Cavia_porcellus Locus ENSCPOG00000008715
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000008715
Cavia_porcellus
ENSCPOG00000008715
GeneScaffold_4088
SNORA62, SNORA62
1572..1727, 3504..3652
5816
CCAGCTCCGCCGGCACGCGGGATGCCGCACCGCCAAGCTTCCGCGTCCCGCAGGCCCGC
CGCGGCACAGCAATGCACAAGGCACAAGGCGCAGCAGCGGCGCTTATTCCTGAATCTTGC
AACCCAGGCCCTCGAGCAACGATAGGCGAACGCTCCACTGGCGAGACCGAGTCCTCTACA
TGCCAGAATCATTCACAACAGGAGCGGGAAGGGGATAACGCAGAAGCCCAGCAGCGTCAG
CCTCCCGGCTCCGCCCGCGAAGCCCGCCCTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NAGGCAGGATTGCATTGAGTTGGAAGCCAGCATGTACTCCACTAGTGGAGACCATGTCTG
AAAAATACGTATGTGTTTTAAATTTCAGCTGCTGTTTTCAGGTTGTTAATTTGGAATTCT
GTAGCTTATACCACCTTTCTCTGCGAGGTTTGTTAGAGTTGTATTTGGCATGTATTCGTG
AGTGTTGTGTTGGCTTCCCTTCACTCAGTACCTCACTCAAATCTAAGAACTATTTTTTTA
AATATCAGGTTCCCATCGTAACTTAAAGGGAAACTTTCACAATGTCCGGAGCCCTTGATG
TCCTGCAAATGAAGGAGGAGGACGTCCTCAAATTCCTTGCTGCAGGAACCCACTTAGGTG
GCACCAACCTGGATTTCCAGATGGAGCAGTATATCTACAAAAGGAAAAGTGATGGTTAGT
TGCAGATTTGACTTGTTATTTTAGCTGTAAGTGCAGGCTTTGGTTGTGCTGTTCTGAGGA
GCATTACTGTTGGTGGGAGGGGTTTCTGAGCTCTAATGGCAGTTGCTGGGTTCTGGAACT
TGAGTTGGGTAGTAAGCTGTGAAATGTGCAGACAAGTTCCTGGTAGGGCCTTCAGCTTCC
TAGGTGCTAGAATTGGTTTACTGAACTGAATTCTGAGGGGAAACTAGGGTAAGAGGCAGG
AATAAACAGTTAGCTCAGAATTAGTGGAGATTGGCTGTGGTAAGGACATGCTGACAAGCC
TGGGGATTCAGCTTAAAGGCAGCCCCGAACCACTGAGATTCAGTGACAGCAAGGGAAGAC
TGACAAGCAATTTGGGGGCCTAATACTGCAGGAGGGAGACAGAGAAATACAGACTTTGCC
AACTGAGTCAAGACTGCACACTATTAAAGCCCAGGTGGAGGCTAGTCTTGGCTGGCCAGT
GAACTTCTGGGTGTCGGAAGTGTGCTACATTAATGGCAGGATTCTCGCTAACACCAGTAG
AGTCCACCTCTGTGACTGGAGTTTGCTCTGGTACTCACTGCCACACACTCAGCTTTATAG
AGGAATGTCCGTCTGCACTGCCCACGTGGAATTGGGATGAGGGATGTGTGCTTAGCGTGT
GTGAGGCTCTCAACTCTACATGTTCTCACCTAGGGATCTACATCATAAATCTGAAGCGAA
CCTGGGAGAAGCTTCTGCTGGCAGCTCGAGCCATAGTGGCCATTGAAAATCCTGCCGACG
TCAGCGTCATATCCTCTAGGAACACTGGCCAGGTTTGTGAACCATGCTTGTTTTTATACA
AAGCTTTTTATTATTTCATTTCAGAAAGATTTTCCTTAGGGTAGGGACCCTAGTCCTCTC
CACATCTTTTAAGGGTCTTTGGCAACTTGAGAAATAGCTTGGGTTTTTAATGGTTAGCAA
GATATGTGGTTAAATCAGGTACGGATTGACTTGAGACTCCAATTTTTTTTTTTTTCCATT
TTATTTTGAATGTAGTAAAAATACAACAGAACAAAGGCAATCAAGACAATGTAGTGACAT
TGGTACAGAACTTCAAACCAAACAGAACATTGGGAAACCAATTGAAGGAGAATATTGAAT
AGAGCAAAACATAGCAGTGAAAACAATCTTTGCCTTCAAATAGAACATAGAAGGAAATCC
CCCATATTTGCTATATTGCATATGGTCATCCTCCCAAGAGATGCTCAGACCTCTGTCCCC
AGTTGCTGAGAGTGGGCAGGGGAAAGATGTTTAGTTCTCTCCACCAGCACAAGGGGCCCT
TATCAAGAGGGCGGGCAGATTGCCTTCTTGTGCAGCCAGATAAGTCCCAACATGGCTGGA
GACCCCCATTTTTAGCAAATTTAAAAATTAAATAGCAGCATTCTGCTGCTTCAGTGTTGA
GGAATGGTGTGTTTTGAGATATGACTTCACTGTTTTCACCAGACCAGTCTGAGATTACAG
GTGTGCAGAACCACACCTGGCTACTGTGAACATTTTTATAGGTTATTCCCCAGACTCAGC
ATTGTGAGGAGGTGCATTATGGAAGAAAGCTTTAATGTTGTGGAATGAGCTGAGTGACTA
CTTGTCTACCTCAGTGAAAATTAACAACTTTACTAGGTTGGAAAACACTTGGGATGAGGG
TGGGGAGAACATTTTATTTTAGTAGGTCGAAGGCATAGAGTTGGGGACAAGCAGGTACTT
GGTGATTAACCTAGAAGAAGAAAATAACTGGGGTTTGGGGTCCCGTGTCTGTTCTCCCCC
CCCTCCGCTTTTTTTCCTGTGTTACTGATTAAATTTAGGTCCTAAAGTATCCTGGTAAGC
ACTGCCTCTGAGCTACACCACCAGTCCCTGATGCTGTGAATGTTAATTTGAGGGTTTCAT
TTTTGAGAAAGAGGTATGAGCATTTCAGCTAGACAGAGTGCTTCAGTCTGTACAGAACTG
GGTGTCCGCACACTGTGTTCTTGTGAAATCACCCTTGGGGTGCTGCTAACTGTTTTCTAT
TTCAAAGCGGGCTGTGCTGAAGTTTGCCGCTGCCACTGGAGCAACTCCTATTGCTGGCCG
CTTCACTCCTGGGACCTTCACTAACCAGATCCAAGCAGCTTTCCGAGAGCCGCGTCTTCT
GGTGGTTACTGATCCCAGGGCAGACCACCAGCCCCTCACAGAGGCATCTTACGTCAATCT
GCCTACCATTGCTCTGTGTAACACAGATTCTCCACTGCGTTATGTGGACATTGCCATCCC
GTGCAACAATAAGGTAACCACTTCAAGATCTGGTTTGCTCTGGTTGCATCTTCAAGATGG
GTGCTCTGGAAAACTGAACATTTCTGTGCACATTGTTAGAGCTTGGAGTTGAGGCTGCTG
ACTGGCCTATGGACTCTCAAGTGTAGGTAGTGTGCTACACGAGGGGCAAGGTTTTCGCTA
ACACTCCATTCCAGCCCCGTGGGTGGAGCTTGATAGTAGTCCTTGCTACAGATTGAACAT
TAATATGGAGCAGCTTTGAGGAGAAAGAACTTTTGAATAATGGCCTGTGTTTTCTGGCAT
TACATGGCCATTCTGTTTACAGGCAACAAAATGTAATTCCAGAATGATAGGTTGTTGTGG
TTTGAATTAGTCTGCTCATTAACTGGTCTTAAAACTGGTGCAAATGAGAATTTGTCAGAT
AGGTTTTTGTTACTTTCACGACAGTGTACAGGGAACACTTGTACTCACTACTGTCTGAGG
TCACACTTAGGTGCATGGGGTACCATCCTGACACTTGTTTTTTGCTTTTCTAATCCCCGT
GATTTCAGTGTGCATACATTGAACTGTCTTGATTAGTAACGATTTTCTTTGTTAAAATCA
CTTTAAACATAGGGCTTCATTTGGTACCAGGGGTGCCATTCATTTGTGTGGGGTGGGTGA
GGCGGATAGGGCTGAGCTTACCGTTTCGAGCTGTCTGGTACTTATTAATGACAAGGCCCT
CTCCACAGGGAGCTCACTCAGTGGGTCTGATGTGGTGGATGCTAGCCCGGGAAGTGCTTC
GCATGCGTGGCACCATCTCCCGTGAACACCCATGGGAGGTCATGCCTGATCTCTACTTCT
ACAGGGACCCTGAAGAGGTATGCTTCCTCCATAGAAGGCCCATGCATAGCATGGGCAGGT
GGGGCACCTGAGTCTGCTTTTCAGAGGGGAAATTGTCCTTGTCACCTTGTTTTTTAAATC
ACCAGATTGAAAAGGAAGAACAGGCTGCTGCTGAAAAGGCAGTGACCAAGGAAGAATTTC
AGGGCGAATGGACTGCACCAGCTCCTGAGTTCACTGCTGCTCAGCCTGAGGTTGCAGACT
GGTCTGAAGGCGTGCAGGTGCCCTCGGTGCCCATCCAGCAGTTCCCTACTGGTATGTGTC
GAGACCAAGGGCTTTACCCTGAGATTTGCATCTTCATTGCTGGTGAAAGTGTCTGACAGG
CTGTGCAGCATGTGTGGCATAGATTGCTGCTGGAGTGGGATAATAAGGAACAGTGCTTTG
GGGTCAGCACTGATGGATTTTTTGGTCTTTCCTTAACAGAAGACTGGAGTGCTCAGCCGG
CCCACAGAAGAACTGGTCTGCAGCCCCCCACTGCGCAGGCCACTGAATGGGTAGGAACCA
CCACTGAGTGGTCTTGAGCTGTTCTGGAAACACTTCAGCAAAGTGGGAATAAAGTTGATA
AAAAATAAAACACCAGTTTCTAAAAGTCTGTTTGATTCTTTCCAGTTCAAAAAGACTACA
ATTTCTTACACCTCCATACTCCTACCATAGGCCACTATGGATCAGTGACAACTGCTTTTT
GCTTGAGGATTTTCTTGAGTTCTGAAAATTGATGTACACATGCATGAGTAGTAGTCCCAG
GGATGGTTTTTCCAAGGCCCCATAGTGGCAGTGGTTGCTATTTGCATTAATGTGGGGTCT
AGGCTATAGTTGGTTTTATGACAAGTCTTGCTGTTTGCTAGTGTGTGGCCACTGCTTGAG
TGATTTCTTGTATCTACATGCCTGCCTCAAGCCAAACTGGAACGTAGTCCTTTTCTTCCC
AGTGTTGATCTCCCATGTTTATAGTTGCTAGGAGAGTTTTTTGAATAGAATTTTCATCTA
CTACTGTGTCACAGTGATTTACTAGTGAAAGTACTGATAGCTCCCTCCTACGCTGATTTT
ATGACATTCATCGCCTATGAACAGAACTACAGGGTCTTGCTGCGAAGTAGTCCAGGCTGC
CCTCAAACCATGGAAAACTTTTGCCTTAGTCTCCCAAGTGCTGCAGTTACAGATGTGTGT
TACTATCTGTAGTCTCAGAAAAAATGGTTCTTGAGGGAACGTGAACATTCACATTGGTGA
TCGTGATGACCTCACTGACCACCTTCCCGATGTGAAGGGTCCTGTGCTGCTCAGCCACCT
TCCCTGCTCAGCAGCTGTCTTCAGTTTGGAAAACACAGGAAGAACCTTATGATTCTTGGG
GGCAGTGTTGGCATTTAAGATGCTGGGAAACAGGAAGGGGCCAGCAAGGTCACCCTGGAA
CTCTGCCCTGTGAGAACAAAGCTCATTTGTCAACAGGTGATGGCTGGAGAGAACACCCTG
TTACTTTACAGGGCAACTCTGCCTGGTAGTCACTGACCAGGTGTCTCTCTAACCATC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1133, 1833..1951, 3187..3432, 4148..4276, 4385..4550, 4719..4739, 4741..4749, 4751..4762, 4764..4816
1001..1133, 1833..1951, 3187..3432, 4148..4276, 4385..4550, 4719..4739, 4741..4749, 4751..4762, 4764..4813
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved