Cavia_porcellus Locus HSPA9B
snOPY snoRNA Orthological Gene Database
Cavia_porcellus HSPA9B
Cavia_porcellus
HSPA9B
GeneScaffold_2512
SNORD63
25139..25211
32482
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGCTAGTAACTACTTTATTCCATCATAACGT
CAGAGAAAGTATTTATATACTGAAGCTTAGCCTATGGACTGCTGCTGACGGAGTACCCTG
CAATTTTCACTGGAGACACTCTCTCCCCGAGAATGTCTTGCAGCTCTAGTTGATCACAGC
TTGAGAAGGGATGCCTATAGGCTTCTAGTTGTGTAGAGTGAAGGATTGTTTCTAAGCATT
TTACAACTCACGGAATAGCCCTTTCACAAAATACTTGCCTCAAATCTTCATGGAGGGAAG
CGTGCCTGTAGTCCCTGCTACTTGGAACACTGAGGCAGAAAGATCACAAGCTTGCTGTCA
GCCTAAGCAACATGGCAAGACTCCAAAAACTGGCTCAAGATTAGTAATGTCAAGGTTAAA
AAATACTGTTGTGATGTAAGAGAATTTTATATACTCAGTACTTACTTAATTTTGGTTCAT
TTGAAAAACATTTGCTTTTTCAGTTCCTGTTTTTCATTGACCGCTGGGTAGCAGAGCTAC
TCAGCGCAGCAAAACTCAGATTTTCATGTTTTCTTAAGAAAAATTGGGGCAGACCCAAAT
GTAATTGATGGCTAATGCAATTTTTTTTTTTCTTTTTTTAGGATGGCTGGAATGGCCTTA
GCCATGAGGCATTTAGATTTGTTTCTAGAAGAGGTTATGCGTAAGTATAACTTCATTTTC
TTTGACAGAATACCTACTAAACTCCAAAGTAGTGGTTTTTACATACACGATTAACAACTA
TTCCATTATAATGAGGTAATGTTACCACTGACATGCCCTATATCAAGTATTTTATGTATT
GCCTTCTATCCTTCTGGAGACCACTATTAAAGCGTTTAACCATGGCATTATTTTAAATGT
CTTACAGGTCAGAGGCAATCAAGGGTGCAGTTGTTGGTATTGATTTGGGTACTACTAACT
CCTGTGTAGCAGTAATGGAGGGTAAACAAGCAAAGGTAAGTATGATTGGAAGCGTTGAAT
CACTTAGGCAGACCTCATACCCAACCTGAATTATATGCATTTGAACTTAGTTAAGAGGTT
CTAAGGTCTGATTTTCATTTTAATAACTGCTCTTGATCTGAGTGTGATTGTATACATCTG
CTGGGAGTGTGAGGCATAAGTTTGAGCCCAGCCTGGGCAACAAAGTGATTTAAAAAGACC
ATATCTCAAGAAAGCCCTGGGGGGGGGCTGGGGATTTATTTTAGCTCAGCGGCAGAAGCA
CCTGCCTTGCAAGCAGGCGGTTGTGAGTTCGATCCCTGGTACCGATAAAAATTAAAAAAA
AGAAAGGCCTGGGGATATAGCTCAGAGTGGAGACCTTGAGTTTAGACCCCAAGAGCATGC
AAAGAAGGGAAATGCTTTTCTCCTGCCTCTGCCTCCCAGAATGCTGGAATTCACAGTACT
GTATAGGCATGCGTCACCATGCCTGTCCTGGTTTTGGTTTCTTGGGACTTGTGAAGTGAA
ACTGTTGATGATAGTGGTAACCTTGGGTTCACAAACAATTATAAGGTTCTGGTCATGAAC
TGAATTGGATGAGAAATAGTCAATTTTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTTTTC
CTTTTTATCGGTACCGGGGATCGAACTCACGACTGCCTGCTTGCAAGGCAGGCGCTTATG
CCGCTGAGCTAAACCCTCAGCCCCGAGAAATAGTCAAATTTAATGGTTAGGTTCAATGTT
GATCTTGATGAGAAATTTGATTTGTTTCTTGTCCAATTCAGTTTGCAACCAGCATTGTGG
AATTAAGTTTGTGGACCAAGGTACCACTATAATTGAATGGATTTGATATCCCATAGTATG
ACTTAAGTTTGTTCTCCTGGGATAGAGGTGAGACTTTTACAAGGACTTGGAATGTCTTGG
AGTATAATCAGAGTCTTGTAGTTTTTTATAAGTCACCTGAACCAGATGAGAAGTTCAGTT
CAGAAGCAAACAGAAGTCCACATCTAAGAGTTCTTTCTGGGTAAAGACTTATTCTGAAGC
CTTCTTACTCTACGTGAAACCTTTATTCCCTCTGGGTTTTTAGCAAGATTGAGAGCACCT
GGGGTTCTAGAATCTTGCTTCTTCCATTCATGAACATCTGTGCCTTCCCTTCCCTGATGC
TTCCCTCTACAATGACTTGAACTGTGTCCAAGACTGTTTTCTCATGTATTTGATATTAAC
AAGAAAATCCCTCCTTTAGCTCTATTTTATGCTTTCTGTCATTTTTTCAGTAAGCCTGAA
ATTTGTAGACACCACTAATTTTAAATTTTAATCTCCATGTGGAAGGAAATACTTTTTCCA
ACACTGAGTTAAAAAACCTGATCAATAGTTTTAGTCACAATGTTTTGTTACTGTGAATTG
TNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
TTCTTATTTGGATTCTGTTTAAACAGCTGCTAAAAAGATGCCACTGATTATGTGATCTTA
CTCTTTGTCTTATATTGGGAATTTTAGGTACTGGAGAATGCTGAAGGTGCCAGAACCACC
CCTTCTGTTGTTGCCTTTACAGCAGATGGGGAACGACTTGTTGGCATGCCAGCAAAGCGA
CAGGCTGTCACCAACCCTAACAATACTTTCTACGCCACCAAGCGCCTCATTGGCCGACGT
TACGATGACCCTGAAGTACAGAAAGACATGTGAGTCAATAGCAGAAAGTTCTTTATAAGG
GTCATCCAGAGCTTTTTTTTTTTTTTTTAAAGCACTTTTAACCGGGTCTTGGTTTAGTCA
TTTTATGTATTGACCCTGGGGGGGACCCATCCTCCTGCCAGAAGAGTAACTCCTTTTAAT
TTAAAGGAAAAGAAAAAAACTGTGCATGGTGGTTTGTGCCTATAATCCCAGCACTTGGGA
GGTTGAAGCAGGAAAGTAATAGGCCAGCCACGATCTACATAGTGAGACTTCTCCAAAAAA
ATCTCCCTAAAGGCTCGTTTTGTTTTCATATATTAGGTCTTTGCTATATGTTGATATGAT
GTATAAGGCTTGTGAAGCATTTCTGGACTTCGAAGTGCTGCATGAGTAAGACAAATAATA
GCAAACTTCCATCATACATAGGTATATAACACACAGAGAAAAGAATACTTAATTTTCCTG
AGATATATATATATATATAGCTCAGTGGCACAGCACCTGCCTGGCAAGCTTAATGTCCGG
GGTTTAATTCCCAGGACACACACACACACAAAGAATACTTGGTTTTCCTTTGTTTCATGT
TCTAAAACACTGGAAATAGGGCTGGTGATTGCAGCTGAGCAGTAGAGCACTCGCCTACAC
ATGCAAGGCCCTGGGTTCAATCCCCAGCACCACAAGAAATATATAAGCACAGCAAGCACA
GGTAGATTTTTTTCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTTGTTCATTTGTCAGTTG
ATGGACATTATGTTGCTATATCCATTCATATATGGATTTTTGTGTGAAGGTATTTTCATT
TCTCTCCTTCAGAGATAAATGCTGAGTTATATGGTAGTTTTCATTCTTAAAGGAACCTGC
AAGGCTGCTTGCAAAGTAGCTGCAAAATTGGTGGGAAATAATACTTAGAATTCAGTAGGA
TGATGTTTTTACACATTTGTGATTCTCTTGGCAGTGTCTCTGTAGGGTGGAGAATAGCCA
TTCATGATGTATGATAAGTTTGTTACAGTAGTTTGCATTGGCCAGTTTTCTCATAATTTT
TGTCTTTCAGTAAAAATGTTCCTTTTAAAATTGTCCGTGCCTCCAATGGTGATGCCTGGG
TTGAGGCTCATGGAAAACTCTATTCTCCAAGTCAGATTGGAGCATTTGTGTTGATGAAGA
TGAAAGAGACTGCAGGTGAGTGGATTTAGTTCAATTCTGGACAATTTCCTTTCATGCTAC
TAGCTCCATACCCTGCTCTTCTGTAGATGAGGTTGTGCTATCTTTCTTACAGTTACTCTA
GGAATAAGAAGTTTGTTAGTTTTCATATTTAACATGCAGATTGCATAACTTCAGATTTTC
TTAATGGTGCGTGGCTTGTTTATTTTTTGCAATATGGGGTAATGTTCTATATTGAAAGGC
AGACGCCTGCACATTAAACCTTTATCCATATTAAGCAAAACTTAGAACTTCCATTAAACT
AGTGGCTGTAGTCTAAAGGTTGTTGTGAATCTTCACAAAATGTAGAAGGTGAGATACTGA
CTTTTGAAAAAGTGTCTTTAGTTAGAATGTTTTTCTATAAGGTTTCTATGTGTTACTTGC
TAAGAAACTAATGGTTATTTCTATGACACTTTTAAGAGGATACCCAAGTTGTATGTTTCC
TATTTTATCTAGTATAATACTGTAATTGAATTGCATTCTTGATTCTTTTCCAGAAAATTA
CTTGGGACATACTGCAAAAAATGCTGTGATCACAGTCCCTGCTTATTTCAATGACTCACA
GAGACAGGTGAGGTCATTATCTTCCTTAGAAAATAAGAAATGGTGGTATACCAGGGATGT
AGCTCAACAGCACAGCGCTTGCCTGGCAAGCTTGAGGTTCTGAGTTCAATTCCCAGTATG
GGGGGAGGGTACCTGAGACATAAAGGTGAAAATGCTTTTGTCTTTGCTCTAGGCTACTAA
GGATGCTGGCCAGATATCTGGACTGAATGTGCTTCGGGTGATTAATGAACCAACAGCTGC
TGCTCTGGCCTATGGTCTGGATAAATCTGAAGACAAAATGTAAGTTTGTACAGAAAGTTC
TAAATGAATGTGTCAAAATAAGTTCATGCAACTCTGAGATTTTTTTTCCAGAGATTTATT
CTGAGTCATTTTTATATGGTACTGATTGGGCTTTCTACTCATATTATAAATATATGTTCT
AGGACCAAGGATATAGCACAGCACCTGCCTGGCAAGTGCAAGGTCCTGAGTTCAGTTCCT
GGTTCCATCACCTCACCCCTGCCCTTCCAAAAGTTCTAGACACTAAATAAAAATACATGT
TCTTTACCTTCTTCAGGACATTTTCAGTCATGCTTGTAGTAAACCAGCAGTCTGGAAGGA
TAAAGCAGATGAATTGCAAGTTGAGCCTGTTTAGTGACACCCTGTTTTATATTGTTCATA
TAGATGTATGTGTGTATATATATGTATATATATATAGTATTTTAATTCTGTCTTGAAGTA
GAAAAGAACTGGGGATGTCAGTGTAAAGGCCCTGGATTCAATCCCCAATACTGCTGTTGC
TGTGCCCCACGGCCCCCCCTCAAAAAAGACTACATTTAAGATCATCCCATCATGTACTTT
GAGACGTTGGTTCTGTTGCTACACATATTGGCAAATATTCCTTCAAAACATAGTTGAATG
TTGTCAGTTTTAAGAACCAAATTAATTTCAGGTCTGTGTACATACGTGTGTTACCTGTTA
GGGCTATTTATTAACAAATACATCANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAAATTCA
GAAAGGAGTATTTGAAGTGAAATCTACCAATGGAGACACCTTCTTAGGTGGTGAAGACTT
TGACCAAGCCTTGTTACGACACATTGTGAAGGAGTTCAAGAGAGAGGTTAGTAATCATTG
TGGTTAAATGTGTAGGAATTGGGATGTTGATGATTTTTGTTCAGATCATTGTTTGGTTTC
AAAACTTTGTTCTTAATTGAAAGTAAAATAAATTGAATTATAGGTTGATGAGTGAACTGC
GTTGGTTTTGGTAGCTTTAGATTGGGAATAAACATTTGAAATATATGGCACTCAGTGTAC
AATATTGGAAAGGCAATTTTAGGAATTCTTCTCACTTTTAATTAGAACTTTACAACTGGA
AAGAGCTGTCAGTTCAGTTGTCTGACTCCAAGCAGATAAATATGTTTTTAAAATAGGTTA
TGAAATAGTTTTGAGACAGGGTATCACTCTATTCTGGCTGGCTTTGAACTCAACTGTGTA
GTGTAGGCTAGCCTCAAATTCACATCAGTCCTCCTTTCTCAGCCTCCCAAGTACACCCCT
GGCTCCCCTATACATTTTTTTTTTCTTCCTTTTCTTTTTTTTTTTTTTCCCCTTTTTGGC
CCCTATAGACTTTCAAGAGTAATACAGTGTAGCTGATAATTGCTTATGAAAGTGTAGCTC
TATTTTGTATTCTGCCTTGTTACTGCAGTTTAAGTAGTACTCATCACCTGGCTGATCACC
GGTATTGTCTCTTTACTTTGTAGACAGGGGTTGATTTGACCAAAGACAACATGGCACTTC
AAAGGGTGCGGGAAGCAGCTGAGAAGGCCAAATGTGAACTCTCTTCATCTGTGCAGGTGA
GATGTTGAAAACTCCCAGCAGCCTTGATGAGTATTTTATTTTTAGCCTGAGTTTATTTGA
ATGGCCTATTCCTTTTAATTTTCTTGTTTAGTAAGAACCTGTGCCATGAGAGTTAGAGTG
ATGTAGTTATCAGTTCATTTTCAAACACCAAAATCAGAGGTTTTGATACTAGAGTCAGAT
GGTGAGATTTGAATGACAGGCTTGCGTGTATAAACAGTAGTAATAGTAATAGTGTATAAA
CCAATATGTGCAAGGCCCTTAGATTGATTTCCAGCACTCAAAAAAAATACTTAGTCGAGG
TGCTGGGGATCAACTTGGGCTTCATGTTGAACTATATACCCCTACCCTAAAGTGCTGATT
TAAAAACTTAGTCGAGGGCTAGAGATACAGCTCAGAGGCAGAAAGTTTACTTAGCATGTA
CAAGGCCCTGAGTGCAATCCTGTGTACCAAACAAGTCTAGGAATGCATAGAATTGGAATT
ACTAGCTTAGAATACTTACCTTCGCTTAATTGAATATACTTCTTTGTGAATCTCTTGACA
TGGCTGTTCATTTAATAATTTCAGTCACCAGTTTGAAACATGAGGTTTGGGAAGGTGAAC
ATTTAATACTTGTCAAACCAGAAGAGATACAGAATAGGGGTTAAGTATGTTATTTCTCAG
GGGCTGGAGGTAGGTAGCTCATCGGTAGTATGCGTGAAATCCCAGTTTCAATTCTTAGCA
CTGAGAAACAGATACTTCTGCAGGCAGATCACTAGGGTTCCTTATTTCAGCACTTAATGA
TCTGTGTTGTTTGCTGGGTTTTTGGTTTTGGGGTTTTTTTTTTTTTTTGGTCTTTTTGAT
ACAGGGTTTCTTTACGCAGTTCAAGTTCAGGCTGGCCATGTGTTCACTTTGTAGCCCAGG
CCGATCTTGAACTTACAATGATCCTCCAGCCTCAGCCTCTTGAGTACTAGGATTCTAGGC
ATGTGCCACCACACCCAGCTGATCTGTGTGGTCTTAGGAACTGTTCAACATCTGTGTTTT
CTTAGCTACAAAATAAGTAGTGTTTGTACCTTCCCTGTTGGAATTTTGATTGCTAGATTA
ATAATTTTTTAGGGAGGTATACAGCAAAAATATAAATTACTATTGGTGTAACAACTGATA
AAAAGAATTAGGTTTATAATCACAGGGAATCTGACAGGTATTTTTTACAACAAGGATACT
GGGTGGGGATTTAGCTCAGTGGCATAAGTGCCTGCGTTGCAAGTGTGAAGTCCTGAGTTC
AATCCCTGTTGCTGATTAAAAAAAAAGAATGTAACAAGGATACTTTGGGAATTGTCTAAT
ATTCTCAAGTCACACATTACCAGATCCCAACGTCATATCAGGATTTGGTATTTATTAAAT
GCCAAATGTTGCATGGTGGAGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNAGATGCC
ATGTCACTGAGCTATATCCCTGGCTCTTGACAGAATTCTTGTCAGGGAGGAAAAAAAACC
AATACACAATGTATTCTTAGGGAAGTTAGCTTATGTGGATAAATATTTGGCCCATTCTTC
AAGAGTGACTTAAAAGGATGGTGAGATTCTGTTCTCACTAGTTTTTAATTTTTTTAGTTA
AACGGTATAAGAAAAAGGGTTAAGGATGGTCACAGTATCTTTAAAGGCATTAGCAGAAGC
CAGGAATTTAGCTCAGTGGCATAAGTGCCTGCCTGAAAAGCGCGAGGTTGTGAGTTCGAT
CCCGATGCAAAGCAAAAAACATAAGCCTCTGTAGAGGCATTAGCAGAAAGAATCCTGAAC
TCAATGTTGTAAAATTTTAGGAATGGAAACAAAGCATGAGGTCAGAGATAATGTAAAATC
TCTGTACAAACACAGCCTAGTTCCTGTGATTTCTTTTTGCCTATCTTCAATAAAGATTTG
TGCAGTGATGCATTTTATTCAACACATCATTCTCAAAGTACAGAAGTGTGGAAAACTTAA
TGACTGAGCACAGACTTATTGAAGATGCAGTTCTTGGCAGCCTGAATAGAATTATCGTGT
TCCTGAGTGAGCTGCCTTAATATTTTTAGTTGTTCAATTAAAATATTTGGGAAAATGAGT
ACAGAATAAACCCATGATAAAAGGCTCTGGATCAAGAGGACAAATTATGTTAACAAATTA
TCCAGGATGCTAACTAGTAGGTTAGCACTAATAAATAGGATGGAAGAAAATACTTTATGG
TAGCCCAGTAGTACAGAATTACTTCTGCTACCTCATTTAAAGGCCTTTGTAAGTCTTCCT
ATTTAAAACCATTTAATGTGTGGAAAACAGGTAAGAAACTGAAACAAATGCTTTCCAAAT
TTAAAAAGGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCAGGTTCAGCAGACTGTACAGGATCTT
TTTGGCCGAGCTCCAAGTAAAGCTGTCAATCCTGATGAAGCTGTAGCCATTGGAGCTGCA
ATTCAGGGAGGTGTGTTGGCTGGTGATGTCACAGATGTGCTGCTCCTGGATGTCACTCCT
CTGTCCCTGGGTATTGAGACTCTGGGAGGTGTCTTTACCAAACTTATTAACAGGAATACC
ACTATTCCAACCAAGAAGAGCCAGGTAAGAGTACCATTCTTTCCAAGCTCATCACAGAAG
TATTAGGGTCTGCAAGAGGTGTGATTGCAGACATGTTGGCACTTTCTGCCTCTCATTAAA
AAGTCACTTCCACCAGCTATGGCCCATGCTGTAATCCTAGCACACAAGAGACTAAGAAAG
ACAGAAGGATAACCTCGAATTCTAAGTCAGCCTGAACTACATAGTGAGACCTTTTCTCAA
AAACAGAGTTACTTTATGTTTGTAGACTACACTTGTTGACTCTTGGTGGGTGAGAATCTT
GTCAGATTTTTTGATTTTTGGAAACAGGGTCTTGCTGTGTAGTTTAGGCTAGCCTTGAAC
TCACTATGTAGATGTAGCACAGGCTGATCCTGAACTCAAAGCAATCTTCCTACCTCAGTC
TCTCCAGTGCTGGGATTACAGGCATGTACTACTACAGCTGGTTGAGAAACTTGTCTTTTC
TTGTTGTTCCTAGAAGAGTTCTTATGTCTGCAGTGATGATTTTAGAGAAGACATGAATAG
TCTTGGCTTCTAAAAAGTCTCATTATTTGGTACCAGTTTTACTGCAGTCTTGGCTGAAAC
CATGGGACTGTGCCAATCTTCTGGGACATCATGAGGTTGTATAGGGCTAAGATACTAAGC
AGGGCTGTTTGGGCATGGTTTGGTCTTAGATTAGGAATTTAATGACCTTTTTAGTCTTGA
CATTTTTTTGAATATTAGCTGCAGTTGTGTTTGTGCAATGATGTATTTGTCAACACATCA
TTCTGAAAAAAAAATTATGTGATGACTTCTGTGACTGAGCACAAGATACATCTGCCACTG
ATCCTTGCTTTCCCAGATTACTGTGCTTCAACATTTTGGTTCCTTGTCTTGGTCCCTTTT
GTGCGTATGTTGCACCTTTGTACAGAGCATTTGCTTTGTTGAAACAACAGCTATTTTGTG
CATTTGCTATACTAATCCTATTCCTAGTCCCTTTAAAGACATAAGCCTTTGTTTTGAGCA
TAACATATATTAGGACCCTTCCAGTGTTACAATCTGAATGTTTTTCTGATTTGTTCTTCT
TTATAAGGAGAACAGTTTTAATCAGATTGCCAACACAGGAAGTTTTTTGTTTTTTGTTTT
TTTTTCTCTTCAGGTATTTTCTACTGCTGCTGATGGACAGACTCAAGTGGAGATTAAAGT
GTGTCAGGGTGAGAGAGAGATGGCTGGAGACAACAAGCTTCTTGGACAGTTTACTTTGGT
AGGTGTTGTGAACTTTAATATTGTTCCACATGCTCTTCATTAGACAGTATTCCAGTGCCT
ATAAATTGCTGGTATACATATCATACGTACCATGTTACTCCAGGAAATTATGCAGGTGAA
TTCTTCACTTTAGTAAGCTGCTATGCCTTGCTTTAGATTTCAAAAATTCTAATGCTAGAC
ATGCTAACTCTTTTCTTCTTCTGATAATCATTTGAGGTTTTGTTTTGTTTTGTACTNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTGCCAAGAATGGATTCAGTGTGGGTG
AGGCTGTCCGGGGCTCAAATGATCTTTCTGCTCTAGCTTCCAGGGCAACACAGCACCTGG
CATGAAATGTTTTTTGTTTAGTCTTCACATGTTTACAGACAACATCTCAAAGTTCTCCCA
TACTTTCTCAAACCAGTGATTTCTCACTTTCACTAATTTTACTTTGTACAAAAGATAGCT
CATGGTCTTGCTCAGCATGACCATTCAGCAAACTGATTAATGGCAGTCACTTATATTAAA
CTTCTAATTTTTCTAAGGAACGAGTTGAAGCAGTTAATATGGCTGAAGGAATAATTCATG
ACACTGAAACAAAGATGGAAGAGTTCAAGGACCAACTGCCTGCTGATGAGGTGAGTTTTA
ATTCAACTCAGGAAATTGAAAACTGAAATTCATTTTTATGTGAATCTTGACATAAGGATT
CAGGTTGTAAAACATTCTGAATATTATTGCTGCATGTAATGAGATAGAATTGGAAACATG
GAAATTTTTGTTTTGTTTTAAGTGTAACAAGCTAAAGGAAGAGATTTCCAAAATGAGGGA
GCTCCTGGCTCGAAAAGACAGTGAAACAGGAGAAAACATCAGACAGGCAGCCTCCTCTCT
CCAACAGGCATCACTGAAGCTCTTTGAAATGGCATATAAAAAGGTACAGGGCTGAAGGGT
GGGTTGGTCCTAATTTGATTTTTTGTTGTAACTGCTCCTAATTAATGTCACTAGTGGCTC
CTGCTCTTTCCATAATTATATGGAATTGAGAAATTATTAAGAGTTAGAAATACCATCATG
CTTTCTTGACTACTTTGAGCATGGGAAGTGTGTTCAAAAGAGAAGCCATCCCTTGAGCTG
GGCATGGTGGCTCACGCCTGTAATCCCAGCACTCGGAGGCTGAGGCAGGAGGATCACTGC
AAATTTGAGACCAGCACATGGGCTACAAAGTGAGCTCAAGGCCAGCCTGAACTGCATAGT
GAGATCGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1059, 1267..1354, 3327..3508, 6070..6194, 6713..6786, 6952..7058, 21183..21345, 21983..22075, 24343..24552, 27516..27743, 28873..28977, 29316..29433, 29534..29628, 31097..31189, 31342..31482
1001..1059, 1267..1354, 3327..3508, 6070..6194, 6713..6786, 6952..7058, 21183..21345, 21983..22075, 24343..24552, 27516..27743, 28873..28977, 29316..29433, 29534..29628, 31097..31189, 31342..31482
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved