Cavia_porcellus Locus KIAA0391
snOPY snoRNA Orthological Gene Database
Cavia_porcellus KIAA0391
Cavia_porcellus
KIAA0391
GeneScaffold_1048
SNORA2
95035..95172
109141
GAAGGCAGATATGAAAGATGAAAAATGACCCTCCTCAAGCAGGCGTCCCAACCTCACCA
AGCCCGAAATTAAATATGAGGATAAGTAAGCCTGCGTTTTAATTTCTTCATTGTGGGCCT
TTAGCGGGTGTGCACCACGTGATTCACAACTCCATTAGCGTTTCCGGGTTGAGAGACGAC
CCTTCTTTATCTGGAGGCTTTAACGGTCCCGCAAAGAAACAGGTGCTCCCGCGGCTTCCA
ATGCCTCTGCTTGTAAAATCTTGACACTCGCCTTTTTCCCTACCGCCGGGCCCTCCAAAT
CGCCGGCATTCAGCGCAGCCACCCTGCGCGCCGGGGCGGCGCGGTGCATTGTGGGCACTG
TAGTTTCCGTCGCGTTCCTGGGTTCCTTTAGCTCGTCTCGCGTGGTGAGTAAATGAAGTG
GCTTTTGTCTACTATCCGGATGTAGTGAAGTCGTTCCTCTAACTGGACCCCGCTTCTTTA
CACGAGTAGTTGGCTCAGGTGAACTTCCCACCTCCCCGACCCCTCTAACCGTTTCAGGCG
AGTTTGGGGGCCTGTGTAGAGTTGTTATGCTGGAAGAGTTCTCTAGACTTTGGCAGTCTT
CACTAGTGGTGGGGCTGGGATTGGGGGCTCATCGAAGTGGATTTGGTTTATTGATCTTCT
TGCTCTTACCTCCTGCCCCCCGTGCCGTTTTCAGAACAGTTGAGAGCTAGACTGAGTGTT
CCTTGTGTTTTTTCCTCAGGTCTTTGGGCTGGAATGTAACAGGCACCAGAAGATCTCTGC
TGTTTCCAGGTTTAGGGCTTTTGACCCACGTTGGACATCCCAGATCCTTGTTTAATGAAT
TGCTCTTGTTGCTAGTGGCCCCCAAAGCAGAACCTCACATGATCTGTCGGTAAAGAAGAA
AGTCTCCTTTTAAAAAATTCGCACTCCACTTCCAAACTCTAGTCTATTAATACGGCTGTA
GAAATAAAGGCCTCTCTGTCTTGTGTAGATCTCACTGCATAATGACCTGTTTGTCTGGTA
TTCGAAGTTTTCCTAAACTTTGGAAGAGCAAGCCATACTTTGGAGTTGGTCCAGGGCACT
CTTACCTCTCTCTCTTTCTCAGAGGCAGTGGCATTAAGAACCAACAGAGGTCTTTTTCTC
TTAAAACTATGTCTCTGCAAAATACCAAAGCAGTGAATATGCTGGCTGCCAAAGGTAGAT
TTGTCAATAAAGGAGACAAAGAGAGTATTAAGCGAATTTCTGCTCGTCCTTCTCATCTTT
TTGCTGCTGGAGAAGCTAAGAAGAGATCACAGATGAATCCTTCCGATCAACATCAAACCT
TGTTACCCAAGAAGAATAATATTGAACTCCCAACAAAACCACTGAGTTCAGAGGAGTGGG
ATAAACTTAAGGAAGATTACACAGGAAAGAATTTTGAGAACTGGATCAGTGCACAGATGT
CTCAAAACCACAGCTCTGTAGATGTGGCTAAATCTCTTTTGGCATGGGTAGCAGCAAAAA
ACAATGGTATTGTAGGCTATAATTTGTTGGTCATGTATTTGCATCTCTGTGTCTTCCACA
AGCAGACATCAGAAGTTATTGATGTCTATGAAATCATGAAAGCCAGATACAAGAGTTTAG
AACCTGGGGCTTACACTCTTCTCATCCGGGGATTAATCCATTCAGACAGATGGAGAGAGG
CCTTCCAGGTATTAGAAGAGGTAAAAAAAATCATGACACCTTCAGTAAGGAACTATGATG
ACTGTATCCAGGGAGCCCTCCTCCATCAAGATGTGAACATGGCATGGAATTTCTATGAGG
AATTGCTAAGTCAAAAATTTACTCCTACATTGGAAACTTTAAAATCTTTCTTTGATTTTG
GAAAAGGCATAAAGGATGATTACTATTCCAACAAACTACTAGACATGCTTTTGTATTTAA
GAAATAACCACCTGTATCCTGGGGAGTCACTTGCCCACAGTATAAAAACATGGTTTGAGA
GGTAATTGTCATTTTTATGTTGTGTATGTTTTTGGTAACTATGTCTATTTTTATAACTGT
ATCTAAAAACCTTTTTTGTTGTTGTTGCTGCAAATCATTTTACTTAAATTAAAGCTTTTC
CCTTTTCTAGGTAAGATTTGTTTCCTCCTTAAGACATTTTCTTGGGGCTGGGGATTTAGC
TCAGCGGCATAAGCGCCTGCCTTGTAAGCAGGCAGTCGTGAGTTCGATCCCTGGTACCGA
TAAAAATGAAAAAGAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAAGACATTTTCTTGA
GCCTGGCATGGTGGCTTGGCTCATGCTTGTAATCCCAGCACTCAGGAGGCTGAGTGAGGC
AGGAGGATCATTGTGAGTTAGAGACCACCCTAGGCTACAAAGTGAGCTCAAGGCCAGCCT
GAACTGCATAGAGAGACCCTGTTTCAAAAAGACAAAAAAAAAAAAAAAAAAAAAAAGACA
TTTTCTCTGCTTAAAACAAATAGTAGCAGAGGGCTAGGGCTGTAGTTCTAACAGTCTTGA
GGTCCTGGTTTAATCTTTAGCCCTTGTAAGGGGGAAAAAAAGAAGTAGAAAAGTGCATAG
CAGTAGAGACAATTTGTGCTAATCTGTACCCTTCACATAAAAAGGAAATTACATGGCCTG
GGACTGTAGCTCAGTGTCAAGCACCTGCCTGGCAAGCACAAGGTCCTGAGTTTGATTCCC
AGTACCAAAAAAAAAAAAAAAAAAGGAAATTACATAGCGTTTTTTTTTTCATGGTACAGG
GATTGAACTGGGCATCCCCACTAAGCTTGCAAGATAAGATTATTGTGGTACCTTGATTCA
CAACCATAATTATTTCCATGATTCAGGTAGTAGAATTCCTTCCAGTATTTGGTTGCAACC
AGAATCATGGAAACATTTAAGTGGTAACTGATGTACCACTTTATGGCATTTGACTGGACG
TGTCCTTGGGCCATTTTAGTATTTTCAGTTTCTCTGAAATCTAGTGACTGGGATAATGTG
CTCATACATCATGTTTACAGAGTTTTGAAGTAGTAATTATGCTTCATGAGGTTGACAAAC
TTACTGAGCATCAATAGAAGAAGAACCAGGATGTGAATATCTTTGAATGCCAAATAGCTT
TGACTTTATTCTGTTATCAAAAATGCTGGTTTTGTAGTGGATTTTAAAAAGATAGTTGCC
AAAACAGTGAGGAAACTGGAAACATGAATATCTGTTTGGATGCGGTTAAGAGGTGAGGAG
GTCCTGAATTAAGAACTGGGAAGGAGAATAAGCAATAGAATTAGAGGGAACTGACGGTAA
TATATGTAAGAAGAAAACATTCATTGATTGAGCAAATAAATTGACAAATGGTTTTTGAAA
TCCTCTAGTTAGGTGAGGCACAGTGATATAAAATGTGATATAAAATGTTGTGATGGCCTT
CTCAGCCTAATTAAGAATATCATTCCTGACAGTTAAGTAATAGTGGTCTGTAAGAGAAAA
GTATGAGAGCAGAGAAATTACTCTGAACAGGAGCAAGCTGGCAACTCCATGGAAAAGGTT
AGAGGTGAGTTTGGCCCAGAGGTCAGCAGCTTTCTGTGGCACTCCGATTAAGACTTGGAA
AAGATGTGGGAGAATCAAAGGAAGAAGGCACTCATTTAGAGTCCCATCTGCTGCTTTACC
TCATCACAGCCTGACAACTGCACTTGTCGTTAAATCATTCTGGGGACGAATCCTGAACCC
TTGAGAGCTCTTGCTTACAGAATTTTTACAGACGGTGAGTATTTTTGGTTCCGTAAGAAT
GTAACCTGATGATTTGGCTTTGTGATCCTTTTTTTTTCTTTTTTTGTAGTATTCCTGGAA
AACAATGGAAAGGACAATTTACTACAATCCAGAAAAGGTAAAACTCAGTAGTTATTTTTA
ACTTTGTTTTATTCAGATTCATTAGAGTTTTCTTTGTTGTTTTAAAAATATTTAAGAATA
CTCTGGGAACAGGATAATTAAGAGTTTATAATTAGAATACTTGATAAATAATGTTTTACA
TATGAAGACTTTGTAGCACTCAGAATGTTTTTATTGTTGATGTTGTGAGCCTGTATGAAG
ACAGAAATATTTACTTCTAGAGATTAAGAGCCCACTTTTGTTTTGGAAATTACTTTAAAA
ATCTCATCTGGGTGCTCAGCAATCTACCCTTTGGTTTCCTGACACACCAACTATGTGATG
TTTTCAGGAAAAAATCAGATAGTTGTGATGATCACAAAGGTTTTAATTTCTGTCTTAATA
CCTTTCAGAAGCCAAGTGTGGTGGCACATGCCTCTAATCCCAGCACTTGGGAGGCTTAGG
CAACAGGATTGTTGAGAGTTTGAGGCCAACCTGGGCTATAAAGTGAGTTCAAGGCCAGCC
TGAACTACATAGTGAAACCCTGTCTCAAAAAGAAAAATAACAACAAACCCTTCCAGTTTC
CTTGAGTCTTAGAATTATTCAGTTTAGAAAAAGTTATTTTCCATGACACTATTTAACTTT
TTAAAAAATCGTAATTACAGCGGCCAGTGTTCAGGCTGTGGAAACACCATAGAGTCTATT
CATCTGAGTCCAGAAGATTATGACTTTCTCAAGGAAAAAATCATGAGGGATGTAATAGAT
GGAGGAGATAGATACAGAAAGACAACACCTAAGGTGAGTGTAATAGGCTTTATTGCATTC
TTGGATTGCTGGTCTAAAGCAGGAGCCAGCAAGGTTCTACCACCGGGTTGGGATGGTCAC
ATATTGGTCACATATTCTTGAAGGGCAGCCAGAATAGCATTTCACTGTCCATTAACATAC
AAGTGTATCCTTGATCCCATGTTATTAGCTGCATTGGGCCGTTCCACTTTCCTGTTTGGG
TGTCCTTCTATAGGACTTGAGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTCTTCTAATTTCTTCTGTGTCTGTGTCT
CCTGGACTTCGGTTGGAGTAAGATATATGCATGCAAAATTAAACAATGCAAGCACTATCT
TCAGTTGCTATCATTTCAAGTATGTGACTTCTAATTTATTTTGTATGTATGTCTGCTGGA
TTGTTCTAGGTGGACTGGATGTCTGAGATTGCACCTTGCAGGATCCTTTGTCTTGACATT
TTCCTGTGTTCCTCCAGATCTGCTGGCTGCTAAGTCCCAAGTGCTTCTTGCACTGAATGC
CTGTCTTGCAGTGCAGGGATTGGGCTAGGCACCTGGGTTCCTCCACTCCGAGGTTCCCAA
GGTGGCAAAGAAGTGGGCAGGGGGACAGCTAACTGATAAGCTCCCCCCACCAAGGCAGCA
AGGCATTGGGCAAGGCTTCTCCTCTGGGCCCTTAGGGTGGTCTCATAGGCAGAAGGGTTT
ATGCCTGACCCCCATGGCAATGGGGCCTCAGGGCATGACTGCATCTTCATTCTTTTTCTT
TTTCTCTTATCTAATATTCAATAAAATCCTCTAGAGATTCAGTCTTTTTAAAATAAGATT
TAGTTAAAAGCAGTGCAAGTGCCTCTGGGTGCCTAGCCGAGGTCAGTGTAGCGAGGGAAT
AGTGAGTGGTATGTGGCTGTATGTGGTGTTTGATTGCTACTGATTCAGAGTTTGAGTGGT
GATTTTTAGACATAGTATTTCAGGGGACTAATCCAGGGTGATGTCAGACACAGGGAGGTT
TATATAGATTAGAGTGCTAGAAGCAGAATAAAGTTCCTTTTGTGAGGTTTTGAGTAAAGG
GAGAGAGTATGCAAAGGAAAACTTTGACTTTTTTCATTCATAGACTCAAGGCAAGAGACA
GTCTTATCTTTTTTATATCCTGTGATTCCTTCTTTTCAATTCAAGTTAGTACTGTTATTG
TTATAACTCCATTGTGCCATTTGTCTTGGGAACCAATCTCTTTTTAAAAATAAATTCATA
TTTATTGGAAAAGTATTGTGAGTTGTAAATAACCATCTCATAAGTAAATTTTTGGAAAAC
GTGATGTGTTAAATGTGAGGCACTATTCAGAGTTCCCACACTGTTAGTTGTCTTTTCCTT
AAAATGTCCTGCCTTAGAATTCTGATTTAGGTTGTGGACTAGATGTATTGATTCTAGTGT
TTTTTCATTCGTACTTCCTAGAGAATAGAATAGTGTTAATAAGGTAGTAAATTAGAAACA
ATGCTCATCGTGAACAATGAAGCTTACTTCCTGGGAGAAAACTGCCAGTGTGAAGGAAGA
GTCTTGGAGAGGCTGAGAATGCACACAAAGGTCTTCTCTGATCTCCATGGTACAAACACT
GATGCTTATACCCAGGCCTCTCCTTGAGTCTTCCCTGTCTCTAAATACAGCTTTCTTCTT
CTGGTTATTCAGGTCAGAAAGGCCAGCCTTGTTATTGACTGTCCTCTTTCTTTCACCTCC
AATCTGCCAGACGATCTTGCTGGTTTTCTTCAGATTTCTCTGACTTTTGTGCCACCTGCA
TTTCTACCACTTTTTTTTTAACCTAAGCTGTATCATTTCTAGACCAGACAACTGCAATAA
CCTGTCTAGTTCCCTGTCTTCCAATACCTGAGTGTGTTTTTAATACATCAATAGGTGTAA
TTTTTTTATATCTGTATCAGATGACATCACTCTAATGCTTACGATTCTCTAGTAGCTTTC
TGTCTTTTCTAGATGAAAGTTAGATTGAGGCTTTGGCCTCTGTCAGTCTTCTAGATCTTA
CTGCATTCCAGCCATACTAGAATCTTTGGTGTGCTAACTATCCCATATATGCTCTTGCCT
CAGAAACAGGAAATAGAAGTATTAAGAATGATGGGGTTGCTCACCTGTAATTCCAAACAT
TAGGGAAGCTGAAGCAGGAGGATCACAAATTCAAGGCCAGCCTGGGCTATATAATTAGAT
CAAGGCCAGCCTAAATTTCATAGTGAGACCCTATCTCCAAAGATAGATTTAAATGAGCCA
GGGCATAATAGTATACACTTGCGTGCTCGCTTCGGCAGCACATATACTAAAATTGGAACG
ATACAGAGAAGATTAGCATGGCCCCTGCGCAAGGATGACACGCAAATTCGTGAAGCGTTC
CATATTTTTGACAAAACAGGAGGCATCACAATCCCTGACTTGAAGTTATGCTACAAAGCA
ACAGTAGTAAAACCAACATGGTATTGGAATCAAAACAGAACCGAAGATCAATGGAATAGA
TTAGAAGATACAACCACAACTGCAAACACACTCAAGCACCTTATCTTTGATAAAGGAGCC
AAGCAGGTTCACTGGAAGAACGACAGTCTCTTTAATAAATGGTGCTGGAAAAACTGGCTC
TCCATTTGCCGAAAACTAAAGCTAGACCCATGTCTATCACCATTTACTAAATTAAAATCT
AAATGGGTCAAAGATCTGAATATTAAAACAGAAACACTAAATCTATTGGAAGACAAATTA
GGTAGAAACCTTGGAGACATAGGAGTAAGTAAAGAATTCATGAACAGGACTCAAACCGCA
CAGGAAATACTTCCTAGAATCAATAACTGGGACCACTTCTTATTAAAAAGTTTCTGCATG
TCGGGGCTGGGGATTTAGCTCAGCGGCATAAGCGCCTGCCTTACAAGCTGGCAGTCGTGA
GTTCGATCCCTGGTACCAATAAAAAAAAAAAGTTTCTGCATGTCAAAAGAAATCTCCAGC
ATAGTGAAAAGAAAACCCACAAACTGGGAAAAGATTTTAGTGAACTCTCTCTCAGACAGG
GACTTCTTGTCTAAAACATATAAAGAATTAAAAAAACTCAGATCCCAAATTCAAAGATCA
ATTCAAAAATGGCATCTGAGATGAATACGCAATTCTCAGATGAGAAATGCAATGGCAAAT
AANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAATATTTGAAGCTAGAGT
ATATGAAGTTTTATCCAAATATCTTCAAGGAAAAAGACAGACACTATGATGGTAACTACT
ATTAAGTCGGGTTGTTTGGTGGTGAAGCACTAGGTTGCTGAAACAGTCATGCTTTGACCT
CTATTGTTATATTGTTATCTCCTGTTTTAACTCAATCTCTCCCTTATTCTTTAAAAAAAT
TAGTTATTTCTTATGTTTGTTTTAATTAAGGGGAAAAATTTAAAAAATTAGGATATATAA
TAGTAACTCTTTTTGATTTCCTATTAACTTGTTTTGAAGTCCTGTAATACTCCTATGATC
TTGTTTTGACTGATTAGACTCTGTTCCATTCTGTATGATAGTATCAAGTTTGAGGATATA
GGCAACTACTTTGAAGGCAATAAGATTCACTAAGATGCCCATTCTGGTTTGACTATTGTC
TTCTTTGGAAGTCCTGTAATGTTTACAATGCCTAAGTTTTATTGGTCTTGTTCTCTACTG
TTTTGTCCAACTTTATAATATCTAATGAGATAGACAATTCTTTTTAAGGAAACAAGAGAC
AATGTTGATAATCATTGTTGATAACCTTGTACTCTGTTCTACACCATGTGCTATGTCTAT
CCTTGGTTTTGACTGACAGCTTTGTTGTGCCATATTTGACTGTATTCTCTCCCCCCCAAA
AAAGTAATAAGAACTAAGGAGTAATAAAATCTAAAATGTGTAAATTTTGTTGTAAAAAAG
AGAGGGAAAAAAAAAAGAGCTCTAACGGATATAACAGCAAGTATGTTTAGGGGTATTAAA
TAGCTGACTATATCAATGTTTTTGGATCATTGAACACAGCTGTTTGCAGTCTCCCTGTTT
GAATGTCCACTTTGTATTCTTTGATACTGTGATTTGAGCAACTATTTTCAAGATGATAAT
ATGTAATCTATTAACAGGTGATTTCTTACTGTTATGTTTTTTTTTGTTTGTTTGTAGTTC
TGTATTACGTGTACCCTTATACCACTTTGTTTTGTTTTGTGTTTTTCTCTTTTTCCTCTT
AAATAAAATTTAAAAAAAAAATAGTATACACTTGTAATCCCAGCTGTTCAGGAGACTGAG
TCAGGAGGATTGCAGGTTCCAGGCCAACCTGGGTAATTTAGAGAGATCATGTCTCCAAAA
TGAGTTAAGACCCAGGTTTGATGGCGCATGCCTATAATTCCAGTGCTCTGAAATGTTGAG
GCAGGAGAAATGCAAGTTTGAGCCCAGTCAAGGTAATTTAGGGATTTGGTGAAGCACTAT
CTCAAATTAAATAAAAAAAGACAAAAAGACCTGGGAATATAGCCATTGTGAAGGCACTGA
GTTCAACCCTAGTTGATAAGTAAATAAAACTATGTGTTTAATTTAAGGAGTGGGCTCAGT
TATCTGCAACTTTTATATATATGTACCACAGAACACATCATTACTCCAACTGCAAAGTAG
AAGAAAGTGTTATTTGTATTCTGGGAGAAGCTTAGAGATTCTAGTTCAGATACTAATTCC
GCTTATTAATAAGTTTTAACTGTACCTTAAAAAAAAAGTAATACCTGGGCACAGGGATTT
AGCTCCATGGTGTAAGTGTCTGCCTGGCAAGCACGAAGTTGTGAATTTGATCGCTGGTAC
CAAGAAAGAAAAAAAAAAGTAATGTTTATGTAAAGCTTATTGTAAGCTAGTCATTATTAT
TAATATGTTGTAAATATTAATTAACTTTAAAACATGGGGAAGTTACTTTGCTACTTTCAT
TCTGTTTCCCAATATTTATTATTTTATTTTTTAATTTTAATTTTTTTATTTTTTGAGTCT
GGCTTTGTAGTTCAAACTGGCTTTGAATTAACTGTGTAGCCCAGACTGGCCATGCACTTG
CAGCGATCTCCTGTTTTAGCTTCCCAAGTCTTCAGATTAGAGGTGTGCACTACCACAGTG
GCCTGTTCCTGATCTTTAAATGGAGACAGGGACATTTGGACCAAACTTTGTTCAGAGCCC
CTTCCAGCTCTGTGATGTTAAGACTTGGTAATTGTTGCTAGGCAGCCTAGTTATCTGTTA
GCAGAAGTACCATAATGTCGACTTTTCCTGATGGAAGCAAAGATTAGGGTAGAACCCTAA
TAACTGTACAGAATAGATTAGAACTTGTTTTGACAGTCTCCCTTTTTTCCCTTCATATCT
GAAGGTAGAAATGAAAAGTGTTTATACACTGAGTAGAGTGTATGATACCTCCCTATTAAC
CAGCATTACTTTTCAGCTATCAAGTGAAATTAGGTCAGTGGTTCTTCTCCAAGATTTTTT
TTTTTTCTTCTCCAAGATTTGAAGAAACAGGAAACAGAAGAATTTATCATTTCGTACAGA
AAATATCTAACTTGAATCTGATTAGACAAGTAGAACTGTCTACCAATTGACAAAAATTAA
AGTGGTGAGAGAAATATGTTCAATTACCAGTCAAGAATACAGTCACCAAATCTAATCTAG
GAAAATGCAAGACAAACAATGCAATCTCTTGCAATAAAGCGTGAACCAATAGATAGCAGT
TTGACGTATAGCTGCTATTCACATCATTCCTGATATGAGCAATCAAAGAAATCTAAAATC
ATTTATTTGGAGATATTAAGAAATTATTCTTGATTTTATGTACGGGCAGTAACTCTAGTG
AGTTAAGTGTTTCATAGCTAAACATTGAAGTGTTCACAATGGAACAATGTGATGCCTGAG
ATAAACTTTGAAAATAGCTGGAAATTAGGGATTGGAATAAATGTGAATCAAATTAGCATG
AGTTGATAAAGTTTATGGAGTCATAAGGATATATTATATCATACTGTCTACTTTTGCATA
TGTTTGAGATTTCTGTTGTAACCCTGAAATCTTCAAAAGCTGTCATTAAATACACGTGCT
TTCAAGATAAAAATCATGAAGAAAGAGATTGTAAAATAGTGCATTTTAGTGATTTTCATG
CAAAGGTAAAATCTTTCTAAAGTATATTTCCTCACTTAAACATATCATAAAAGATGAAAA
CACTTTAGAAATGTCACTATAGAAAGTCCCCTTCTTTAAGCAAATAATATTTTTCAGATA
ATGAAAATGTTGCACACAGTAATATGTTCCTTTTTCCATTTTTGAAATGCACAAAAAAGA
TGAAATTTCTTAATTGAGTAGAATAGCTAATTTAGATTCACATCTAACTCTGGAGAGGTG
TCCTAATGTACTACATTGCATTTGCTCTGGAGTTAAAAAACAAAACAAAACCCTGTACAT
GTTAATCCACTGTGTAGTGAAAACTTCAGCTTACTTAGCAACCTGGAATGCTCCAGTGTG
CAGCCACTCAGCTTTTAGTGAAGGTGGCAACTGAGTTAATTATGGTGTGGTTAGGCCTTC
CGTGAAGGGAAATTTGAACCTGAGAGCTTCTGTCCTCAACAGTGCTAATTGGGATTGTGG
AGTGAGGGGATTTCCACTCTTTGTTAATAAAATCTCCAGGCACATTTCCTCTGTGTTTCT
GCAGATTTTCCTCAGCTGTGAAGCAGCTGCAGGGAAGTAAAATGTGATTTCCTGCACTCT
GGAGTGCTGGCTTTTCTTTTGGAGATTTATAATTGGAAGAGTGGAATGTATATGGCTTGA
GCTACCTACACAGCTGATTTAAACACTAGATTTGTTTTGTTTTTCTGTAATTAGTTGACT
GCATTTGTGCTGGAAGTAGATTGCTTAGGTAGTTTGAATTAGCAAAGTAACTCAGGTTAT
CTCAAAGGCAAACATCCTTCTTAAAGGACCAGTGCTTTAATTAACAGTGTGTTTCTCTGC
ATGTTGACTGAAGAAAACAAAGAATGGCATATTCTGTCATAGTAATGACAATACCATAAG
TCCTTTGTAGATTCTTAGTACATAAATGTGTATCTTTTTTTATTGAACTGTTTGTTTAAT
ACGTAGAATTCTCCAAAATGACATAAGTGGCCAAAAAATATTTTTAAGAGCATATGAACA
CAGTGTCATCGGAAAGTGAAAAAAAAATTATTGGTATAGTAGATGTCCTGTACCATTATA
CTTTAAGTGAAAGTCTTACCATAGATTAACAACTTTTCTGCAGCCTAATAACTATGCTTT
ATGCCCCCTACACCATATGTTTAAAGACCTATACTACATCCAAACATGGACCAGCCCTTT
GGACATAGGTTTTTTTTGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTTTTCATGG
GTACCAGGGATTGAACTCATGACCACACACTTGCAAGGCAGGCGCTTACGCCACTGAGCT
AAATCCCCAGCCCCTTTGTTTTTGTTTTTGAAACAGGGTCTTCCTCTGTAGCCCAGGCTG
GCCTTGAACATGCTACTTTGCAAGTTTTTGATCCTTCTGCCTCAGCCTTCCCAGTGCTGG
GATTACAGGCCTGTACTACTTTGGCCAATTGGAGAAAGAATTTTTTTTTTCTTTTTGAGA
CAGGGTCTCGCTGCACAGTTCAGGCTGGCCTTGAGCTCATTTTGTAGCCCACGCTGGTTT
CGAATTTGCAACGATCTGCTTGTCTCAGCCTCCCAAGTGCTGGGATTACAGGAGTACCTA
GTGACAGAGAAATTTGTGATATGATGTCTTCTCAAGTCACTCACCATTGTGTTTATGGTA
TGTGGCTTCTACACCTGCAGTCAGAGAAACTTCATGTGGCTTCAGAAAACAAGAAGTGAA
GCTGGGTGTGGGGCACATGTTTATGATCCCAGCTACCTAGGAGGCTGAGGCAGGAGAATN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNTTCTGCCTCAAGCACATTCCCTGTCTCAAACCTTCTTTTGACTTCTGTAG
TCTGCATTAATCTTTTCTTCCTTTGTGTTTGTAACAGTTACTAACATGGCACGTACTACT
GTGTTAATCCTATACTTGTAGTGTTCTTACAGTATTTAGCTTTCCACATTGATATCTGTT
TAAACTGCATTAGAACTTCTTTGATGAATAGGACACTCTTTTTTGAGTTTTCCACAATAC
TTGGCATCCAGTAAGTATGCGATAAGTATTGTTACTGAACTTATAAATTGATAGGATTAT
ATCCAAAAGATGAGAAGTATAAAACAAAAGAGGCCTTTATTCTGAGAACACAGAGAGAGA
ACACCACCACCACCCCACCCCCACCCCCACCGCTGGAGTCCAGCTTTCTCTCTGGCAGAC
ATGTGGCGTGGGGGGGGGGGCGCGCAGTATCTAAGTATCCCAAGCTTAGGGTAGTGCCCT
AAGGCCATTAGAGATGCACAGGTATCTCATTGGCACACATTTGGCGCCAGGAGCATATTT
ACTTTACAGATGAGAAAACTGAGGCTCAGGAAAGTTCATTAACTTACCAGAAACTACAGT
TTAAGTGACAAAGCCAAGATTCAAACCTAGATCCTTGGACTCACTAGTAGTAACACATGC
TGTTTACATGATACCAATAATTCTACCTCCTCATTAGACGAATACTTTTGAGAGCAGAAA
AATACTTAGCATTGGTTTTGTGTTCCTTGTTTAATTATGGCAATAGAAATAAAGGTATGT
AAATGTGAATTAGCAGTACTTGCTAGCAGGAATATGAAATAGATTTAAAGTGTGCAAAGT
TCATAGGCAAAGAAAATTTCCCTTAATCTCATTGATTACTGGCTGAATGACTCATTTTCT
AGTTGTGTGTTGCTCTTGAATTATTCAGATATTTGGATAAGTTACACATGGGGGAAAACC
ACTGATGAGATGTGTAAGACACGTCATTGGAGCTAATGAGTGATTCCAGGATGTCCCCCA
GATTTCTGCCGAGTATTCTTACCTCTTTCATTCATTGTTTGCATTTCTCACCTTTGGTTT
TTCCTTACAAGTAAAATCACATATCATTTCCTTTCTTCCCCCTTCACTGACAACTTTTAT
AGTCTATACAAAAATTCTAGGAATTTAACATCTTTCCTTCTCCATTCTCTGCACCTAGCT
CAGTTTTTTCCCTATTAAGAGGACAAAAGAGAATCTATTGTCCTTTCTTTCAAAGTTAGC
TTTAGATCATAGTAACATTTTTTTCATTTCTATGAGAATGTTTAAAACTTTGCTGACTTT
TGCAGACACAACTGATAAATTGTTTTTGTTTTCTAAATACTCATTTAACTCAGTGAAGTC
ATAAATTAATTGGGAATTGGAAATAGAGATAATCAGCAGGTTTTTTGAGATACTCTTGTG
TTTTTGTGTAATTATTAACTTGGTCCTTATATTTCAGTGGTCTCACAAGATTGTTGTAAA
CATAGATCAGAAAACACAGAACACTGTAAAACACAAAATCATCTTCAGTGACAGCCACTA
GAAGACACTTGATTTATGAGCCATTTATGTATGTGTTCTCTAGGGGAGTAGCTCTAGTGN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCACCTGAAGGGCAAACTGG
GAGAACCTCAGACTCAGTAATATTGGGCAAGGCTTTAATTAAGGTTGTCCTGGAAACCTT
GTCCTCAGCCCCAAAAGGTGGAGGAGGGGCAGCTTTGGCTCAGTGATAGTGGATGCCTTA
AGGGTCCACTGAGGGGTGTCTGGTTTTCCTGTGTCTCACATTTACATGTGAATACGAGTA
AGGATTATTTCTTTGGTGCAAAGACAGACTGAACACAAGGCAGTTTTGACAATTTTTCCT
CTTTCTTATGCTACAATTCTAGTTGTAAGATAGCATCATAATCAGTATTTCCCTTTGCAT
TAACAGTTATGTTTAAAGAAGGAAGCATTGCTTAGTACTAAATAATTGCCTTCTGGTTCT
TAGAAAGAGAGCTCTAAATGTCCTTTTTGGAAGCTGCTTCTCTGTTACACAGCTCTAGAG
CTGTCCTGCTACAGCCAACTCATTCCCGCCAGCACAGGTCTCATGCTGCTGCTGCCTCTG
TGGAGACAACCACCAAGCCATTTTGGGTGTCTTGCATCAGTCTAAAAAATCTGAAAGTGT
GGGCCAATTTTGGTTATTAGGATCGTTTTTTCGTGACCATTGGGAAACAACAAGGTCCAA
GAAAATCTTGCATAGCCACCTTCTTAACAGCCTGTTGGTATTTAGACATAAAAGGTTCAG
AATATTTTATCTTTAAATAGTCTGGAGGTACAGGCCACAGAGTTTAAAAGCCTGCTCTGA
ATGTCCCACAGAAGCTGGTATGTAGTTGGAGGCTTTTTTCTTTTCTTTTTCTTTTTTGGC
ACTGGAAATCAAACTCAGGACCTTTTGCTTATTAGGCAGGCACTTATGCTACTTAGCTGA
CTTTTCTTTCTTTTTTTTTAATTTTTAATTTTTTTCTTCCCTGTCCTGTTCTAAAGCAGA
AACTTTTAGGATACTAGTACTTAATGAATGTGAAACAGAGTTTATCAAGCTCCAAGCTGA
AAAACAATTTATGCTCTGCTATGAGTGCTCTTTAAATTTTTTCCAAAAAAAAAAAAAATT
TTTTTTCCCTACCTTGTCCCAATTTTTAGTACTTAAAGTTCATGCCTGTGAGAACTAAGG
ATGTATTTAATTATTTCCTGAAGTACTTTGATAATACTGCTAGCTGGCACTGTGTACTTT
ACCTTCTTTAAAAGAGATTTCATAAAAAGAGATTTTAAAGAAGATATTTCTTTTAAAAGA
AAGATATTACCCTTTGGCTCAGTGATAGTGGATGCCCTTTGTTTTAATTCCAGTGAAATT
ATTATTTGTGTCGAAAGCATTTATTTTAGCTCCACACCAGATCTCTGAAATAGTCACACA
AGATATCAGTGCTGTTAAAACACTCCTAGTAAGTCCACCAGGAGGCAAGAATGCCATGGA
TTCAGGCCACATTGGGCACCAGTTATCAGAGACCCTTTCCATGGTGCCAATTATCAGGGA
CCCTTGCAGTGAGTTCCCAATCTGCCTCATGGACTTACAGCACGTGGTGAGAAAGAAAAA
GAGCAAGAGACAAGAATTGTAAGAATTGGGCTGGGGATTTAGCTCAGTGGTGAAAGCACC
TGCCTGGTAAGTGCAAGGTTGTGAGTTTGATCCCTGGTACAAAAAAAAAAAAAGAATTGT
AAGGACACAGGGCTCTGGGTGCTCAGTGTTCTCTGTAAACCATGACCAAGATTTTCCTGC
TAGCCTCTATTTTATTAGCCAGTGCGGTGGGAGGGGTACAGTGCTTTCCTTGGAACATTG
TAGAAGTAGTAGTTGAATAGGCAAGTTTAAGACCATAAAACAAGGAAGTTAAGATTCATC
CCCACATGTGGGTACTAGTTTTCCCTGTATTGTCCTCAGCAGACTTCATCCTGTTCTGTG
AACTTTACAGCCTCATTGACCATCAAGATCTCAGTAGTGACCTAGAAAAGTGGGATTTTT
GCATTCCAAAACCAGCCCATAAGGCAGGGCAAGGAGGGCCTCAGGCAGTTACTAGATCAA
TTTATAATTCATGACCCCCAACACTTTATGGTGGATACTGAGTTTAAGTTGCAGAGGTAA
GATGCTTTTCTGTTGGTCACCCTTAGGTATAGGCTGCCCACCATCTCACTGAGTGTTGTT
TTTCAGTTACCAAACAAAAATGAGAAGTAAAATTGTTTTACTTTCTTGCCTGGCTTTATA
CTTTTCAGAAAATGTCCTGAGGTCATATAAAATACCTTTACTCCTCCAAATAAAGTCAAA
ATATTGTCCATAAAGCTAGAATACCTTGTCCAGGCTGGGATTGAACTTGCTCAGTTCCTG
CCTCAGCATCCCAGAATGGTAAGATTTCAGGCTTATGCCAGCACACCCTATGTAAAGAAT
TTTCTTATTTTTAGAAGTTATGTATTGAAATAGTTAAGCTAATGTGTTGTCATTTGCACA
ACTTACTTTTTTTGTGGTCCAAGAAATCTAACTATTGATAAAATGACAGCATTTGTTACA
TAATGCTAAATACATTCACAATATCTCATTTAATGCTTACAACTACTTCATAAGATACTA
TTGCTATTTTATATAGATAAAGGTTGAGACTTGAGAGATTAAATTTTTCCAAATATGCCT
CCTAATAAAATCTAGATCCCTCTGACCCCAAAATCTTTTCATTGCACCCAGCTGCTTTTC
TCACAATGGCTGTGGTAGTCCTCTTTCATATATATATGAATATATGTGTATGTGTTAGCC
ACCTGGGTTGTCACAGCTCCTAATGCCTTGGGAATTTATTTCAGCTAAAATCTGGTTTAA
ATAAGTTCCCTTTTCTCAAAACAATCATCATGGAGTGCTTATGTGTATCTTTTGAAATAA
ATGTAAATGCATGGGTTGTGGTAAATCATGCTACTTGCTCATATAATGTTTCTATTTGTG
AGCTAATACATATTCTTCTCATCCTTTCATCCTGTTTTATTTGGGACCACCAAAATTATC
AATTTAGAGCAAACNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCACTGCAAGTTTGAACCTAGC
CTGAGCTGTGAGTTGAAGGTCAGCCTGAACTGCATAGTGAAACCTTATCTCTAAAAGACA
CACACAAAAAATTCTGTTTTGATATTTTTGCATATGTGTACATACGTTGTTGTTCATTCC
AAGTGAGTAAACATGTAGATTGCTTTCTGTATCCCTCAAGGAAAGGTATGGAGTTGCACA
ACCAGCTACTATTTGCTGAAGTACAAATTTACAGTAGAAAAGGGATGGGTCTGAGTTAAA
ATGCAAATTCTAGTATATATGATTCATGTTGGTATTCTTTGGCTGCTGTCAGCTGGATCA
TCCATTCTTTGGATCCGGCTTTACATAGCCACTGTTAACCATGTGTGTATCTCTTTATGG
GATCTTGGACCTGCCTTCTTGATATTGAAGATAAAACCCAAGGGTGCTCTACCTCTAAGT
TATAGCCCAAGTAATTTATGTTTTGAGACAAGGATTCACTAAATTGTCCAGAACAGGATC
AAATTTGTCATCCTCCTGCCTCAGATTTTTTCTTTTTTTGTTTTTTTTGAGACAGGGTCT
CACTATGTAATTCAGACTAACCTTGAACTCACTATGTAGCTGGCTCAAACTTCTAGCAAT
CCTCCTGCCTCACTGCTGAAATTAAAGCGTGGTATGCCACTATGCTTAGGTGAGCACTTT
TTCTTAAAAAGGGCTTTTTCTCTAGTCCTTGGATTTAGGGCCCATCCTAATCACTATGAC
CTCATTTTACCTAATTACATCTAAAAATAAGGTTATTTCACTTAGTCCTGGTGGACATGC
GATTTGAGGGAACGCTTGCTGCTACAGCTGTTCTTTTCCCTGTCTAGGACTGAATGTTGA
GTGCTTCGGTAGCTATGTGTGTGATATTTTAATTTACATTGTCCTAATGACAACTGTTGT
GCATCCTTTTATGTGCTTGATTACCACCCACATATTTTCTTGGTGTAAGTGTTTTTAGAT
ATTTTGCCAATCCTTTAAAAAAGTGAGTTGTGTTCTTACTGAGTTTTAAGAGCTATGTAA
GGGCTAGGGGTGCAGCTGAGGGGTAGAGAACCTGTTTAGCTTTGCATAAGGCCCTCTCTG
TGATTCCTAGCACTACAACGAATGAACAATTGATTATATATAATTTTAGATCTGTGTTCC
CTAGCACTACAATGAACAAACAATTGATTATATATAATTTTAGATCCAGGTCTTATGTCG
AATAAACATTTTGCAAATATTTTCTCTCAGTCTACGGTTACCTTTCATTTTCACACGTTA
TAGATTCTGCTTTCATTGCTTGGGCTGAGAGATCCACATTTTGGAACTTTCAGAGACTTC
CAGGTGATTTGAAAGTGTAGTTGGGATGCAGAGCTCCTGCTTCTAACTTGGCATTGCAAA
GAACCCCAATGTATGGCAGCTCCCTTCCTGATAATTTTGGGAAAAAAACACAGTTCTACA
AGGTATATTTTTTAGCTTTTCTGTTTTAGATATTTACTACACTTAGAAAACACAGCCAGC
AGATGGCAATAGTGTAACATAGAAAAATTCTAGGTTATGGCCACAGCAGTCAGGTTAGAA
AACTTCGTTGAGCTTCTTTCAAACTGAAAGAAATCTGTCATTTTTGTATGTTAGGTTAGT
AATAGTAGATGAAGATGAGAGCTATGTGTGTGAATTGTAAATGAACAAAGCAGAACTCCA
AATAATGCCTATCCACTAATTTAATGAACATTAATTGAGTCACTATCAATGAAGATCAAA
AAGTAGGTTTGGAGACTGGCACCTTGTTTCATCACTATAATCTCAGTACTGAGAGAGGCT
GAGGCAAGACAATCTCAAGTTGGAATCCTGAGGAACTTAGAGCAGTTGTCAAGACTTGTC
TAAAGGGGGAGAGGGGCACTGGCATTGTAACTCTGGTAGAGGAGCACTTGTAGATTTAAG
CCCCAGTGCTGGGGAAAAGAAGTAGATTTGGAACATGAGAATAGGAGCTATGGGAATAGT
GTTAGTGTCAAATTGAGTTCTTTTTCCACTTATGTTCTTCATCCTTAATAATAGTAACAC
CAAATTATAGTCAAGTTGTTTCACAATTTCTCACATAAGAATTCAATTCTTGAATCTTTA
GTTCAGAAAAATTTAAAGCATATACATAACGAATAGTGTTATGGACCCAATTTTCAGGGA
TTACTATCTCATGAATTTTCTTCATCATGTATACTTTGCCTTTCAGATGATTTTGAAACA
GATTCTAGATATTATTTGTCCCTATTAATTGTAAATTCACTTTTGAGTAGCTTTTTTTGT
TTCCCTTATCTTGAAAAAAAATTCCTTTGTAGAATTGAACTTTTCATACAGATTTAAAAA
TACTTTAGAATAGCAGCTCTTCATGCTTTTTTAAATGTGGCTCATATCTGTTGATACTTT
CTGGTTTAAAGAGGTACTCTGAGAACCTTTAAAATATGTATTGATTTACAATAACAAAAC
AATTACTCATTAACATAAATAATATGTTTTACTGAAAATAATTCTGTTAAAATATAAGTT
GGGCATGGTGATAGTATGATTGTAATCATAGTACTTGGGAGGCTGAGGCAAAAAGATTGC
AAGTTTGAGTCCATCCTGGGAAATTTAGTGACTTTTTCATTGCCTGTATCAAAAATTTTA
AAAGGGGAGCAAGCTGGGCATGGTATAATCCCAGCAGTGAGGGGGCTGAGGCAGGAGGAT
CAGTGTGAGTTCAAGGTCAGCCTGAACTACATATTAAAAGTCTGTCTTAAAAACCAAACA
AAAAACCCCAAACAGATAAAAATAAATAAATAAAACGAGGAAGTGGACACAGGAATGTAA
CTCAGTGCCAAGGCCCTAGTTCAACTCCTGGTACTGTCAAACACAAAACAATATTAAGGA
GAAAAGTGACATTGTCTTAAACTTTTGCAAGTGTCTCTCTCTCTCTCTTTTTTTTTTTTT
TTTTTTTGCTTCATTGATGAGAGCAGGGTTGTTTTGACTATTCTTGTAATAATAGAAATT
ATATTTGGAATTATCCAGGGGAACTTGGTTTAGATGATCCCACTTTTGTTGATAACTTCC
AAAGCATCAGTCAGGAGAACATAGGCCTCCTTCTTCTCCCTCTAAGTCCCGAACATGGTG
TTGGTCTTGGCCACGTCAGAGTCAAGAGGCTTTTCACAGCTTCTTGATCTGGTGCTTTTT
GGTCTTAATGTTTATCATGAACAACGATGTGTTGTGTTCTTAGTGAACAGCTCAAAGGTC
AGCGCAAGTTGCTGGTGGTGTAGTGTTCAAGCTTGAACCTCTAGCAATGCTCTTGCNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGGCAGACTGCTGCCTAGCAAGAGCAAGG
ACCCTAAGTTCAAGGTCCAAACTACATCACAACAACAACAAAAAAACCCTGGATTTAGCT
ATGGAAGGAACAGGGTTGCTGTATGGATTAAAAACTGGTGGTCAACTTAACACCAGCTGA
ATTAAATCAGTATGGTGGTAAGTGTAGATGGCCCACCTGAGGACAGTTACTGGCATAAAT
AGAGACGTGAAGAAGAAGAGCTAGGCATGATGGGTTCTCCTAAGTGTTGCTGTTTTGAGC
TGTTGGTTCTCCTGGAGGAGCTCATTGTGACTAGCTTCCCCAATATGAAGTCAGCCATTA
TCATCAGAGGAGCTTGGGACCTTGTTGCTGAGAGTGGCTGTGGTTCACTTTGAGGAGCTT
TGCTCTTTACATTGAACATCACTTCCTGGCCCTGGAGAGTAAGATGTGTGTGTTTAATAT
CCAGGAGAAACTTGTCGCTCTGGCTTTCTGGAATGTAATTGACTGTTTTCATTGTCAGAG
GAACTTGGGACCTCCTTGTTTCTACGGATGGCTATGGTGCTTTTCAGGGCACCTGGTCCT
TATTTTGAGTGTGACTTCTCAGTTCCAGTGTAGAACCCTCAACCTATTGACACAGCTCCT
TCATCCTGTTGGCATAGACTTCTTGTCTTCCACCACTGACCTTTGGGCTGTCCCAGCAGA
TCATAAAACAGACTGGCGTGAGTCCTTGTCGTGGGCTCTAGACTTCCAATTGGATTCATG
GGAGGCATTGTCATGAGCTCTAGATCTTCAGCTGGACTCATGCAGGACATTGTATTGCTG
TGGAATCCAAGCCCTTGGCTGAATATTCTGGGCCTTTCATATTGTGGACAGATTTCCTGT
ACTTTCTTGTGTTTAACTCTAGATGACCATCATAAAACAATAGTATAAATTCTGTGTCCT
GATTACAATTGTTCTCACAACTCCCGGACTACAATAGTTGCCTATTTTGTTTTCAGTGCC
ATCTTGGTAAAAAGAATCACGAGAGAATTTTTATATCTACTTGTGTTGATCCTATCACAG
TATTAGCTCTGGTGCAGCTCAGTGCTGAACTCCTTGCCTAGATACTCAGTCCTTGATTCA
GACCCCAGCATTGCAAAAAACAATGACAACAAAAGATTAATGGTCTGTAGTTTTAGCTGG
AGCATATGAAGGAAATGGAAGCTCTTGAGGAGACACAGTAGGAAAAGAAAAGACTAATTT
TACTGGCATTTTCAGATAATTGTGGTTCTTCTTTGATACTATACCAGGACTCCACTGTAC
ATTTGTAAGTAGATGATAGTGGAAAAAAGGCATATGAAATCTTAATATTATTATGAAAAT
ATAACCTTGAAGTCCCCTGAAAGGATCTTAGGATAGTCAGGGTCCTTCAGCCACATTTTT
AGAAAATACTGTACTTTAAATATGGTTCATTCTCTTCCTCTTCCTTCTCTTTCTCCCTCT
CTTTTTCCTTTCCCTCTCTATTCTTTTCTTCCTTCACCTCCCTCTTCTTTTCCTCCTTTT
TTCTCCTACCTTTTCCTCTTCCTTCTTCCCCTTCTTTCCCTTTCCCCTTCCCATTATTCT
TCCTTCTCTTTCTTCCTTTCCCCTGTTCTTCTTCTTCCTTATCCTTTTCCTCCTCCACTT
TTCCCTGCCTCCCCTCCACCATACTGGTGACTGAACCCAGAACGTCAGGGCTATACAAGT
ATACAGCCATTGAGCTACCCATGTTCCCATCCCTTTTTATTTTCATATTTATAAATTTTG
AGACAAGGGCTTGCTGTGTTGCCTAGGCTGATTTAGAATTTGGATTCTCTTGAATAGCTG
GGGTTACAAGCATGTGGTATTGGGCCGGGGATTTAGCTCAGCTGGATAAGCGCCTGCCTG
GCAAGGGCGAGGTTATGAGTTTGATCCCCCGTACCAAAAAAATTTAAAAAAAAAACTGCA
TAGTACAAGTATGTGGTATTATACCTAGTTGTTTTTCTATTTTAAAAGTTTAAGTACAAC
ATATTTCCTTCAATTTATTACACAAAGGCATTAACAAAATAAGGTAAAGCATAGACAACA
GTTTCATTACTCAGCTTCTTTCTTCATTAAGACTTTTTAATCTCATCTTTTGCTTTCCAA
ATTGGAGGTAATTTTTTTTTCTACTCATAAAGATAATATATATTAATTAATTATTAAAAA
GTTCCAGAGCTTCTGGGGAAGATGTCAAAAACAGTAAGCAGCAGGAGTAAATAGCCTCTT
CTGAAGAGAAACAGGTCCAGGGTGCTGGGATAATAACATTGTGAGGAAAGACAAGAAGGA
AAGGGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNCATCGATGGCAGGAAAATAGCATGGCAGAGACGAGG
CAGAGCATGTTGGCCATTAACAACTAATACAGATGGCCTCAGTTCACCAAAAAAGAGAAA
CACAGGCAGAGTGGATCAGGAGACAGGATCCATCAATATGATTTATGTAAGAAACATATT
TAATTCGAAAGGGGGTTCATAGACTGAAAGTCAAAGGAGAGAGAACAATACTTTATGTGA
CAGAGAAGCAGAAAGAAGTGGCAGTAGGTTGCCCATCACCTGCAGAGTAGGTGAGAAAGA
CATGGCATTTCTATACAATAGAAAGCTACTCAGCCATAAAGAAAAATAACCTCGAGGCTC
TTGTAGGTAAAAGGATGCAACTTGTGATCATAATCATGGGTGAAATGGTTCAGGGTCATA
TGGGTGAATATTGTGTTGTCTCCCTAATATAAAAAACTAAAGGAGTTAGTGGGATCCAAA
ATGCACAATACATCCTATGAAAGTGAAAGCGGAGGAAGTGTTTAAAAAGGGAAGGCAGTG
GCCATTGGTAATTTATTATTGTTGTTTGAAACCCATATTGTTTTCATTATTCTGTTTAGT
TTGGTTTTATTCTGTTTGGATTTGTCAAATTTTATTATATTTGATGGCGTGGACAGCTAT
TTCAAAGATAAAAAATATATTATGGTAGCCATTATTGATTTCCTATTATCTTGTTTTGAA
GACCTGTATTGCTTTCATTGTTTTGTTTTGATTGATTTTATTTTATTTTGTTTTGTTTGA
TTGTATCATGTCTGATGGTATAGGCAACTACTTTGAAGATAACAAGAGGCATTATGGTAG
CCACTTTTGTTTCACTATTATCTTGTTTTGAAGTCCTGTATTGTTTCCATTGTTTTGTTT
TTATTGGTTTTATTCTATACTATTTTGTTTGATTTTATTATGCCTGATGGTGTGGGCAGT
CCTTTTGAAGATAACAAGAGACATTATGGTAGCCATTATTGATCTCCTGGTATTTTGTTT
TGAAGTCATATACCATGTTTATTGTTTTAATTGACTCAATTCTATTTTGATTGATTTTAT
TCTCTTTAAAATAAAATAGGAGGTTTTCAAAAATGGTGGCTTGCTAGGGGATTAGGCAGA
GTCTCTCTGGACAAATCATATTAGATGCTAGAATATGACAACATGGAGAGGACCAGATGA
ATGGATAACGATTCTTATTAATCAAGACAGCACGGCTGGAGAATTTAAAGTCATGCTGAG
ACTGCGAAGGCTGATAACGGGAGGCTGCAAATCCCGCGCCTTTAATGCGGCAAACTGACC
AGTGGACCCAACAGGAAAAGCTGTGTTGGCTTTTGGTGACTGCTGGAAATTGAGACCGGG
GACCCGTGAAGCAGTCAGGACTGCCCCACTGCACCAGGGGAGATTGTGAAAGGCTCTGGA
GCTCCGAAGCCGAACGATGTGCAGTTTTCTGACCATTCCACACTGTGCTGGGAGCGCAGT
GAGGGCAAGTGGTGTGGTGTGTAGTAGACTCAAGAGGAGGACCTGCACCGAGCCCTGGTG
AGTACTGGGGACTGGGTCCTGCGGCTACTGTGGTTGGCCAGAGAACATTTTGGAACTGAG
CAGAGCCTGCCACCACGGCGATATCAATAACACAGAGAGTCTGGCAGAAGACATCTTAGA
GTTGGGTAGAACCTGCGGCTCGGTGACATCACCGAGTTGCCCCTGGCGTAGAGAGGTCTG
ATGGAGGACATCTTGAAATTGGGCAGAGCCTGGTGCCATGTGGGCTTCAGCGTCATACAG
AGAACTAGTGGAAGACATCTTGGAATTGGGCAGACCCACTGTCCTGGTGCTCCTGGCACA
GAGAGGTCTGGAAGAGAACAGCTGGGATTTGGGCAGAACCCTGTGCCATGGTGACATTAG
TCAGCTGCTTCTGGCACAGAGACAACTGGCAGGATCTGCTGGGGCTGAACCAAGCCTCTG
CTTGGGGCCCAATAAGCAGATACAAAATAGTTGCAACTCTGTGACATCCAGAACGTACAG
CCTAATTTACGGATTGACTGGCACAGAGGCTGGAGGCTAACCTGCACCATCCCTGCATCC
CTGCCTACCCTAGATAACAGCAAATTGGAGAAGACAGCAAAAACGCAAGTCAGCACACTT
CTGAAAGGCCCTAAGCAATACGGAGAGGGCCAGAGACCCCCAGGACACTCCAGTCTGAAA
GAAACCAGAAACATGACAAGAGATAAAAATAAAAAAANNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTCTAT
GTGAGTCTAAATAGTGGGCTGTGTAGATCAAATGAAGTCGCAGGTACTCTGAAGTGTAAA
GCACCCTGAGATAAAAAGTGTATCGGCCCTGGGTGGTATGCTTTGAAATTTTATTGTAGT
TTTTCTTCTTTTTTCTTTCTTTATATGTTTGAATAAAATAGATTTGATGAAGGAAAAGGT
GTATTGGGTAATTCTATGTAGCTGTGTCCACTGGTCTGGCTTTTTTAGGTTCTTGGAATT
TCTTTGGTACAAGGCGTCGAACCCAGAGCCTTGTGCATGCTAATCAAATACTCTACCACT
GGGTTACATCCCCAGTCTTTTTTAAGACAAGGTCTTGCTAAGTTACACAAGCTGGCCTCA
AACTTGTGATATTCTTGCTTCAGCCTCCATAGAACTGGTACCATAAAGGTTCAGATTTCA
TTTTGGTAATTTTTGTGTGTGGATGGGTCTGCATGCTTTTAGGGGAGGAATATTTTGAAT
TATCAAAAATAATAGTAAATATTGCCACAGCATGTTTACAATAAAGTCCACACTAGGTTC
TTGTTAATGTTTTGTTTGACTTCTTTTCTAGGAGCTGAAGACATTTGAGAACTTTATAAA
ATCCTGTCCTCCTTTCGATATTGTTATTGATGGGCTCAATGTTGCTAAAATGCATCCGAA
AGCCCGAGAATCTGAGTTTGTAAGTACAAGTTCAATTTTGCTATTCTCCATCTCTGTAAG
TGTTTATTCTGCCCATTAGTGATCTGTGAGCATCTTTGCTCTCCATTTTTCTTTCCTGAA
CTGGACTCCTAAATGTGCCACAGTGAAAGCCACTATATTCATCTCCCCAAGTAAGTAGGC
TGGGAGTAAAAATTAAGAGAGTGAAGAGTTAAAAGAAAAACTACGTGACCAAGGGCCATT
TTGTGTAACCTTTATCCCATTTCCTTCTGGCTCACTGCTCTCTTTAGTGTTGCTCTGTCA
TTTTCCTGTGGGTATCAACCCCATGAAAATTACCAACATAGTAGGGTATAATAACAAGGG
ATACTAGTCACTTGTTACTTACATTTGTTTTTTTCAAGAGATAGTACATTCATGAACTAA
CCTAAGTGGTCTTCTTTCACGAGGTACTCATTTCGTTTATTGATTTATAAATGCCCTAGC
AGTCTCTAAAAGATATCATGATTTTTCATTACAGCAATGAGCAGTTATTTTAATTCTATT
TTAGGTGAGAAAATTAAGGCTAATTTTATACAATAAATCCTTAGATAGATCGTAGCATCG
AATTAATGGTAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGGAAATA
AAGCATAAGAGGGGCTGGGGATTTAGCTCAGCGGCATAAGCGCCTGACTTGCAAGCAGGC
AGTCGTGAGTTCGATCCCTGGTACCAATAAAAAGGAAAAAGACAAAAAAAAGAAAAAGAA
AAAGAAAAAAAGCATAAGAGAATAATAGGATTTTTATTTTTTGAAGTTTCTTTCACCATG
GGTATATATTACTTAAATATTAAATAAAACAGAAAAAGAAAAAAAGTTTAAAGCTACTCC
TGATAAGTGTTTTAAAATATCTGCATAAAATCTGGGTCCTGAAGAAATACTGTAGCCAGG
TGTGGTGCCACATGCCTGTAACTCCAGCACTCGGGAAACTGAAGTAGAAGAATCACCACA
AGTTCAAGACCAGTCTGAACTACATAATGAGTTTGAGGCCAGGCTGAATTATACAGTGAG
AAAACAAAAACAGAAAAATAAATGCTATCATTTATTAATTTCTGTATCCTGTGACATTTT
AGGTGGTTTCCCTTTATTCATTATTGTAAGTAGTATTTGGGAGATCTCTTTGCATGCTTC
AGGTGAGTTCTTTGGAACAGATTCCCAGAAATAGATCTTTAGAGTCAGAGGTTATAGATA
TTTTTAAAGGTTTCACTGCATGTTGCTAAATTGCTTTCCAAAATGATTGCAGCAATTTAT
ACTACCACCGACAGTGTATAAAAGTGCCCAAATGTAACATATTTCCTTAAGGTTGCTTAT
TACATGATTGTTCACCTAGTATGTCTAGTGTGAGTCTGCTAAGTGAAAAAGGGCCAGACA
TTCCCCTCATGCCCCATTGTTTAGGTCAAGCAAATTTTTTAAAGTTGGGAACAAGAAAGA
AAATATTCTTAGCTATCTTCCTTTTCCCCTTCCTTCTTACCCTCCGCCCCAATTCTTTAT
AGTTGTACATAAAGGGAAAATTAGGAATTTTGGTTTCCTGAGTCTTAAATTTTTGCCATC
TTTATGTGAAGAGATTTCCATATATTTTCTGTGGAATAATGTATGCATCACTATCATAAG
TTACTTTTCTCGTTGCTGAGACAAAATACCCAATACCCAAAGTTAAAAGAAAAAGGATTT
ATTTGGCTCTTAGTCTGTAGAGGTTTCAGTTCATATTTTGCTAACTCCAAGGTAAGGATG
GCATAACAAAGAAGCACCACAGAGGAGAAACAGTTCATGGCAGGCACCAGTCTAGCAAAC
AACAAGTGAGAAGCTTCTTTCTGTCTCTATAGTTTACCTTGCTGTTTGTCCTTAGGGTGG
ATGACACCCTTAATCCTAATGCCTCCAGTAAATCTTTGTGTACACCTTAGTATTAGAAAT
AGACTATGAAAGTTGTCCATGTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNAGAATGGAGGGAAAGGGAAAGAAGGGGGAGTGAAGGAG
GCAGAGAGAGAGAGAAAGATGAATGAATCCTAGCTGAGGTTCTAGAATCAGGTAACTTGC
TGATTGTGATTATAACCACATGAATGGTCAGTCAGTAACCTTTTGGTATAGAAGAACCAT
TTGACTGAGCCAAATTTCCAATCAAAAGTATTGTGAGAAAATAAATGATTGTTTTTAGCC
CAGGTTTTAGGGTAGTTTATTACACGGCAACAGATTTAGTTGCTTCTTCACAGCATTAAG
TATCTGAAATTACTTATACCCTGTTCTGTCAGATTCCTCCATTAGTGTAAATACCCTGAG
ATTAGAAACCTTATGTTTTTTGTTATGAAATCCGCAGCACTGAGAAAGAGGCCTTATACA
TAATGAATGTTAAATATGTATTTAGTGAAAGAATGAAAAAATGAGTATACAAAAAATTAC
ATGAACTGTTAGAGATCGTATCTGCTAGTCATGCATAACTATAAAAGATTCCAGGAGTTT
TTTACTGTTGACATTTTACTGAGTTCCATGACCTCTTTTGCCTTATATAAGAATTAAATT
AGCTAAATCTTGAAAAGCACTTGTGGTATCTGGTACATAGTCCAGTAAAGTTAAAGCAAA
AGAAAAAGAAAAATTTAAGACCTTGTATCATTTTAATTGTCCATGATTGTAACTTTGTAG
GAAAAAAAAAGGCAAGGTTTTTTTTTTTTGATGTAGTTCTTAGTTTTTAATCTTTTCATT
TTATGTTTTCATTGAAATGATCTTCATACTTTTTGAACTGGTACTTAATCTAAACTTTAA
TTACCAAGTTATTGGCCAACTTCTCTATTAGGTAACTAACAAATTTTGCTAGGGATTTAG
CTCAGTGGCACAAGCACCTACCTGGCAAGCTCTAGGTCATGAGTTCAGTCCCTGGTACAA
AGAAAAAGAAAAAAAGAAAGAAAGAAATTTCATGGGCACAGTAGAGAAAACAAAGACTGT
ATTTGCCAGGGTAGGCTAAGTTACAGTGCAGTAAACAACCCCAAGTTCCTGTTGCTTGAA
ACGGCCAACTTTTTTTTCCATGCCCATTTGAAATCATCTGTGTTATCAAAACTATTGTCC
CAGGATCCAGGATAGCTCTGTGAAATGTTGCCACTCACTGTGACAAGAGAAAAGGCAAGT
GGCAAAGAAGACTCCAGCTTGTAAAAGCTTCTCTGCTATGATAGCCGTCACTTCTGCTCA
GATTGCATTTTATTAGCAGCTCACACAATTCACCAAGCTGCACAAGTTCAGTGGGGACAC
GGAAGGCAATCTTCCATGTACGTAGAAGCAAAAAGAGAACGACTGTTTTTGAACAGCTCT
AATGGCAGCCACATGGAGGCTGATGGTGTCTTGTAGTTATGATTGTCAAATCTAGCTCAG
GAGCTAGAAATGAGTTTCAGCTCAGCAGTGCAGAACAGTCTTTGCCCAGATCATTTTTTC
AAAATCAAAGTCCTTCACTGATATTTTATGTGGAAAGAGCTGCTACTTTTGTGGATTATT
TTTTCCTAGAATGATAGGGAAAGGATGCTAAACTCCATTAATCAGACTTTATGCATACTT
TCACAACTTTCATTTAAAGAAATGAGTTGTTCTTTTCAGTCACCAAGTCATCACTAGTAA
TTGGTGATGTGAGATTGAGTTTTGGGGACAGGGACAACATGCTAACTTTTCACTTAGAAA
ACAAAAAGACAGAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCTGCT
GAGAGTGGCTTTGCTGCATTCTTTTTTTTTTTTTTTTTTTTTTTTTGGCAGTGACCGTGT
ACATTATTTGGAAGGAGGAAAAGAGCTACCCTCTAAAGGGTAAGAGCTAACCAGTGAACA
GCCTCACAGCAGTCCAAGGATAAGGAAAATTATGTATCTAAAATTCCTGGATTGGCTTCC
CCCTCATGCAAATTAGGCACTGGGACAGTTGTCTTTTTGAAAGTTCACCTGGCTTGGTGT
TGGGAGCCGCGTCTGTGATAGCTCGCCTTGCGCGGCGGACGTGCGGCCTGTGGTAAAGAG
CAAAGCCTGAGGTAGATTACCCCTCCCATCGAATATGTTAGTTTCCTGCTTACCGCGTAA
ACAACCCGCTCAACAATATAGTCTGCCTGGCAACTGATGATGTTAGCCAATCAGCTTGCC
TTGCTTACTTTAACATGATTGGACACTGTACCCGTATATATACCGGTGCCACCCCTGGGC
GGAAGAAGAAGCCAGGTAAAAGCCCGGAAGTAAAAGCCCAGAAGGAGCCGCGGAGAGCGG
ACCGGTAGAGCGCTTTGGGGCAGACTGAAGCACAAAAGGAGCCGCGGGGAGCGGACCAGA
GGAGGCTTCGGCTGGGAGCGATCCCAGGGCAGGCTGTACGGAGAAGGAAAATAAAAAGAA
AAGGTTGTCCACTACCAGACTTTGTCGTGTGTCCTTCCTGCCGGCCGGGAGCGGACATCG
ACAGCTTGGTGCTGGATTTAAACTGCTCTATGGAAAGTCATGCTTGGCTTCCCTCCAGAC
ATAAATGAAGGATTGAAAATAGCACTCTTCTGATTAGTTCTGCAAACAGCACCAGATTCA
AATGAAGGATTGGAAAATACTTTGCTCAGGAGTTGTGGAGTCAATTTGAGTCCTGTGTTT
TGTGAATGCCCTTTGGGTTTGTATAATCTTTGACACATTCTGCCCAGTTAGCTGTCTAGT
TTGCCTAAGCCCTGATCTACCTCATTTCACCCTGAAAGACATAGCTCCCATTATTGTTTA
TAGAGTGGTGGTCTCTTTCTTCTGATAACTGCTTCCTGCTGAAATAGGATATAGGTCCTA
CTTGCTGGATATTATGTGTTCTCTCACTACCTTGGGGTATTAGGGCTTGTTGACCTGGCT
GGTAAGAACCTGTCAGAAGACAATGAGAAAAATGTTTAGTACCTGTATATCAGGAATTGT
GGCCTCTTGACCTCAGTGAGAATGCTCTTTCTGAAGATCACTTACCTGTCACTTCTCTGA
GACTCCTCTACCCAAAGTCCCAGATCTTGTGTGTACTATACAAGAATCTGGATGTTTGTG
TCTAGATGTGCCCCCCAAAGCCTCATACAGTCATGGGGGCAGGTTTCTAGAATTTGTGAT
TGATTCATGATCTAATACTGGGATTATGGGTTCAAACACTATACCCACCCTACGGTGAAT
GATCTATATACAATATAAAGGACAGAACAAGTCTTCTCTCCCTCCTCCCTTTTTGTTCTT
GTTGCTTTTGCTGTCTTCTGGCTCCAGAAACTGTTGCCCTCTGCTGTATGTCCCCCTGCC
TTAGAGCCAGCTGAGTATGGACTGAAACCTCCACAAACAGTGAGCTAAATAAACCTTTGC
TTCCTTAACTTTAGGTGTCAGGGTATTTAGTCTCCACAACAGAGAAAAGTAAGTAACGTA
TTACCTCTAGCTTCATGTCTCACCTCTCCTCAGCTCCTGCTTCCTTCTACCTTGCGAGTA
CATGCAAGTGATCCTAAAATTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNATTACTGGCC
TGTGACTTTAAGATAGGATCTTACCCTTGCTGAGCCTCAGTTCCCACCCATGTAAAAGGG
AAATAAGAGCAGGTGGTATACTGTGCCGAATTCACAGGATATCTAGGAGGATTTAAAGTA
CTCGTGACATGTCATAATTGCCCTAGGTGGTAGGTGGGAGCAGGGTCCCAATCTGGTTCC
ATCTGGTTCTCCCACCACCCCCATGGAGGGTCCCAGCCACTCTGGCTGCTGGAGGAGCTG
CAGCGCCCCTCTCCGTGAGGCTCCCATGCACCTCGGCCCGCAGCTCCTGCACACACCCTC
CTTGCCTCTGAGATGCCCAAGAAGGAGGTCAGCTAGGCCAAAGGGGCAGCAAAGAAGAGC
CCAAGGAGACTGGTAATGTTGTCCAGTAAACCTGCTCCTGCAAAAGTGGAAACAATCCAA
AAAGGCAGCGGGCCAGAGATTTAGCTCAGCGGAATAAGCACCTGCCTAGCAAGCATGAGA
TCATGAATTTGATCCCTGGTACCAAAAACAAAAGAAAGAAAAAAAGTAGCGGGAAAGGAT
ACATCTTTGGACAAAAAAGGTGCAAGCAAAAAGGAAAAGGAGAGCAAAGGCGAAACAGGC
TGAAGTGGCTAAACAAGAAACCAAATAAGATTTACCTGCAGAAAATGGAGAAAGGGAAAA
TGAAGAGAGTGCAGCCTCAAACGAAGCAGGAAAAAAGACCAAGTCAGATTAACCACACAC
CATGTCCTATCAGGACTCCCCGGTCTCGCTGCTTGTACAATCCAGAGGAATATTGTTATC
AACTATTTTGTAAATGCAAGTTTTTTAGCAGCTCTAGTAACCTCTTTAGAAAGGCGGGAA
TCCTATCTCATTGCATTTTCTAAGGGTAAATTATTTATTTAGAGGTAAAATCATTCGCTG
ATTGTTCATTTTTTGGCACAACCAGAAAATAGTGGGATACTGAATTAAGGCAGGTTTTGA
CTGTCTTGGGTGTCAGTTTAACATTTCATAGGTGGGGATTAGTTTTATATCCACAATACA
AAGCATGCTAGATGGCAATTTAGAATCACAATCATGCATTTAATATGCCTTGAACATTTT
AAAATGATTTCTACTCCTATATTTTTAGTAAAATTGCTTACTAAGAAAACTACTTCCTGG
CTGTTGCCCTGTCAGAATTGTATGCACTTCCTAACATCTTTAGTTTGGTCATAGTAGTCC
AGTTTGCCTAATTTGTTAACGTGCTGCAAAAGATCGAAAATTTGAGTATGTAGTTTATAA
GATACAAAATTGTGAATCAGTGGCATTTAAAATAAGATCTTAGCAACATTTGAAGATAGT
GGTACTTAAACTTCTTACAGAAAATTTGCCTCCAAATTTGAAGCTGGACAGTCTCTGGAA
TAACTGAAAAAGAAACAACACGTGGCCTTTTACATTTTTGGCATGTGTGTTTAGAATTCT
GTAAAAAGTGAAATGTCTCTATTGGTCTTCAACACAACCGATAAAATCTCAAATATGAAA
GTAAGTAACAATAATAATAATTGCCCTGGAACTCATAGCTAGTGGAGGAAAAATAATATT
CTTTTTGCCTTACATCACTTTTTAATCTATATGCCTGAAAAAAGGAGTCTCAAAACAGCT
CTTCTACTGAGAACCAACACTTCCTGTCCACGCCTCTGCTTTGATTAGAGAAGTACAATG
AACACAGTTGTCTCGTGTATACTCTAATCCCTCTGACACCTCTCCCTCAAATCACATCCC
CATTACTGCTTCCTGTCATTTACGGTTTCTGTGTCCCCATTTCTACTACGAAAAGCAGAA
GTGAGGGTGATATGAAGCTTTGGGGATTTCTAAAAACTGTTCTTAACTCCTCCTTATTAT
GTTAAACTATAGTGTTAGGAATGTAATATTTGACAGACCACACACCATAAAAGAATTCTC
CCACTAGAGACTTTAATGTTTTAACTTTTTAAGAGACAGGAATTGTGATGTTTTTGCATA
TACAATATGACAGTTTCACAATTATAAGAGTTCATTAAATTTAAATTTAAGACAGAAATT
TTCTGTTTAATTTCTTTTTCTGCTACATTTTGCTTGTGGAGAAAGTTAGGCTTTTAATTT
GCCTTGGGCGGGACACAGGGTACTTTGCCTAGCATGAGCACTTACAGTTAAACGTATGTT
AAAAACGGTAGAACACTGGCAATTTCTTGTGCTTCTTAATATAAAAGTGTGTGTGCTGGC
CCTGAATCAAGGCCGGCAGCTTCCGGACACTGTTGGTTTCAAGCAGGAGCCTTAAAGAGA
TGTCTTTCTATGATCTGTTGGCCATTTCAGAACTTGGTCAATGAAATGGTCAATTCACTA
GAAAGAAACAGCTTGAAACACTCCCCCCACCATGAGTGGCTGTGAACATGGGCAGGCTGT
GGCAGCCCAGGACAGGAGCCACTGGCCATTTACTGGGACCACATNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTACTTTCACAATTTTGCTTACAGTGTTTAGTGCTTCCA
GTGTTATTCTTGGAAACATTCTGATCTGACCTTTTGTATGTGATCTGCTTTATTTCCTCT
GACACTTCCAGAGTCTTCTGTTTCCAGTGTTCCAAGGTTTCACAGTGTTGTGATTTGGTG
TAGTCTGTTTACAGTCACTGAATTGGACATACAGTGGATTATTTCAGTCCAGAAACCTTT
CATTTGGTGAGATGGTTGTAGTTATTTTGTTGATGACTCCTTTTCCTGAGTGATTCTAGT
TCTCTCTCCTTTTGAATAACAAACGCTCAGACTTCCATCCCCACTCCAAGAGAAGCAGTA
TGGATTTGAGGATATTGGGGTGCTTGAATTCATAAATTGAATTCTCCTTCAGTAGCTTTT
AGTTAGTTCTCTCAATTAGTCTGCACACCTCCATTCAGCCTCTCTCCTTTGTGTCCAGTT
GTGGAATCTTTTCAGAGTTGTGCTTGTGCTTAGCTACCTCCCTTTAGAATTGATTTAGAT
TTGCATGATCAGTTATCATTTGCCCATCTATTTTCCATCTTCCACAATTATGTTGCTGTT
GTTTCCTAGCACTTTGGATTTGTCCTTTTAGAAAGTCTGTATTATAGTTTTTCATGGAAT
TTCAGGTGGCAGTGGGATTACATGTGTTTTTTCAGTTTGCCTTCTTAACCTGAAATCTAA
TGCTCCTATCAAGTGTTACAAGAGAGATTAACACAAAAATGACACAAGCCTTGATAATGC
CAAAAGAAACTTTTTTCTCTGTTTTATTCTTTTCTTCATCTTTTTGTTGAGAAAGAGGAG
TATTCAGTGGGGGTTGGGATCCCTAACTTAACTAGTTCAAGGCTATTTTGTTTGATAATA
CCTAACATTTATTGAGTACTTGTCCATGTATTTTGTATCTACGTGCATTATCTACATGAT
ACTCAAAGTAACCCATTGTTACTCCCATTGTACTAACAGTGAGACAGAAGAAATGTAACT
TGCCCAGGATCACAAAGTTTGCACATAATAAAACCAGAATTTGAACATAGGCAGTTTGAC
ACCAAAGCTTGTTCTATTTTCTTAAATGTTTACTTTTATTTTTATTTGTTTGTTTGTTTT
GCTGAAATGAGGATTAAATTCAGGCACTTTGCACTGAGCTATCTCTCCTGCCCTTGTTTA
TTTTATTTTATTTTTTTATTTTGAGACAAGTTCTCATTAAATCACTAAGCTGTTTAAGCT
GGGCTCAAACTTGTGAGATTCTCCTGCTTCAGCCTTCCAGAATGCTGGATTATGAGCATC
ACTGCTCATACTAAATTTTACAGTCTTAATCACTTAGCCCTGGCTAAATCTTGTGCTCTT
AATTACCCTATTGGTAAATTATAGATACCAAATGGAAAACTCTTGTGTGTGTTCAGTTTC
TTTTGTTATATAAGCCATTCCACTTGCAGGCCTATATAAATGGCTTAGAATGTTAACTAG
AGATGTTCAATAAATAACTAAGTCTATAAACTTTAAACAGACAATATTGTTCCAGAAAAC
AAAGTCATTAACCACAGTGTACAATTTTGTGGATCTTTGTAACTAGACACAGCTATATGA
ACTGGGGTAACTGGAGAGACTGCACCTCTGTTCAAGCCTCTGGAGCCCCCACTCATCACG
TTCCTTCTCTCCTAATTGTTAGATGGCCTGTGACTGTGAAAGTGTTCACATTCTTTCCTG
GAGTGAGAAAATTATTCTATGTACTTGTACTGGATATAAATTTCCCTGTGGGAAATTTTT
AATAAAACTTTTGAAGGTAGAATTTAAATGCACCCAAAGAAATTAATCTTATCTCCTTGG
AACTCATTTTCAGCATTTAAGCTACCTGTCCTTTTCTATCTCAGGATAAATGAAACACAG
AGAAACTAAAAAGACCCAAGAATGTGCATAAATGTGGGGAAAAGTCACACTATGAGTCAG
GGGCCAAATCTGCCTTCTAGACCACTGTCTCAGCTGGCTGGGGAAATCCAAGCAAGCCTG
CAAATTAGTTGTTTTCTAAAAGGCTGGATAACTGTGTGGGTGCTGATGGCATGAAAGCAC
GACAGTGGTGTGCAGGAAACATCCCACACTTGGCAGGATGTTCCCAAAGCAGGAAGGGCA
TTTCTCTTCCTCCTTAGGATTGTTTCATTACTAAGGACAAAATGAGATAATTGAAATCTC
CCTAAAATACCAAAACCTGACCAAAGCAGGATATAGGACATGGTAGGTCTAACGTAAACT
ACTGGGATCATTTATGATATCATAATGAAGTAACAGCACTGTATTTATATGCGTTATCCC
AAGACACTCAGAGCTTTGTAGAGTGTTAGTCATCATGTAGTTTTAAATCTGTGCCTAAGG
AGATGGAAGTGGACTCCTCTTCAGTCTCAGCCCATGCCCCCTGGAGTGACTCCATCAGAC
TTACAAAGCTCACAATGCTGCTTGCATACACCTAGTGAAGGCATCCCTCTCCCTCCTTAG
CCCCAGCTTCTGCTTCTTTACTAAATACTTCCTTTCTCATTTTCTAAATCTCTCTTATTC
ATCAAGTACTAATCTGTCTCCTATCTGGTATACAGCTCTTGTATAGTTCCAGCAAGACAG
GGTTATATTCATTTAAAAAATAGTATCTTCCTCTCTCTGCACACAACAATGTCTGTCAAA
GGTAGAATGACCAGAAACCTTAAGGTACAACTTGGGTGGATTTCCTGTACTGTCTCTCTT
GATGGCATTTTCAGAAGACTCAGAAAAACATCAAGTGTAGCAGTCACTTGAGAATATAGT
CATTATCTCTGAGACAGGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNG
TTATCATGAGGTTTCCTTAGTGAAGCCATCATATAAAAAGTGGAGAAGTATTTCCTGCCC
TTTAACACTATTAGGGGCAGCAGAGGAGGGCAGAAAGGCACAAAGGCCAAAGCACCATTT
ACATTTTACAAATAAAAGAGATCTTAGCAAATAAATAAAATAGGAATTTGGAATTTCAGA
CTCTGGCTAGAACTCCACACACAGGTCCTCTTATTGATAAAATGTAAATTTGGAATCAGC
CCCAGCATGGTAACCTGTTAATTCCCAATACTTGAGAGGCTGAGGCAGGAGGATCACAAG
TTCAATGGGGGGGACCTGTTCCCCCCCAAAGCAGTTATTTAATATATTCAGTTACTAAAA
ACAAATAAGAGTGATACTAGATGATTGATGTTTCAATTATAATTCCACCTGAAATACCTC
TTCACTGAATATCAATGTAAAACAAGTAGAATCTTTATCCCTGTTGTCTTCTGGTTGCTA
TCTCTCATGGGCAGGCAGTGTGCTGAGTGCTGTGAATTCCCTTTATGCTCACTGCCGCTG
CCTCCAGGCGTTGCTGGCCTCTGACTACTCCTGGGCTTCATGCTGTCAGGTTCTCTGTAC
TTACTGCAGTCATGGAGAGACTCCCACACCCAGGTCCCACACCAGCTACATGGCATCTGC
ACCATGGCCCTTCAGCCTCCCACTCCATCTCCTCCCAACCCCTCTGCCAGTGATTCACCT
CCTGTTGCACACAGAAAATAGAAGATATTAGGAGGAGTGACTTCAGTTCTCCGTACAACA
CACGCGCACCATGCAATCAATATCCCTGTCCTTCTTCCAGCTGAGTGCAGAAGGTGTGCT
CCCCACCTCTTTTCTAGATTCCACCTCCCACTTTCCCAGGAACCTTGTTTCAACATTTAT
CCTCATCTGTGCTTATGTCTTCAGCCTTTATGAGAAAGGCCCCTGCCTTTTTCTGATTAA
AATACGAATATTCTTAACTTTCCTTCATCTTAAAGAAGAAAAAGTAGAAGCCTGCTCCCT
TCACAGTGAAACTTCTAGGAGGTTGGCTTTGAAGAGGCAGGACTAGTTTGCAAAGAGACA
GCTGTGCTTGCCAGAGAGCGTCTCTTTGTGCAAAGCCAGCTGCAGCCTTCTACGAGTTTA
GAAAACCAACAGAAATTTCAGTCCTGTGCCCTCTGGGGTCATGAACATGTCAGCACTGGG
TTGCAGGCCACATTTTGGTCTTTATCTTACACAGTGCTTCTGTAACACTGATAGTCATTT
GCTCCATTTTTTCCCTTACTTTTTATTTTTATTTTTTTGTAGTAGAAGAAATGGAACCCA
AGGCCTCATGCATGCTAGGCAACACTCTACTACTGAGCTACACTTCAGCCCTTTCCCTCC
TTCTCTAGTTTTCTATCTTTTCCTCAGGCTCCATTATAGGCTTCCCTTAATACTGTATCC
CACTCCACCCCAGTGCTGGGAATTGAATGTAGGACCACACACTGAGGCCACACATCCCCA
GACCTTTTCATTTTGCATTTTTTTTTTTTCAATTTGCATTTTGAGACCATGTCCTCCCAT
TGCTCAGGCTGGCTGTGGACTTGCTGTCTTCCTGACTCAGCTTCCCAAGTAGCTGGAATT
ACAATGTGAGCCCCACACCCAGTTTCAACCTATTCTTTAAATAGTAATGGTCCTTCAGCC
TCCCACTCCATTACCTTCCCACCCCTCTGCCAGTGATTCACCTTTGGTTTCATCCTCTAC
TTTCTCGCTCACTAAGTCTTTATCCTCTCCTGTTATACAGCATCTACTGGCTGCCATCTC
CTGCCATCATGTGTTCCCTATTGACTCCCAGATTTTTATCTGCAGCCCAAAGCCCTCTCT
TAAATGGCAGAGCCACGTAATTGGCTACCTGCAGGGCATCTCCATGAGACTCAGGAGCTC
TTCTCACAGAGCCATCTCTGTACCACCTTCTGTCGAGGGGTCCAAGTCTGCTTTATTGGC
TTCTTATTTCCCACACCCACTCAATGACTAAGTCAGCTCAGCGCTGCCTCACCAATTCTC
AGGCTGCTCTATTCTCTCCACTGCCGATTTTCTCATCACCTCTTGACTGAATTAGTGCAG
AAGGTTCCTAATTGCTCTCCCTGTTCCTGTGTAGCCTTCTTGCAATCTATGTTTTAATCT
CTAAAATGGTAGTCATGTGACTGTCCGGTTAAATCCTTTTCATTTCCTCCACTGTTTTCA
GGCAGGAAACCTTACTACTGCTTTCACAGGCTCTTGTGAACTGACCTCTGTTTCATTCCC
AGCCTTATTTCTGGCTCCGTCCGCGTCTGCCTCCCACTCCTCTGCCTGAACCACAGTTGA
CGCCTTGCAGTTCCTCAGACTCCACTTGCTCTAAAGAGCCCCCACCTTCAGGGTGCTGCT
CCTTGCCCGGGGAAATTCCCATCTTCTGCCTGGATAATTACCTGAAAGCCCAAGCTGCTC
GCACTGCTCTGAGGGGACTCCTGACCCGCCTCCTCAATCGCAGGCCTGACGGAGGCCCCT
TCCTTGTTCTCCGGTTTAGTGCGCAATACACGGTGTTAGTCATTTGACTGCATGCACCTT
GAGGTTAGGAATAGCTCTGCCTTCAGATCTGAATGTTCTCAGTAAGATTAATGAATGAAG
TGACCTTTTTAAATTTTATCAAGACCATGATTTTAAATATACCCATGCGTGGGCACACAC
ATGAATGAGGATGAAAAAACACCTTGAAAGCCAGGCGTGGTGGTGCACATCTGTAATCCT
TACACTCTGGAGGCTGAGGCAGAAGGATCACTGTGAGTTTAAGGCCAACCCGAACCATAG
TGAAATCTTGTCTCAAAAATAAAGAGGACTAAGGACTTAGCTGCGTGAACACCTGCCTGG
CAGAGGCAATGTCGTGAGTTCAATCCCTGTACCTAAAAAAAAGAAAGAAAGAAAGAAAAG
AAACTTTAAAACTTCTTACTTGAAATTATCTCAGTGATTTTTCATATATATGAGGTGTAT
GATGGGTTATAGTTCTCTTACTGAAGAACTGACATAGATGACATAGATTTACTCCTGTAG
ACATCAAATCCCAAAGACTTGGTAACGTTTGAAGACCTATAGTCCCCACAAACCCAGGAA
GTAGCCAAGCCTGGAGAGGGGAAGGTAAAAAGTTCTAAGGATGGAGAAAGGAAGTTGTAT
GTGCTATTTAGGATCCCTCAGGAAAGACCTTGCCCTTATGGGCTTCTCCTGCCTCCAAAC
CAGCTTTTCTACTTCCGGAGCAACTCTGCAGCTCTCCTCCCACATGCTGCCCTTCCATTT
ATATTTCTACCCTAAACTTAGCTTTATGCTAAAGGCGAGTGTGACTTATAATTGTAAAAA
ATTTCTCTTACCTCTTTCCACAGGAGACAAACCAAATTAAGGTGGAAGACACATCAAAAA
GTGTTTGAACCAAATATAAATTCGAAACTTTTTCTTAATCTGATTTTTAGAGAATTATCC
TTTAGACCATATCTTGAGGATGGAGTGCAATAGGAGGGAATATAGACAACAAAAACCCCA
AATCAGAAATGAGTTTGTTGTAACTAGCCTACAAGTGGGTCATGTGGTTAACATGTAGGA
TTGATATGAATCTAACTCTCCTTTTAATAAATGTTTGCCATTATAGTCACTGGGCTTGTT
CCCTCGCTTACTTCTCCTGACATTGTGTGGGCAACTCAGACGTGATGCTGCGGGTAGCGA
TTTGCAGCACATAGTGATCGATGTATTCTTTGTGGGGAGTCCATGTACATAACACAACTT
AATGTTTTTTTAATCTTCTTCCTTTCCCTTCCCTTCCTACTCCTTCCATCTCTTGGTCTC
CTTCCCTTTTGGAAAAGATCTGTTTCCTATTCTCTTTTATTTTGCTCTATTTGTATATAG
AATTTCTCATGTAAAAGAAATCATGCTATGTTAAACATGTGTGTCTGATTTCTTTCACTT
AACATTATGGTCTCAAGGTGCAGCCATTTTCCTAGATGACTCAAGATTATCCTTTATGGC
AGAGTAATATTCTATTGTATATAAACACCATGTTTTCTTTATGTATTCATTTATTGATGG
ATATATATAGACATAGGCTGATGCCAAGGTTTAGATATTATGAGCTCTGCTTCCATAATC
ATGTGCATTTGTCATTATAATATGATGTCTTTAGTGCTTTTGTGAAGATGCCTAGCAAGG
GAATAGCTGAGTAAACAGAATTTCTAGTTCTAGTTTTTTGAGGAATCTCCATACTGGTTT
CCATAGTAGTTGTGTTAGTTTACATTTCTACCAACAATGTGGAAGGATTCCTTTTTTCCT
ACAGCCTTCCCAGCATTTGTTATTATTTGATTTCTCAACGATGACCATTCTTTCTAGAAT
AAAGTAGAATCTGAATATAATTTTAATTTGTACTTCTGTAATAGCCAAAGATATTGATCA
ATTTTTCATGTATTTATTGGCCATTTGGACTTTTTCTGAAACGTGTTTGTTCATTTCAGT
TACCCATTTTTTGATTGGGTCTTTTATTTTGAGAGATCTAGGTTTTTTTTTTTTTTTTTT
TTTTTAGTTCTTTACATATTCTAGATATTAAGCTTTTGTCCAAGATGTAGATGGCAAATT
TTTTTCCCCATGCTGTAGGTTGTCTTCTCTCTGTTGGTTGTTTCCTTTGCTATGCAGAAG
CTTTCTAATTTGATATTTCCATTTATTTGCTGATTCTTGATGATATTTCTTGTCCCACTG
GGGTTCTGTTCAGAAAGTTGTTGGCTGTGCCTATGTCATCAATAGTTTTTCCTGTTTGAT
TATATTTGTTGAGCAGATTATATTTGTTTTAACATTGAGATCTTTGATCCATTTTTATTT
AGTTTAGGACATGGTAAAAAGATATGGGCCTAGATCCAGNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTCCATACAGATCCTCCTCACAGGGAGTGTGTGCTAGAAATTGCTATCATGCCCTTC
TCGGAGCACATTTTAGATGCTGGGTTATGATGTCTTGCAAGGTATCTGTGGCCAACGTGT
CTTCTAAGATAGAGGTTCTTTCTCGAGAAGGAGGCTAAGGTAGTGAGAGGGAAACACGGA
ATCGACATCAGGACAGCTGGGTGGCTTCCTAGCTCATTTTGCAGATGTCTGTGTGCCAAT
GGTTCACCACTCTGGATTTCAGCTTCCTTGTGGGAAAACTGGAGACACTCACCTTTTCCA
GAAGGCTCTGTGAGGTAACGGATGTGACTAAATGCCTCACTGTAAATATTCAGTAATAAA
TATATGAATCATACTTGCATAATAAACTTATTTAAATGCCAATTCCTGGACCTTCCTCCA
GAGATTTGAATTTGAACTGAGGTCTACATATCTAATATTGATCATCTGTTTTACAAATAC
TCATACAGATTATTTATAGGCCACAATTTCCAGAAAGCTTACAATTCTTGTATATTATAT
ACCTTTGCATTAAATTGTACTACTAATGACCATAAAAGAAGTAAGAGTACCAAATTCTTT
TCTCTAGTGTTTGAAAATATCAAGTATAAAAATACTTAGAAAATATATAGATGAATAAGG
TCACTCTCTTCCCTATAATTTTGGCATAAATTACTCTTATCTAGAAACATGCAAGACATA
AAAACATTAAGGTACCAACAATTAGAGAGAATCAAATGCCTTATGTAATCTTCACAAAAT
GTACCTAAACATGCTTAAGGCTTGAATGTAAATAGAAAAAATAAGAGAAAACGAACATCG
TCTTACAGCAATACATGCACTGTCAGATTTCATGGTGGTTAAATTTGTAAGCAATTTAAT
ATAAAAGATACAGTATCGGTCAAAAAATGAATAAAGAAAATAACTACTCAGTCATACAGA
ATAAAGTTGAATATTTTTTAGGGAAATGAATGGATCTTGAAGCCATAAGGCTAAGGGAAA
TAAAATAGACCTAGAAACTTAAACATAGGATGATTTCTCTTGTATGAGAAACCTAAAATA
TAAGTATTTAAAGAAAAGACTAAAAAAAGAGTGATGTTGGAAAAAAGGGAAGCAGACGTT
GTGGAGATGAAAAGGGTTATTTGGGAATGAGGAAGAGGAAAGGATAGGGGGAAAATGGGC
ATTAAAATTAAAATGAGATTTGTACGTGTATCAGTTCCTCCACATGAATATAATTACCTT
GTATATTCCAAACCAAAATATCTACATGAAATACAAGGTATCATTGTTTCCAGTTTGGGT
AGCTAGGCAACACTGCTAACCTACGGGTTCCACAATCCCACACAGCTATGTCCTTAGAAA
TAACTTTCCCTGTCTCCTAGTCAATACAAAGAGCCTAGGATAAAGTAATAAATGGGAGAA
AATCAGTATCTAAAGAGGTGCCACAATATTGCCATTTTTCTCAAATCAGGCTCTGAGCCT
TTGTGGTCATTAGGCTGTTTGTATTTTGCAAACATTTGCAATTCATTTCCAGGCTCACCC
CAAAAACACAAAGGACCTCTACCACCCCCCTTTCCAGGAAAGTCAGTTTCAGANNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTTGTTTTTGTTTTTGTTTTTATTTG
TTTTTGTACCGGGGATTAAACTCACAACCTCACACTTGCCAGGCAAGCCTTAAGCCACTG
AGCTAAATCCCCAGCCCTAGGTTTTGTTTTTTTGAGACACAGTCTTGCCATGTAGTCCAA
GCTGGCCTTGAACTCACTGTGTAACCCAGGCTGATCTCAAACTCATGGAATCCCTCCTGT
CTCAACCTCCTGAGTTTTGGGATTATAAACATGTGCTATCATTTGCAGAATGTGTCTCAT
GTTTTAATATGAGCTGGTATATGTTGGGCATATTGTTCAGTTAATAAGAAAATGTTTATT
AACCATTTTCAGTATCATATATGTATTTTCCTTCTAGCTTTGATATTAGGCATTCCCTTG
TTCAAAGCAGGACCATGTCTTTAAATTTTTGTGTTATTTTTGTAATAACTCCCAGGGATC
TTCCGCATAGACAAGATTGGGAAGTACCTGTTGAAGGAATACAGAAGCCATTATTCCTAA
CTGAGGAAAACAGCTACCATTTTACCAGCTGTAAAGTTTTGGGTTCGGGGTTGCCTCACT
GGTCTTTATTCTTCTCTGCTCAAGTCAATATTGGTTCGTGTTTTTTGAGCCAGTTGTGTC
CAATCTGTCTTAATTTAGAACTAATAATTAGGGTAATAAAGCCAACTATTCCTTTCTAAA
ATAAGATTAGTAACACAGCAGAGTAGATGCAAATCCAATCTAAGTATATAGAACATATGA
ATATACCAAAGTGTATCTACTTGGGTTGAAACAGTGTTGGAAGTGATAGGAATAAAACCC
TACCCATTTTGAGCCTCCTTATCTCTATCCCTAACCCTAACCCTAACCCTAACCCAGTGA
ATTCTAGGGAACTCAGTTTAAAAATAACTGAATTTATCTCTGTTTAAAAACCCAACCCTG
GATCTAAAGTGATCATACCAGACTGGGGTTAAGCATTAATTTGTAATGGGGAAAGATTTT
ATTCAAACTTTCAAGGATGGAAAACTTTCAGGACTGTTTCCTTATCCCTTACCTTGCCAC
TAAGTGACTGAGATTTTTCTCTTGACCCTTTTGGTGCTGGCTTTGTGTTTTTTAGCTCTT
GGAAGTGGTATCTCTGCTGGCCAAACAGAATCTACAACTGCTGGTGCTGGGCCGGAAGCA
CATGCTAGCCCGAAATTCCCGGTGGAGAAGCAGTGAGATGGAAAAGGTGCAAAAGCAAGC
CTATTGTTTTTTTGCTGATGATATGTAAGTATTGGAGGTAACAGGTCAATAACACTAGGA
TCCAGTCATCAGCTTGTTAATTACTTACTTTTGCCATTTTAAAAAAAACCCGTGTAAGGG
CTGGGGATTTAGCTCAGTAGCCTGCCTTCCCCCGAGGGGGAAGGAAGGAAGGAAGGAAGG
AAAGAGAGAAAGAGAGAGAAAGAGAGAGAGAGAAGGAGGGAGGGAGGGAAGGAAGGAAGA
AAGAAAGAAAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAAGAAA
GAAAGAAAGAAACAAGAACGCACAGAGGAGTTATAAAAGTAATTGCTATCCAGGACAATA
TCTTTGACTACAATAAAGTTAAAATTTCTCCTGAAGAAAACTTAAAAAGAGACCAAAACA
ATCTACAGATTAGGACCTGACACTGTATAACATAAACCCCAACACAACTTGTGGTCAGAT
TCTATGAAGGATTTCTGTAAATCAGTAAGAAAAAAATCAGACAATGAACAAAGAACATAA
GACAGATTCTGTGTTTTTAGGGAAACACACATTTTCTTTGTTCTTTACTGTCACGGCACA
GCCTGAAAAGCTTTGTGGGTTTCTCCCCAGAAGAAGAGGTGCAGTTCTGCCGCAGTGGAT
GCCAGCTGGGTGTCCGCCAGTGCGGCTCAGCTCTCACGCCTTCTGCCTGGAGACAGCATC
AGATCTCACAGGCTGGGTCTCAGCAGCCCCCCAGAGTGTACTCGCTCATTTTAGACCCCA
GTCACAAATGCCAGGTCCTTAGAGCTTAGGCTCTGACTGACCAGCCATAATTCTAGATTC
CTACAACCCTTCCTTGGGTTTGATTAATTTTTTAAAATGCCTCACAGAACTCAGAGAAAC
ATTACTTATGTGTGCAAGTTTATTGTAAAGGTTATTACAAAGATACAGGATGAGCTACTT
GGATGTGGTGTGGAATTTTCAGGAATTTCACATATTCCCTTACTTGGAAGGAAGCCTCAG
AG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1980, 3829..3876, 4520..4652, 81571..81678, 107995..108141
1001..1980, 3829..3876, 4520..4652, 81571..81678, 107995..108141
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved