Cavia_porcellus Locus ENSCPOG00000004169
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000004169
Cavia_porcellus
ENSCPOG00000004169
GeneScaffold_1849
SNORD14
2595..2681
5871
CGCGGGCTCTCTTGGCCCCACCCTCCCTTTCCCCGGGCTGTTCCGGGGGGCGGGGGTGA
GCCTGAAAGTTCCAGAACGCTGCGGTGGTGCGTCATCGCGAGAGGGGGCGTGATGAGGGC
GGGAGGGGGCGAGGCCCAAGGAGTCGACAAGGGCTTTTCATTGGTGCTTGAGGAGGAAGC
TGGACGCTCATTGGTCTAGGGGGCCAAGACAGGCAGCCGGTGGGGCGGGACCCTTCTGGA
AGGTTCTGGGATGGGGTATAAGAGACTGGGAGCCGGGGACGGACCGGTCTCATTGAGCGC
GTTGGCAGCTTAGCGGCTTCTTGTGTTCTCTTCATTAGCAGAACCGGGCCTACAAGCAAG
GTGAGTTCGCCGTTTGAGCCTGGCAGTTAACTGGGAATGGGCCGGCCTGGGTCAGGCTGA
GGGAGGGCTCTGCCGCAGTGCGGGCTTCAGAGGTAGCGGGGCGGGCGGTGATTTGTGGCG
GCTCTATCCGTCTGTAGTATTTAACGGAATGGTTCCCGTTGTGGGGCTGCACCAAGAACT
GTCCTCGGAAAAGCCGACAGCTGGGGAGCGCGGTTGGGGGTGGGCGCTGAGGGAGCAGGG
CGGCGCCCCCCAGCCGGCTTCCTGGCCGCATGGCTACGGCGGAGGTGGCGCATCCGCTGT
CAGGCGCGCCCGCCAGCTGGCCCGGCGTGCGCTCCGGGTAGGGGCGCTTGTGAGGAAAGA
GTAAGGGTGTCCTGGCTGCAGGGTCTGGGTTTTTGTAGGGGACGAGGTTCTCGGCGGGCC
ACGTGGTCGGCTGCGTCGCGGCCTTTAGCTGGGTTGGGCTCTGAAATTGGCACAGCCGCG
TGGGCTGCAGCGCTGCTGCCGGTTCCATCCGCTGCGGTTCTCACAGACGAGTTCTGGGAC
CAGACGTGCTCCCGGCAGCGGTCATTGATTGCCCTTTTTCACGTAGACTTGTAACAACTA
GCTTTAATATTCGCCGGCATTTTTTTTTCTTCGTAGCAACCATGTCGAAGGGACCTGCTG
TTGGCATTGATCTTGGCACCACCTACTCCTGTGTGGGTGTCTTCCAGCATGGAAAGGTGG
AGATCATTGCCAATGATCAGGGAAATCGAACCACTCCAAGTTATGTCGCTTTCACTGACA
CCGAACGACTGATTGGGGATGCTGCAAAAAACCAAGTGGCCATGAACCCCACCAACACAG
TTTTCGGTAAGTACCTAATTTTAAATGACTGGAGAATGTAGATGCTGGGAAAAGAAAATG
TGAGGAAGTTGTGGAATTTATCCAACTTGAGAAAAGATTAAGGGGTTGGAGGGAAAGTGA
AAACGTTATTAGAAAGATCTGATCTGAGAGGGCGTAATACTGCAAAATAGTTGACTTTAT
AAAACCTCTTTACAGATGCCAAGCGTCTAATTGGGCGTAGATTTGATGATGCTGTTGTCC
AGTCTGATATGAAGCACTGGCCCTTCATGGTGGTGAATGATGCAGGCAGGCCCAAGGTTC
AGGTAGAATACAAAGGAGAGACAAAGAGCTTCTATCCAGAGGAGGTGTCATCTATGGTGC
TGACAAAGATGAAGGAAATCGCAGAAGCTTATCTTGGAAAGGTGAGATATATGTCAATAT
CACATCTGATATTTATAAAGCTATTTATTGCCAGATATTTTTAAATGCTTTGTGTAATCC
ATTTGGTACTGAATTTGTGTTTGAGTAGGTTTACTTAAAGAGGATTAATACGTACAATGT
TTCTCTTTTCAGACTGTTACCAATGCTGTGGTTACTGTGCCAGCTTATTTTAATGACTCT
CAGCGCCAGGCTACCAAAGATGCTGGGACCATTGCTGGTCTTAATGTACTTAGAATTATC
AATGAGCCAACAGCTGCTGCTATTGCCTATGGCTTAGACAAAAAGGTAAGCGCTTCTGTA
GAGAGAAATAGCACTAATTTATTTATTTTGTGTTACCAAGAATGTAATAGTTTATCTTTA
ATGGCAGGTTGGAGCTGAAAGAAACGTGCTGATTTTTGATTTAGGAGGTGGCACTTTTGA
TGTGTCAATCCTCACTATTGAAGATGGAATTTTTGAAGTAAAATCTACAGCTGGAGACAC
CCACTTAGGTGGAGAAGATTTTGACAACCGGATGGTCAACCATTTTATTGCTGAGTTCAA
GCGCAAGCATAAGAAGGACATCAGTGAGAACAAGAGAGCTGTCCGCCGTCTTCGCACTGC
ATGTGAACGAGCTAAGAGAACCCTCTCTTCCAGCACCCAAGCCAGTATTGAGATTGATTC
CCTCTATGAAGGGATCGACTTCTATACCTCCATTACTCGTGCTCGATTTGAAGAGCTGAA
TGCTGACCTGTTTCGTGGCACTCTAGACCCTGTGGAGAAGGCTCTGCGAGATGCTAAGCT
TGACAAGTCACAGATCCATGACATTGTCTTGGTGGGTGGTTCTACTCGTATTCCCAAGAT
CCAGAAACTTCTACAAGATTTCTTCAATGGAAAAGAATTGAATAAGAGTATCAACCCTGA
CGAGGCTGTTGCTTATGGTGCAGGTAACTTAAAACATTACTATCAATAAGAGTAACAGCC
ACTTAGAGACTAGTTTCACTGTGATGATGGATTCCAAAAACCATTCGTAGTTTCCACCAG
AAATTTTGTGTTGGCTAGTTCCTTCCTTGGATGTCTGAGTGAACAAAACGTTCAGTGAGG
TGGTGGGGGTTACATTGTGTATGCCTCAATGTTACTTTCTTGTTTCAGCTGTTCAGGCTG
CCATTCTGTCTGGAGACAAGTCTGAAAATGTTCAAGATTTGCTGCTTTTGGATGTCACTC
CTCTTTCTCTTGGTATTGAAACTGCTGGTGGAGTCATGACAGTCCTCATCAAGCGTAATA
CTACCATTCCTACCAAGCAGACACAGACCTTCACTACCTACTCCGACAACCAGCCTGGTG
TGCTCATTCAGGTATTTTTACACTCTGGGTTACAAAGGTTAACTTAAAGTATTGCCCGCT
GTGATGATGGATTCCAAAACCATTCGTAGTTTCCACCAGAAGTTTCATGTTGGCCAGTCC
TCCTGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
GCTTCCCTGGTGGAAGGAGCTCCTCCCTCTGGTGATGCTTCCTCAGGCCCCACCATTGAA
GAGGTTGATTAAGCCAACCCCAAATAGTGAGTTTAACATTCTTCACAACAGTAATAAAAT
TGAAGGACCTAAATTCGTAGCAAATTCTGTGGCAGTTATTAAAGTTTAACTGCTATAGTA
AAGTAACTGGGCATTCTCAATACTTGAACAACTGAACATGTACACAGGGAAAAGATTAAC
ATTGCACTTTATAAGCACTGTACTATAAGTGGAAATGCAATGTCTTCAATAAAACTATTT
AAAATTGGCACCATATAGTTGGCTTTACTCATTGACTGTCGGCCCATTCTGTATATGAAA
GAAATGAACCAAAGCTGTATTTCAAAAAGGAGTCCTTGCTGAAGGCCATGTGAACTTTGT
AGACAGGTGGCCCAGGAGCCCATTGTTCTGATATGACCTAAGTTTTTAAAAGGTAACATT
TGATTTGGTTAAGTCATTCACAATCTTGATTTAAGCCAGTTGTAAAGGTGTGACTTGGGC
TAGGGCTGTGGGCAATGAGTGACTCATTTGGCTGTATAGATGTTTTGCTGAAAGCAAGAA
CTACAAATATTACAGGTTCACTATATGGTGTACTAACCTGCCCATTGTGGTCAGGGTGTG
GTTCTGACACTGAGCTAGCCACAGTAGGTTCATAGGACAGTGCCACACAGATGAATATGA
CAAGACTGTAATAAGTGAGTCATGAGCAGCATACTTAGAAACCATTCCAAGTCTTGGCAC
ATAGAATATTAATAAAATGAGTATATTACTATCTAGATTTCATAGCATAGCACTTTCCAA
GGCCTAGAATGTGAAAGGTTCTAGAGACCAGTGTAGCAATCTGGGCTATACAAGTATTTT
ATGCCATTTAGGCAGTATTTAGCCGACTTTTAAACTCAACTTTTCCCATGCTGGCCTGGT
AGTTCCTCAGTTTGCTGGGTTAAAGAAGCCCTAGGTTACCTGTTTATATATGGCACTGGG
AGACAAAACATGTAAATACTTAGTCCCATACACATTTGAGCTTTTTAGCATA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1205, 1395..1600, 1752..1904, 1987..2542, 2748..2950, 3608..3806, 3907..4139, 4683..4799, 4802..4813, 4815..4871
1001..1205, 1395..1600, 1752..1904, 1987..2542, 2748..2950, 3608..3806, 3907..4139, 4683..4799, 4802..4813, 4815..4868
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved