Cavia_porcellus Locus KIAA0907
snOPY snoRNA Orthological Gene Database
Cavia_porcellus KIAA0907
Cavia_porcellus
KIAA0907
GeneScaffold_3128
SNORA42
16080..16208
20986
ACCAATTTCACTGTACGATCTTAGTTGGCTTTATTCTGTCTTATTCTGTTGTATTTTAC
TACTTTCAAAATAAAATAAAATGCCTCTCAGAACAGGCAAGGGAAAACTGAAGAAATCTA
ACAGCTATTAAAATATGGGTAGCTGTTGTAATAAAAACAAAGGAATGAATAGACCAATTC
AATAGAATTCAGAAATACAATGTGCGAGTATGTCCTTCAATACAGCATGTGGATTATTGC
TGATGTTAACTTCAGTTATATAGTTAGGGCCATATATGTGATATTTCTCAAGTGTGGCTA
AATTGCCCCGATGGGCTAGAATCTTTAAATTTTCTGCCTCAGTTTCCCAGATTACTTTGG
GGTACAAGACCGGTTTAAATTTTATCTTATTTTATTTTAGCCTTTTTGAAACAGGTTTTC
ACTATGCAGTTCAGGCTGGCCCTGAAGTCGCTTCATAGCCCAGGCTGGCCTCGAACTTGC
AGTGATCCTCCTGCGTTGGGCCTCCCGAATCCTGGGACTACGCCCAACGAAATCAGAATT
CTACAATTTCCCTTTGGAACGAAACAGTTCCCTTCCTAAATAAGTAACTGAAATGTAAAT
TATAGAAATACCATAAGAAGACTTCGTCTTCAGCCTGAAGCTGGGACACCACCCAAATAA
ACATAAATTTGGGGAGAGACCTGTTTATTCCGATTCATGCGCATTGTCTTCCAGGCTTCC
TATTTGCCCACAACAAAGATGAATTCTTCTGGTTCTTCAGTCCACTTCTAAATTGGACGC
AGCAGCCATTTTTCCTTAGGGCAAAACTCAAACCGGAAAGTCACTTTCTACACCCGCCTT
CTAAACGCCAAACGCGTTCGAATCACCAAGTGTCCAATTGGAATCGGCTTTCTCGCCGGA
ACCTCGCTGCTTCGAGACCGGAAGAGACTGTGCGTCCGGGAGTTGGGCGGAAGTGACGGG
AAGTGTAGTGGAGTAGTTGGCGGGTGTGAGTGAGCGTCGCCATGTCGCGGGGAGCGCGAC
ACATCCTGGAGCTGGCGGGTAAGGTTCTCGGTGGTGGGCTTCGTAGCNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNGAACATTTAGGTAGTATTTTGTCATAAATTTTACAAAGTATTTTTATTG
GACTCATTACATTTTATGAACCAAATAGCTTGTTTTTGTCCATGTTCGCTAACTTGAATT
TCAGCTCTATCCACTGTCATCATTTAAAGCATGTTAATGTCTATGGATACACGTGCTTTT
TTCCCTGAAATAGAAAAGACTGGCATGGTGATGCAGTCATGTAATCCCTCGCTCTAGGAA
GCTGAGGTAGGACTGGAAGTTTGAGCCCAACCTGGAGAATTAGACTTTATCTTTAAAAAA
GGACAGCTCAGAATGGAGTTCAGAGCAAAGTTCCTAGGTTCAGTTTCCGGAAATGGAAAA
ACAATAAAAAAGAAAGAAAAAAAATTAAGGTAACGCGTGAGCTTTAAACTGTCACCTCTA
ATTAGACTGTATCGATGCTTAATGACTGAATACAATTAAACATGACTAACATGGAGGTAC
AATTTATATTTGACTGATTTGGTTGCTTTCATACAAATAGTGAGGGAAGTTAAATAGAAG
TTAATAAAAACTGTTGATATAACTAGAATCTCACAGTTAAAGGGGACCTGACTGAAGCCT
TTGCCATGAAGTGCAAGAGTTTTATTATAAGATAATGATAGTGGCTATTTACATTGTATG
CTTTGTAAATTAAAAAAATTCTTTGCAGCAAGAGTAAGAACACTTTGACATGAGGAAAAT
TTGGCTAATGAATGTAAAATAATTTGTCCAAGCCACAAATAGTTCAGATGACTTCAAAGT
TACCTCATACAAATGAATGTTGAGCTTTTGGCTGAAAACCTCCAGAGTTACATTCCAGTG
TAGTCAGGTACACTAATTTTTTGCGGGGAGGAAATTTCAGTACTGTCTTAACTACTTAGT
TCAGGTTGGCCTTGAACTCAGGGCAATCCTCCTGCCTCACTCAGTCTGTCAAATGCTGGG
ATTACAGGCATGTGCTGCTGTGCCCGATGTATATCATTTGAAAAGAATTTTTTGGCTTAA
ATTAAGATTTGCCTCCTATTGTACTTCTGAAGAAGTAATATTTGAAAATGCAGTGTTTAA
GAGGTGGAGGGGAGGAAGGGGCATAAAAAAAAGATGTGTTGTTACGTACAGGTACCAGTT
CCCTACAACGAATGGTTTCATATATACTGCAGATGTGTTCTAATAGCTGTGGATTGTAGC
TCATGCCTATAATTCCAGCACTTGGGAGGCTGATGCAGGTTTACTGTGAGTTTGAGGCCA
TTTTGGGGTACAGCATGAGTTCAGAACTAGCCTGAACTTCATAGTGAAATCCTGTTCTAA
AAAGAAAAAAGGGGCTGGGGAAATAGCTCAGCTGGACAAATACCTGCCTGGCAAGTGTAA
GGTCCTGAGCTCAATTCCCGAGCCTAAAAACTCATGTACAAATAAAAACAAAAATAAGTT
AATCAGAAAAAGAAAATGCAGTGCTTAGTGACCTTCCACTTCCATGGTATATTTTATCAG
TCAGCCATAATCTCTTTGGATGTTTAAATACTAAAATTCTACAGACTTGATCAGAACTTT
GAGTAAAAATTGCAATACAGATTATATTGTCAGTGACTTCAAAAATCATTTGTATTGGTT
GCCTATTGCTGAGCCCTGTGTGAAAAAGGAACACGTTGACAAAGGTGGAGTACTACCTGA
ATATCCTTTGCCTGGGCTGGCTTTGGACTTGTGATCCTTCTGCCTCAGCCTCCCAAGTAG
CTGGGATTAATACACACACCACCAAGCCTGGCGTAAATATCCATATTCTTAGTACTGGAT
GTTCATCACTTATATTCATGTTTGTTTCTCTAAAAAGTAATCTTCAAATGATAGCTGTGC
TCAATAGAAAGCAGTGCAGTGAATTAAAATTGTATTTAGAATCATAGTATCTGTTTCACA
GCTCTAATGTCCAAGTAATTGGTTATATGGCTTTGACATCTTGAATCTCAGGTTTCTCAT
AGGTTCCTGCATTGTCTAGTGCAGTAGTCTCCAGCTACATGTGGGTGTATAAAATACACT
CACTGAATATAATCTGAATATAATGTCAGATTCACTTTAATCCCAGTAGCCACATTTCAA
GGGCTTAGGAAACACCGGTAGCTAATGGCAACCCGATTAGATTGCTTAGATACAGGATAC
TATTTATTTATTTATTTATTTATTTGATCCAGGGCTGGCTTTGAACACTCTCTGTAGCCC
AGGCTGGCCTTGAACTTGCAATAGTCTTCCTGCCTCAGCCTCCTAAGTGTTGGGATTGCA
GGAATATGCTGCCATGCCTGGCTCAAGCATACTTTATTATTATAGACAGTTCTGTTGGAT
AGTGTTGATACAAACCTGTAATGGTGATCCTGAAAATTGAACAAGATAAAATATGTTGGT
GACTTCTGTAAGGTGCTGAATAAAACTGGAGTGATACTATAGAGTGTGTGTTTGGTTTTG
CGTCCATGTTTAAAAAAATGTATCTGCACAGAATAAACAGTATTTTACCTTGCTTGAGCA
GATTTGCTGGCCATGGGTTACAGGAATGCAGTCTTAGTACTTTTCCTGAGATACTCAAAT
TCAACAATCTGAGTTATTGTAGTTTAAATTAGAACCAAATTAGGCTAACAGACCTGACTA
ACTTATCATCCATTCTCTTTGTTCTTACATAATTGAGGGCAAGGGAATGATTGATCAGCT
GCAATTTTAGGATTTTTGAAACTATCACAAGAATAAATCAGTTGGATTGGGTGTGGTGGC
TATAGGGTTTGTACAAAGGCAATTTCTTGTTGCATGTATGAGGTCTATGGGTTGCATGCA
TTCTTTGTGCTTTAAATATTTTATTATATGCGTTGGCCCTTTTATTTTCCTTTTAGAACT
TCTTATTTATACAGGTTCTGCATTGATGTGACCATAAAAGCATGCACACGTATGCACATA
CACATGGCCAAGGTTACAAAGAATCTGATGGTGGCCAGCAGATAAGGGAGTTAATTTATT
GTTACTTTGATGAGATTTTTGTGTGTCTTTTATTCCACTTAAAAAGTGTGGCAATAAAAA
CATGTTGCAGGTAGGTAAAGGAAAAGGTAGGGAGCTGATGGAACTTGGGAAGGAATATTT
AAAAACTGAATATCTAAAAGATGTTATCATATAAACTTTTTTTTTTTTTTAGCTTCAGGC
CCCTGGAAAAGGCCTAACTAGCAATAAAAGCAAGGATGACCTGGTGGTAGCTGAAGTAGA
AATCAATGATGTGCCTCTGACATGTAGGAACTTACTGACCCGAGGACAGACTCAAGATGA
GGTGTGAAGGGTTGGGACTCTGGGGAAGCGGGTAGGTGAACTGACAAAAAGACACAAGTA
TTTGAGAGGGTTTCGGTCATAGTCCTGTATCGGTGTTGAGTTTAATGTATGCATTAATGG
GATATGATGTTGGGTTTAATGTATGTATTTATGGGATATGATGTCATACGTATACCTCAT
CTTTTCAACAAAAAATTTTCCTTTTAGATCAGCCGACTTAGTGGGGCTGCTGTGTCCACT
CGAGGGAGGTTCATGACAACTGAAGAGAAAGCTAAAGTGGGACCAGGGTGTGTAAGCTTA
CCCTTTCTTTGGTTTGGGTTTGGTTAGGCTGTGATACTAGCTTCCATTCTGAACACAATT
TTCAGTGTGTGTAAAGTGTATTTGGTTAGTAGGTTGAGGGTGGCCGTGTATTTGTATATG
TGTGCATATGTGTTGTGGCAGAATTTGGGGCATTTCAAGTATAAGAAATGTTGGGAACCC
ACTTATTTTCCTATCATTGTGAAGTTGAAATTGGGATTAAAGGGGCTGGGGATATAGCTC
AGTGGCACAAGTGCCTGCCTGGCAAATGTTAGGTCTTGAATTCAATATCCAGTACCAAAA
AAAAAAAAAAGACAGAAATTGGGATTATTAAAACCAAGATCTTTGCACTGAATGCACTGA
ACTGCATCGTTTGTTCATCTTGTCTGATTTATTTATCAAGAGAAGGTCTTAACAAGTTTT
ACAAGCTGGCGTCAAATTTGGTAGTCTTCATGCCATACCTCCTGAAAACTTCATTTCACA
GGTGGCTTTTTTTTTTTTTTTTAAATGTTTTGTTTTGTTTTTGAGGCAACAAGTTACAGG
GTAGCATAGAAAAAAGGAATAATGGTTAACATTTAATACATATACTTCTTTATCTGGTAG
AAATAGTTTCTTCAGATGGGCTCATTTTATTGTAAACCAACCTTCACTCCCTGCTGGGGA
TTGAACTCAGGACCTCACATTTACTGAGCACAGGCTTTACCATTGAGGAACCTTCAGCCC
CCTCCCTTTTTAAGAAGAAATTTTATTTTTATTGCCTCTGTGATTATTATACAACAGTAA
ATGCCCCCACCCTGCCAGTTACCCAGGTAACAATTCCTCCTACAGTTATGTTACTTCTGT
TTCTTAGTAATGGCTGGTCACTCTGATGTATAGTAGGTCACTATGATGCGTATTGTAAGA
ACCAGTCCTCAGATGACAAGCCAGTCTGCATGTGTACTCCTGCTTGCTTATTACATGTAA
GCCCTAGACCACCAGAGATCAGGGCCTGACATTTTTATAAGGATTGATTCCTTGTGAGTG
CTAGTCCAACATTAAATTGCCTCCAATTCCTGGTTATCATTTCTGTGTTTCTGTTGCAAT
CATAGGCTGTAAGTAATCTGGTTAAATCTTTTTAGTTTCTTTCATTCCATGATTTAATGT
TTTAGCTTGTCTTTACCATCAGTTGGATTCAGAAAATCGAACTTTCTGTTGTTGATGTTC
CTGCTTAGTGATATAATACAGGCCACTCACATGCTAAGTACATGCTATACATAAAGCTGT
ACTCCCAGCAGGAAATATAACGTCAGCTTAAACTAAATATAGCTAGAAGGCAAAACTGTC
TTCCAGTACCAAGCCAGAAGTTTATTTTTATTTTAAAGATAATAAAATCCAACAGATCAA
AACAGAACAAAGCCAATCAAAAAAGAGCAGTAAAATTAGTACAGAACTTCGAAGCAGGTT
ACTAGGCAAACAACTGCCATAGTATATCTTGTTATCTTTACAGTAGTTATCCATTCTATC
AGGTATAGCAAAATCAAAACAACAGGATAAAACCAATCAGAACAAAGCAAAACACAACAA
TATTAGATTTGAAAGACAAGATAGAAGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNATGGGCTCTGTAGGCTTCCCAAAATAGGACAAATGTATCTCATCTGACATAGCAGG
GAGATGGCTAGATCAATGGGTGTGCACATTGCACCATGATAAGATGGTGTATAATTTGTA
TTTGTAGACCTTGTGGCTACTGGAGGACTAAGAAGGCTGAGTCTGATGAAGCAAGACTTT
GCTGATACATTCCTCCTAAAAAAAGGGGTTGGAGAGAGCAGCCCAAATTGGAGAACGTCA
CAGGGCTGACTGTACTACCCAACATTCTAGTCTAGTCTTACAGCACACTGCCTTTGCTAT
GGTTTTGGACTAGATGACTTTTGTTGAAGGGACGAGGATGTGCTTTCTCATCATTGGAGC
CTAGGCTTTTGCCTTATGAATGTCTTTTGCTGAGCAGAATAAGCTCTTTGCAGGTTAGGT
ACATATATTAATTTGGAGGGCTTTTATTTATTTTCCTTTAGGGCTTGAGGATCAAACTCA
AGGTCTTTTATGTTTTAGGCTTGCTAGGCAGGTGCTTTATCCCTGTGTCACACACTACTG
AAGTTTTAAATTGAACTAGTTTCTTATAGAAATGATAGAGGTATTTCTAGAAGTGATCAA
AAGTATCTGAAGGATTAATGTATTTTGTGTAATTTGCTATAAGATTTAATTTTATATTCT
GTTCATATCTGAGGTGTTCTTTTTTTTTTTTACAGATGCATTATGTTCAAGATAAATTAT
TTGTGGGTCTAGAACATGCTGTGCCCACATTTAATGTCAAAGAAAAGGTGGAAGGTCCAG
GCTGCTCCTACTTGCAGCACATTCAGATTGAAACAGGTGCCAAAGTCTTCCTGCGGGGCA
AGGGTTCAGGCTGCATTGAGCCAGCATCAGGCAGAGAAGCTTTTGAACCTATGTATATTT
ACATCAGGTATGGATGGGTGAGGTGGAGAATGTTTAAATCCTTGTTAGTGTGCTGTGTAG
ATTAGAATGATTCAAAAGTAACAGGAGTAAATAGGCTTAATAGAAATATGAGATTTATAT
AAACACTGGGAATAATCACTTTTAAGTAATTGATGCAAATGAATTAGGAAGCATAATTAT
ATCTTTAGTGTTTTAAGTCATTGTTTTATACAAGTTTGTAATCATAAAATGAGTTGTGAA
AAGGCTAGAATAGCTTTCAGTGAAACTTATATTACTGTGTTTTATAATCTTCAAATGTTT
TTATATCAAGAAGCATCATTACGGGGGCTGGAGATCTAGTTCAGCGGCATAAGCACCTGC
CTTGCAAGCAGGCAGTCGTGAGTTCGATCCCCGGTATCGATAAAAAGGAAAAAGACAAAA
AAAAGAAGAAGCATCATTACCCAAACAGGCTAATAAAATATTTGTGGTAATTATATGATT
TTAATTGCATCGTAATTTTTAGTTTTTTGTGAGAGAGTCTCATTCAGTGTAGGCTGACTT
TGAACTCACTGTATTGCTGAGGCTAGCTGAACTGCAGTGATCCTTCTGTCTCAGCCTTCT
AAATGCTGGGATTACAGGTGTGTGCCACCACATCCAGCTTTTTCTTTTCTTTTTTGCTTG
TTTTCTAATACCGTAATTGCACCCAGCTCATATAGCAGAGGACTGTAGGCTAAGTAGACA
TCTAATTATGTCTTAAAAGACTTACATGATGTTATTTATGTTCCTTTTATGATTTTCAGA
AGTCTAGATATAAAATATCATGAAGACTGGATGTGGTGGCATATACCTGTAATTCTAGTA
GACTGAGGCAGGAGAATTGAAAGGTTAAGTCCAGCTTGAGTGATTTAGCAACCTGGTGAC
ACCTTGTCTCAAAATAAAATATGAAAAGCTGGAGCTGGGGATTTAGCTTAGTGGCATNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGTGGTAATTATATGATTTTAAT
TGCATCGTAATTTTTAGTTTTTTGTGAGAGAGTCTCATTCAGTGTAGGCTGACTTTGAAC
TCACTGTATTGCTGAGGCTAGCTGAACTGCAGTGATCCTTCTGTCTCAGCCTTCTAAATG
CTGGGATTACAGGTGTGTGCCACCACATCCAGCTTTTTCTTTTCTTTTTTGCTTGTTTTC
TAATACCGTAATTGCACCCAGCTCATATAGCAGAGGACTGTAGGCTAAGTAGACATCTAA
TTATGTCTTAAAAGACTTACATGATGTTATTTATGTTCCTTTTATGATTTTCAGAAGTCT
AGATATAAAATATCATGAAGACTGGATGTGGTGGCATATACCTGTAATTCTAGTAGACTG
AGGCAGGAGAATTGAAAGGTTAAGTCCAGCTTGAGTGATTTAGCAACCTGGTGACACCTT
GTCTCAAAATAAAATATGAAAAGCTGGAGCTGGGGATTTAGCTTAGTGGCATAAGCGCCT
GCCTGGCAAGCGTGAGGTCATGAGTTTGATCCCTGGTACCGTAACAAAAAAAGCAAACAA
AAAATAAAATATGAAAAGCTTTGAGATGTAGGTTAACTCAAAGGGCCCTGGGTTCAATTT
CCAGTACCCCCCTGCCGAAAAAAAAAACAAAAAAACCTCCCTATGTGAAAGTTTATGTAG
AATTCTTTATCCTATAGTTTTCCGCACTTAAATTCTATATATATATATTATATGTTTTTT
TTTTTTTTTTCTTTCCAGTCATCCTAAATCAGAAGGTCTGGCTGCTGCCAAGAAGCTCTG
TGAGAATCTCTTGCAAACAGTGAGTTGTGAGTTTGTGTATATATGCATGTATTTATGCTG
GAGACTGAACTCTTGGGCTTCACACATGATAAGCATGCATTTATGACTAAAGTACATCCC
CACTTTTAGCTCCAATAAGTTGTATTTGTCTGGTATTTGTTTAGAAGAATTGCTGATTTT
GGAGTATGTTTTTTTATCTACCTGTGTTAGCTTCTTAGGGCATACCAAAATGTCATAAAT
TAGATGGACTACAAGAACAAATTACTCTGACACTTGAAGTCAGGAATCTAAAATCAGGGA
ACTGGCAAGATTGTTGGTTCTGGGCAGCATAACTGTCTGTCTAGCAAGCACAAGGTGCTG
AGTTTGATTCTGTGTACCACCAAAAAGAATTATTGGTTCACTTGGAGTATTTTTTCAGTG
CTGAGGATTGAACCCAGGGCCTCACATTTACTAAGCACATTTACTGCCACTGAGCTTCAC
TTCTAGATATGTTCGAAATCTTAGACAGTGCTTCCTTCCGATAGTTGTGTTGGCATTCTT
TGGTTGTCAGTCTAAAGAGTACAGTAGAACTATGACAGATTGTAACAAATCAGCAGCTGG
GGATGGTGGCACATGTATGTTATCCCAGTACTTAGGAAGCTAAGGCAGGAGGATCCATGG
GAGTTCAAGGCCAGCCTGCTTTATACAGTGAGTTGAAAGACAGCCTGAACTACTAAGAAT
CTGACTCAGAAAACCCAAAAAAATAATTAGCAAAAGTTTTTGGGATACTTGGCTTACTTG
GTTTTCCATTGTATTTTGTTTTTGGCTTTTTTGGAGGCAGGGTCTCTCTGTGTAATTCAC
AACTTGAACTACTATGTAACTTTGTCTTAAACTCACTGTGTAATGCAGGCTGGCCTCAGA
TTCACAATGATCCTCCTCCCTCAGCCTCTCAAGAATGCTAAAGTACTAAGTTGACAGGCT
TGAGCCACCACTCCCACCTTCCACTGTAGTCTGTAAACAACTGAGAGTTACAGCTAGGTG
TAGTGGTGCATCCTTCCACCCTACACTATGGGAGGCTGAAATAAGGTGACAAATTGAGCT
CAGCGTGGACAATTTAGTGACTTGGTGAGATACTGTCTCACCAAGATTGGAGTGTAAGTT
AGTGAGAAGGCTTTGAGTATCCTCAATACTGCACAGATACACACACACAGTTATGACTTC
TTTGGTAGCACTTAAAATCAGGTTCTGGATTGAATTACATTGAACCTTGTGTTCTTTGGT
ATTTAAAGGGACCTTTTTGGGAAGCTAATGTTTGCTTTTGAGCCTATTAACAGATTGCCA
ACACTTGTATCACATAATTTCTTTGATAATCTTTTTGTTTATTGATGCTTGAAGTTACAG
ATTTACTCAGATGCTTGAACTAAAGAATAGATTGGAAAAATTGGCAGCTCCTTGAGAACG
TGTCACTCATTAAATATGAACGAGTTTTCATTTCATTGCTAGTTGCACTAGCAATTTAGA
AGTTTCCTAATTACAAAAGTTTTGTGACTTTCTGAATGATTTTGAACCCCAGAATTAAGT
CTAGTTTGGGAATGTTAGGATTTTATGTGTTCCTCATTTCCAAAACTAGCTTGTATATAG
GTATACAGATTCACCTTATTTTTTTTTTTGTANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGTTACCCTGTTGTTCCC
CCTCCTCAGCAGCCAGTTCAACCTCCCTATGGAGTACCAAGCATAGTGCCACCAGCTGTT
TCATTGGCACCTGGAGTCTTGCCAGCTTTACCTACTGGAGTCCCACCTGTGCCAACACAA
TACCCGATAACACAAGTGCAACCTCCAGTTAGCACTGGACAGGTAAGATGCCAGAGTCTG
TAACATGCTGTCATTGAAATTAGGGAAAACTGGAGACAGGTGGTATTCCAGATTCAAATC
ATGTAATGTGAGCTATTTTTTTTTTCTACCATCTTGTTTTTCTCATGATGAGCCTTGCCT
GAGTGCTTGTTTGTATGTACATGTTTATGCATCATCTTAAAGTTTGCAGTTACTTTTAAA
ATTCTCAGCACCAAATAATTGTTTAAAATAGAGATGTTCAGTAGACTTTTTGTTAAGGGC
CGCATGGTAAATATTTCAGGATTTTTCGGTTAGAGTTGACCAGCTACTGTCTTCTGTTGT
AGTGCAAAAGCAACCATAGACAAAACAAGAGTGGCTGTACCCATTAGAAGTTTATTTACA
ATAATTAATTAATTAATGAGTGGCAGTTCAATCCCTGTTCATTGTACTGTGGTTATAGTT
TGTTAACCTGGGTGTGGTGGCACATGCCTGTAAGCCCAGCATTCAGGAGGTTGAGGCAGA
AGAATTGTTACAGGTTTGAGGCCTGCCTCAACTATATAGTGAAACTGTCTCAAAAAGACC
AGATACTAATGGTAATAATAGCTTTGCAGTGTTAACTTAATCCTCAGGGCAAAGGAGGCT
GGCCTGTAGCATACCTCCCAGTGGTTGGAACTGCATTGACAGTTTTGAAGTTAGAAATAT
ATAAACCAATACTCCTAATCTAAGACTTACAGACTTTTTAAACTTAAGGATTACAAATGC
TAGTAGTTTCTTTCACAATTTCTTAAATTATGTAAGACTGGAATTTTAGAAAAGAGCAGA
TGCCTAGTTCATCTGAGGGATTTATATACATATACTTGGAGACATTGTGGAGACTTGAGA
GGGTAGTAATGGATGGTGGCCCCTTCTATGTGTGTCTTTCATAGTGTACCCATGCTAGTG
CAAACTGGCCTTGAACCATTGCCCTGCTTCACTATATGTGCTGTGAACACTGAAGAGGAT
TGCAGAGTTTGTCACCAACAGCACATATGGACTGGGTGTGGTGGTGCACTCCTGAAATTC
CAGCACCTTAGGAGTTTGAGGGATGTGGATTGCAAGTTGAAGACTAGAGAATTGAGCAGT
TACCTTAAAAATTGAAGAAGACCTGGAGCTAATAACTCAGTGCAGAGGCTCTGAGTTCAA
TCCCTACCACAAAAAACAGGGTATTTGAACTAAATGCTATTTATAGTTCCTAGTCGGAAT
TATATATAGTAAAATCTATAGCTCTTAGTTTTGAGCTACAGCCATTTGTAATTGGGAAGC
AGTGTGGCAGAGTGGTTGTTAGAGTTAGATTGGTAGAGTTCATCATGCTTTCCCTTTTTT
GAGCTGTGCAATCTTGGGATAAGACCTATTTAGGGATTAAATTTCCTTAGATGGAAAATG
GGAGTAGTATTAAAAATCTCAAAGGATTACATTGATAAGTTGATCTAAGCAGTCAATAAA
TGCTTGAGATCCTGGGCTTGGTAGTATACACCAGTAATCTCAGCACTCAGAAGGGGGAGG
CCAAAGGATTGTGAGTTTGAGGCTAGTGTGAACTATATGTAGTGAGATAATGTCTCAAAA
AAAAGTATTTTATATGTACATATTTTTCTCTGATATATGCTGTATGTTGAATCACCCTGT
TGCCTTTTTGGAGCAACCTCCTAAAAATATTAGTCAGACTTGTTGATATGGTAACTCAGT
AACCGTGGAAGTAGTAAATGAAGTTGCCTTTGCCACAAGCATTAACTGTATATGATACAG
AAAGAGATCACATGGATGAAGGGGCTTTAAATAAGAGGCTTCTGAAGCTAAGTAAGTAGT
TGGAGTTCTTACTGTTTATTAATGTTCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNGTAGTAAATGAAGTTGCCTTTGCCACAAGCATTAACTGTATATGATACAGAAA
GAGATCACATGGATGAAGGGGCTTTAAATAAGAGGCTTCTGAACTAAGTAAGTAGTTGGA
GTTCTTACTGTTTATTAATGTTCATGTTTATTCTAAATACCGATGTGCACTACTGGTTTT
TCCTGGGAAGTCAAAGAACTGTCTGTAGATTGTCACTTTGCTGTTACACTTGGATGAAGG
TGGGAAGGTTAGGTGATGTTATTGCCAGATCATCCCTGAAGATGAAAGTTACATACATAC
ATACATACATACATACTGATCATTATAGTGCTTGCTGATCATTTTATTTATTCATTAGTT
GGACAACCTCACAGTTCTTTTCCTCTTTGGTTTGTTTTGGTCCCAGAGTCCAATGAGTGG
TCCTTTTATTCCTGCTGCTCCAATCAAAACTGCCTTACCTGCTGGCCCTCAGCCCCAGCC
CCAGCCTCCACTCCCATCACAACCCCAGTCACAGAAGAGACGATTCACAGAGGAGCTACC
AGATGAACGGGAATCAGGACTTCTTGGATATCAGGTTAAATAAAATACCTTGTCTTCCTT
TCCTTGTCTTATGCTCCTGCTATATTCTCCCTTTAAAGAAAGATACATCTATATCAACTG
TCCTAACACTAAGAGTTCTGCTTTCTAGAATCCATTTAGGTTAATATTCATGAGAAATTA
ATTTCTTGAAGTGGGTTTTGTCAGAGTTCAGTGTGATAAGAAAATACAAAGCTCCATTTA
GAGAGAGGTCTCATGTGTGACATCTCAAAGGACTTCTATAGATGTTCCTGTATTTGTATA
GTAGACTCATGAAAGGCTCAGATTTTCTTACATATGTTACTAGATGCTATCAGTCTACCA
GTGAATGTATGGTTCATGTGTAAACTTTGGCTTTCAACTTGCTGTTTCCTTTGACCCTTA
CTTTAAATGATTTTTTGAGAACCTCCTATCTGTTAGCTCCCTGCCCTACCAAAAAAACTT
GCCAAAAGAATAAAGTTTGGGATAATTAATACCTTTCTGGTGGATCCCTAGCCCTGGCAT
GTTTGAAGCCCTGGATTCAGTCTCTGATACCTCAAATACTTGGCGTGATTTATCAGGAGA
AGCACCTTTACATCATGCCCCTTGGAGCATTCTTAAATCACAGCATTTTTACAGTTATAA
CTAGGTTTTTAGGAAAACAGTGAAGTTATGGCCAGTCAGTTGAAAGCATACATAATGATT
ACAGCATGCTGAATCATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCCTGATTTTATCTTTA
TTTTTCTACTGATGTTCATTCAGGTGTTTACCTCTATAATCTGCCTAATGAGAATACTTG
CGAATACTTGTGTTTTGTTTGCTTTGCTTTGTTTGGTTTTAACGGGAACAGCATATAGCT
GTATGCAGGCTTACTTTCAACTATCATGTGTCTAGAAAAAGACAGTTCACTTATTCTATA
CATAAAACCCTAGGAAATGCTAATGATTGGTAGGTCATTTCAAAATTCTGTTGCCAGTGT
TGTCCGAATACCTGAAGGTGATCTGCTACAGACTTAATCAAGATTGATTTTTCTTTGTAT
TGGGAGCTGAGCCACATATCCTCTTGTAGCCTGAGGCTGTTACAGAATCCCACAACTCTA
AATCCAGTAGTGGTGCATGGGGTCAGTTTTGTTCTTGGCTATAGTCATAATAAAAATAAA
CAGAAGAAAATACATTTTTTTCTTTTCTGGACTTCTTTTCTTTTAACTCTAAAAGGTGAA
ATGTCAGCCCCCAGAGACTCATTTGCTAACTTTCCTTTTTGTCTTTTTCTTTTTTCTTTT
TTTTTTTTTTTTGTTTTTGTTTTTTGTGTGTGTGCGTTTCTTTTTTCTTTCTGTTTTCTT
ACATGGTTCTGGTGGATTCACATGTGCTGATGCTGGTGCTGTTTTTCGTGTGATCTTCAA
CATTTTTGGGTGACCATGACCCTGTGACTTCAAAATGGTGTCCAACTAACTACTTACAAT
TAACATCTTTTTTTTTTTAATTAACGAATTTATGGTATTATCTTTTTTTTTTCCTTCGTG
GGGAATGGGGTTGGGTTTTTTTTTTTTTTTTTTTTTTTCTGTTTTAGATTATCCTGCCAA
GAAGATGAAAACTACAGAGAAGGGATTTGGCTTAGTGGCTTATGCTGCAGATTCATCTGA
TGAAGAGGAGGAACATGGAGGTCATAAAAATGCAAGTAGTTTTCCGCAGGGCTGGAGTTT
GGGCTATCAGTACCCATCATCACAACCACGAGCTAAGCAACAGATGCCATTCTGGATGGC
CCCGTAGGAAGCAGTGGAAGAGTTTTGATGTTGGAGACTTCTTAGCAATAATGCATGCAT
TTGATTTAACAAGACTTGGGGCCTGTCCTGGGAGCCATCATGGACCTTGCAAAAGTTAAA
AATGTAGTGTCCCTTTTTTCTTAAAGGGATTCTATTCTTTTTAAAAAACGTTTCTGCGGT
GACATTAACTTCTGTTAAAAGTTTACTTAGGATCACAAATTTGTCTCAGAGCTTTTTAAT
GGTTGGTAAAATGTGCTTTGTCAGATGACATATCCCAGTAGGATGATTCCCATGTACATT
TGAAAGGGTCTAAATGAACAGTTAGAAACCCTCACCTAAAGAAGGTTATTTGTATTTTAC
TATGTGGGTGAGTTTGATACTCAACTGGTTACAAACAGGCCTTAACNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1003, 1006..1037, 1601..1817, 5512..5640, 5847..5926, 8228..8280, 8381..8544, 9935..10146, 11958..12018, 14281..14338, 14968..15221, 17566..17733, 18537..18649, 18750..18841, 19787..19986
1001..1003, 1006..1037, 1601..1817, 5512..5640, 5847..5926, 8228..8280, 8381..8544, 9935..10146, 11958..12018, 14281..14338, 14968..15221, 17566..17733, 18537..18649, 18750..18841, 19787..19983
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved