Cavia_porcellus Locus RPL23A
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPL23A
Cavia_porcellus
RPL23A
GeneScaffold_5697
SNORD42, snoZ17, SNORD42, snoZ17
1453..1520, 3624..3690, 4216..4280, 4470..4539
5657
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCCTAGTAATAAACAGTCGGGGAGCTGGGAATTTAGC
CTCATGCGGCATAAGGGCCTGCCTGACAAATGGAAGGTCGTGAGTTGGATCCCTGGTACC
AAAAAATAATAATAAATTAAACAGTCGGGTGTGGTGGCACACTCCTGTAATACCAGCACG
GGAGAGACTGAAACAAGAGGATCCTTAGGAGTTCGAGACCAACCTGAGTTACAACGTGAA
CTCAAGGCCAGCCTGAATTGCATAGCTTGTTTCAAAAAGATCAAAAATAAATAAATAAAT
AAGCAAACCAAAAACTACAACTCCCAAGAAGCTTTGGGGCCTGAGGAGGAGTGGCTCATG
CTTAGTCACTCTTGCGAATAAATTAAATTTAACTACAATTCCCAGCGAACACCACGCTAA
ACATTACCCAATAAGAACTAAGCAAAAAGTATCGCGAGTCTTCGGTTAGAGTTAGCGCTA
TAAGCCCATGGGAACGAGGGTGGGAAACCCTTTTTATTAAGATGGCGCCGAAGGCGAAGA
AGGAAGGTGTGTGTTGGGACTGCGGGGGAGGGTGGTCCACGGCGGGTTTTCCTAGGATGC
GGTCCCGGAAAGCGAACGCATTTGTAGGGCGGCGGCCGGTCCGATTCCTTCGGAGCTACT
CCCGGCGATTGAATGCAGCGTGTCGAAGGTGGGCTGCGTAAGCAAGCCTCATGGGCTAGG
GTTCCGTGAAGGGGTTTGGAGAAACAACCTGGCCGGCATTATCCGCCAGGGCTAGCCACA
CAGTTTACGCTAGGAAATTTAGAAACATCCAAAGATAATCGCTCCGTATTGCCACATCCG
TAAGCATATAAGTGCTCCAGCATAACTCATTTTTCTTTATGTGTTAAGTGGCCCTGTATC
CCCCTCTCATGAGTGTTTGTTTTCGTTATATCTTTGAAGTTACTCTAGATTGGTTGTTTT
TACTTTCCATATCGTGCATATGATGGAAAAAAAGTTAATCTCCTGAGATTTGTGATGTCT
CCAAAGGAACCACTGATGCACGTGTAGGCTGGGGCACTTGCTACAGGACGTGAGGCCGGA
AGTGACCAACGGGTTTCAGAATCCCAGACCTTTCTTTTCTTTCCCAGCTCCTGCCCCTCC
CAAAGCTGAAGCCAAAGCAAAAGCTTTGAAGGCCAAGAAGGCCGTGCTGAAAGGCATTCA
CAGCCACAAAAAGAAGAAGATCCGCACCTCACCCACCTTCCGCCGTCCCAAGACACTGCG
GCTCCGGAGGCAGCCCAAATACCCTCGGAAGAGCGCCCCCAGGAGAAACAAGTCAGTACT
GTTCCTATACCTATCTGAAGATACTTGAATATCCTTCATTGTTAAATTACTCGCGCTGGC
GCGTTCTCGTCAAAAATGCAATAATATCTAGTGTATGGGAGTGAAGATTTTTCAGCCCCA
TTTGTTTGGTTTTGTGTTTTTGAGACAGGGTTTCCCCTGTGTAGTCCAGGCGGGCCTCAA
ACTCGCGGTAATCCTCCTGCCTCAGCCTCAAAAATACTGGGATTACGGGTGGGTGCCACC
ACACCCACCTTTTCTACCCTGTTTAACAATTAAGTTTTTAGATACTGGCAGAAAAGTTAT
CAACCTATGGTGGCAGATTTTTTTGCTAGGTTAATTATTTATTCAGCACAGTCGGAGTTT
GAACATGTTTTTTGGGGGTATAAAATAGTCAATGGCCAGGGGGTTTAGCTCAGTGCCTGT
CCGGCAAGTGCAAGGTCGTGAGTTTGATCCCCAGTACATAAATAATCAAACAAAGCAGTC
AGTGGACATAGTGACACACTTTTAATCCCAGCACAGGGGAGGCTGAGGCAAGAGGGTCAC
TGTTAGAGACCAGCCTAGGCTACATAGTTAGACCCTGTATCAATCTCACTTCCCGCCCCA
AAATACATACATACATAGTACACTCAGTGCTGCAAGTTTAGTTCCTTGTTTGTGGCACTT
ACCCTTGAGGAAACAGTCTTAGAGGTGAAGATGTGACTGGGTCTGTGTGTGTGCATGTGT
ACCATACTGAGGATTTAACCAGAATCTATTTGCACGAGCCAGGCTGGTGGTCTGCTGAGC
TGCATTCCCCATCATTTGAGACAATTTCTTAAAATTGAGTGAGTGGGTAATGTTATTTGT
TTCTTCCTTTGGTCTTTTTGAGACGGGGTCAGGCTGCAGGTCAGGCTGGCCTTGAGCTCA
CTTTGTAGCCCAGCCTGGTCTGGAACTCACAACAAACCTCCTGCTTCAGCCTCCTGAGTG
CTGGGATTACAGGCATGTGCCACCACACCCTGCCAATAAAAGGTATTAAGAGAAAAGGAT
GGGAGTATACTTCTCTTATGCCCCTAATTTTTTTTTTTTTTTTTTTTTGTCTTTTCATTT
TTATCGTTACGGGGGAATTGAACTCACAACCGCCTGCTTGCAAGGCAGGTGCTTATGCTG
CTGAGCTAAATCCCCAGCTCTTGTGCCCCCAATTGGGATGTAGAATTTAGTGTAAAAGAG
TTTGAGTCTTGGCCTACCTTCAAAATAGTAAAGTAGTGTAGCTGGAGAGTCTGCAGTTTA
GGGGGGAAAAGGTGTGTTCAGTGTAGCCTGTAATCTACTATTCTAGATGCTGAATTACAT
AAATTGTGAGTTTAAGGCCTACCTGGACTACATAGTAAGACCCTGTCTGAAACAAAGTGG
TAATTCTTTTTTTGTTTGTCTTTTTCGTTTTTATCAGTACCAGGGATCGAACTCACGACT
GCCTGCTTGCAAGGCAGGCGCTTATGCCGCTGAGCTAAATCCCCAGCCCCAAAGTGGTAA
TTCTTGATCATCCCTCTTTAGCAGCCACTACAAGCAGAATTTGTGTGTGTTTTTGAGATA
GCATCTTTAGTGCAGGCTGTTCTTGAAATATGTTAGCCCAGCCTGGTCTCCAACTCTGAG
ATCCTACCTCAGCCTCCTGAGTGCTGGGAATACAGGCTGGGAGCAGAAATTTTGATCCAC
CTTCCTAGGGAACTGTCAACATGGAGGTCCAGTGAGTGAGAGTTTGAGTTAAAGATGATT
CTTTAAAGGATAAGAGCCCTTTAGGTCAAACAAAATAGACAAGAGTTTTGCCTTCCAGTA
AGAGTTGCCCAACCCTAGGAATAAGGTGCAGCTGATGACACTAGCGACCAAAGTCTGACA
AAAATGACTGTTACCCATTGTCTGATGCACCTGTGTTCTTAGATTAGGGCTCCAAAAAAA
CCCATCCCACTGGGACCAGGCTTGGTTACCTGCCATTCTACCCTCAGGCTTGACCACTAT
GCCATCATCAAGTTCCCCCTGACTACGGAGTCAGCTATGAAGAAGATAGAGGACAACAAC
ACACTCGTGTTCATTGTGGATGTCAAGGCCAACAAACACCAGATCAAGCAAGCTGTGAAG
AAGCTCTATGACATCGACGTGGCCAAAGTCAATACCCTGATCAGGTGAGTGGGCCCCTTA
CCAAGTAGGCCATGTATGGCTTAGAGTTCCCTGATGCTGCTCTTGAGGTCAGAAGTAGGA
TTTTCACTATGTGAGCTCCCCTGTGAAGTTAGTCCTTTCCATCAAGTATAGAGCTGAGGA
AACTCCCTCTGGAATTTCACTGATGGGGCTGGGGCAGAGGCGGGCACTGAGGGAAAGTAT
AGATGTTAGATTACATGGGTTTAGTCTCAAGGGTCTTGGGTTTCTAGTGAAAGGAAATTG
GCTTGGTGGCTCCTCTGTGCAAATGATGGAAAATTCACTATTTGGAAAAGAATGACATGA
ACAAAGGAACCGCTGATGCACCAGAGAACCAGGGGAGGGCGGGAATGTGGGTAGTGACAG
CAGCAAGGGCTAAGGTTTATTCTCCACCCAGGCCTGACGGAGAGAAAAAGGCCTATGTTC
GACTGGCTCCTGATTATGATGCTTTGGACGTTGCCAACAAAGTAAGCTTCCTTTCTAATT
AGACCCCTAACACCACACATTCACCCACTGGGTGCAAATGATGAATCTGTTAGCGACCAA
AGCCTGACTTCCTGATTAGTCACAACTGACTGACTGCACCATGATCCTTAACAAGCTCTG
CTCTCCTGGTCTCTCATCTTCAGCAGGCCACCTTACATCTTCCTGTTTCAGCCCTGGTAA
CAAAGCTCCCTTTTGTTTTTCAGATTGGGATCATCTAAACTGAGTCCAGCTGGCTAGTTC
TAAATACACATTTTTTTTCTTCGTTTATATGCTTCTTGTCTTTATGTCAGTTTCTGGTTG
GGCTGGGGAAGGCCATGCCATGGGATACACGAAGTCTTGTGCAAGACTCATGGGGTGCTG
GTCATCAAAGCCAGGGCCTGGGACACATGTTGGGTGAACTCCCCACCCCTGAGCGGTATT
GGTATTTCCAGCTCTGAGTACAACTTGATATACTCACCCTGTTGGAACACTCAGTCCATC
AAGCCATGATACTCTTTAATAACTGGTAGTGAGAGCGAGATACCACTAGAGGTATTTATT
ACTCAGATGAAGGTTACTTGTCCTAGGACAACTTGTAGGGACAAGGGAACAAGCTTTACA
GGATCCCAGTTGCTTATCCCTGGAAGTGTAGGGTTATCATTAGCATCCATTTCAGGTCAG
TGTGGGTTGGCAGCATGTGGGTTGGATCCTTATTCTCACCCACATACCATTCCAACCGGT
TCCTCTGCTTCCCTCACTCAGTTGCCCAAGAGAAGATTTTAAGGCTTCAGAGGAGTGCTT
TCAGTAGTGTGGGTGTATGCTTTAAGGTACACTGGCCCCTGGGGGTGTCCAAGGCTTGGC
GTGGACCCAGTTTATCAGTGAGGCTGTTTCTGTTCTGGCTGTGTTTGCTGTCTTCACTGC
ATGTCCCAGATTCTGTGCCTCTCACTCAGTTAAGAACTTGTCTTTGTGTTGCTGGCTGGG
GACATGGTCAGGGCAGAAGTCATAGCGGAGGAGGCGGGAAAAGTAGATGAGGATCATCAT
ATCCAGCATGAGCAAGACAGCCAGCACAAACGTGCCCAGGGTCCTCTGGCCTGCATACTG
CATGAAGAAGTTTGTGAGGTAGGCCTGAGGGGCCAGGCGGAAAAGAAAGTACATGACCAG
GTTGACATACTTGTTGACCTGATAGAGGAGGAGATCCTGGGCATTGTTTATTTTCATCAT
CATGCGCATGGTGAGGAA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1025, 1607..1790, 3767..3943, 4351..4420, 4643..4657
1001..1025, 1607..1790, 3767..3943, 4351..4420, 4643..4654
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved