGTATCAGGAAGGAAGGG
AGGGAGGGAGGGAAAAAGGGAGGGAGGGAGGAAGGAAGGAAGGAAGGAAGGAAGAAAAGA
GAAAGAGAAGAATGTAAGCAAGCAGAAATTTATTCCCACTATTTTGGAGACCACACACCC
TACATCACCATGTCCATAGGGCTTCATTTTTTCTGTGTATTTAGAGAGGTAATTTGTTCT
TGGCCTTTTCTAGCTTCTGCTGGCTCCAAGTATTAATTGACTCACGGTTTTGTAACTCTA
ATCTCTGGCTGTATCTTTTTCTCTGTGTGTGACTTCTTTGTATGTCTCTTACAAAGATAA
TTGTCATTGGATTTAGAGTCAGCTTTAATAATCTATTAGGAGCATGTCTCAAAATCCTTA
CCACTAATGCTTCTAAAACAACAACCCTCTAGCAAATNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTAAAA
TTAAGTATTGAGAAATATCAGTAGTAGCTGCGAATGTTGATCCTATCATGTATACCAAAC
ACATGTATGAATGTGGCTCATTATTTTTCTTCTCAAGTTTTAAGCAGGGTCTCAAAACTC
TTGGTGTGTTGGAAAAAATTCAGATGTACCCAGAAGCATTTTATAACATCCTCTGTCATA
AAGCTGAGAATCTTTCTGCAAAAATCCTCAGAGATCTTTTTACTGTACACACATTAACTA
GTGTACCAGCATTGGGGTTTTGGAACAAGTACCTACAGAGTGTTGAGGGTACGTGGGTAT
TTTATTTTTATTTAATTATCTCAGAATTGTTTCAACATATTTATTTCTTGCAGTTTTGCT
TCTTAATACTAGTATTTGCTAACTCCAAACTTACAAAAGAAATTTACTTCAAAACAAGTT
TTCATGACTGAATTGGAAATGAAGAAAAAAGTCTACAGACTAAATCTATATTTTGAAATT
TATTTTACTCTAGATAATTTGAACTGAAAGGCATTTTCAGAGAAAACCTGGAATATGTTG
ATGTTTGCAACAACCTTAAATATGCAGATGATTCCAATACCACAAAACAGTGTTTTTGCT
TTTGTAGTACTCGGGACTGTATTCAAGGAGAGCTGAGCTACATCCCGCCCTTCTTATTTT
GTGATAGTCTCATTAAATTGCCAGGCTAGCTTCAAACTTAGAATCTTCCTGCATCAGCCT
GCTGAATAGCTAGAATTATAGTTCACTTGGCAAGGGCATATAGTAGTCTTTAAAACCCAT
TATTTAGTTCATTTTTTCAGTTTTGAGTTAAACTCAGTTATTTCTTATGTACCCTTTTGG
ACTATGCCAGTGATAATTTGTCATTGAGACTAGCAATGCAAAATTATTCCATTTGATAGG
ATGGAAAACTTTTAGCCATTTTTTCAACATTTAATTTTTTTCCTTTTATTTGTTAAACTT
GCAAATTAATTAGTAATGACCTGTAAGTAGTAATATATAGTGAATAGTTAGACAAAATGA
TTTTGAGTCCTTCTACATTGAGAGACCTTTCATGAATGTACCGTTTGCCTATTATCATAC
CTCAGTTAGTGATTTAGTTTGCCCAAAATGCAATTTGGAGTCTGTGACCTGCACTATTCC
AGTTTAGTTGGGGAATGAGGCAGTGATGATAGCATTATGTAATATTGTTTTGTTCTTATA
TTTTGGAGGGTTTTTATTCACTTTTATTGTTTAACTTTTCAGATGGTAAATCTGCAATAA
CAATGGAAGACATTCTTGTTTTTGCAACTGGTTGCAGTTCCATTCCACCTGCTGGATTTA
AGCCCACTCCTTCAATTGAATGTCTGCATATGGATTTTCCCATTGGAAACAAATGTGAAA
ACTGTTTAGCTCTTCCAATCACCAGTACATATGAAAAATTTCAAGAAAATATGGACTTTG
CCATAAAAAACACTTTAAGACTAGGAAAAGAAAAATGTTCTCACCATGATGAACATTAAA
ATATTTCTGTGAACAAAGAAATGCTTCTTTAAAAGCTGCTATTGATAACATTCCTTTGTC
TCAGAAATCTATTAATCATATTTTTGAACAAATTTGTCATCTTCTTGGTCTATTAAAACT
TAGGATATGTACATAAAAGAATGTTTTGGCCATTTAAACAAAAATTTTTTTGTTAAAGCC
TTCCAGTCAAAATTGGTGATATTTTTTGTTTTCTAATATGTATGCTTTACAAACTTCAAC
ATACTTTTAGAATGGTTGTACAGGTTTAAAACAGGTGTAGAAACATCTTAAATACGGAGA
AACCCTAATCTTTTAATAAATTAGAATTGCCTAAGGATGCCATGATTTTTTTAGTTATGC
AATTTTCAAATTCTTTAAGCATTAAATAGAAAGACTAGCTGAATGTGGTGATGTATGCTT
GTAATCCCAGCAACGAGAGGTTGAGGCAGGAGAATTACTGTGAATTCAAGGCTAATCTGG
ACTACATAATGTGTTCAGGGCCAGCCTGAACTTCATAGCAAGATCCTAACTCAAAAAACA
AAACAAAAAAAAAAAAAACTTTCTCAGTTAAAGCCTTAAAAATAAAAGGTATATATTCTG
GAGTATGCAGTATATATATGATTATATAGAATGGCACTAAATTCATTCTAAGATGTTTTT
AGATTACTGATTTATATATAAATGCTCCATACTGCAATTATATTGTACCTAAGAGGAAGT
AGTAAATAGAAAGCAGAATTGCACAGTTATTCTGGAATGGACATCCTATAGGCTTAAAAA
CACTTTCTGAGATGAATAAAATGTAGTAAAAAATACTTAGGACAATGTATCTTCTTTAAA
ACCATGATTTTAATCATGAGGGTTTTTCCCCCTGTATCTTATGTATGTTATTCAATGTGT
TTGATCCAGTCACTTTACATATCTGAATGTAGACTATCATATGGTTGATTTGCTATTTGA
CACTTGTTATCAGGATAAGCTGCTATCATAGCATTATAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1096, 3046..3147, 5378..5502, 7225..7390, 10402..10508, 11357..11473, 13913..14035, 14038..14039, 14189..14321, 20494..20801, 22428..22609, 25297..25299, 25302..25307, 25310..25467, 37057..37247, 38202..38458
1001..1096, 3046..3147, 5378..5502, 7225..7390, 10402..10508, 11357..11473, 13913..14035, 14038..14039, 14189..14321, 20494..20801, 22428..22609, 25297..25299, 25302..25307, 25310..25467, 37057..37247, 38202..38455
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved