Cavia_porcellus Locus TOMM20
snOPY snoRNA Orthological Gene Database
Cavia_porcellus TOMM20
Cavia_porcellus
TOMM20
GeneScaffold_2475
SNORA14
1601..1735
13315
GTGTGCAGGGTATATAGGAAAAGCATTTCATCTTATTGTGCAACCCTCGAATCTGAATT
CACTTTGGTGTATTTGTATCTCCTACTCCATTTGGGTTAGTGAACACAGTGCCTTTGGAC
TAATTTCCAGTATTACCAGGAGGAGCTCTGTATCATCATTACTTAGAGACTTTTCCTCAA
TTACATGTCCAAAGCACCGATGCTGTCATTTCAGACACCAAACTGCTTAGGTTAGGAGCA
CAGGCCTCTTCAAGGCTGTTTTTACCTCAGACTCCAGCTACAAATTTGGGAGGAGGCAGT
CCTTGTATCTGATGAGGTGGGCACACATTAGGAGTTTTCCATTACCTTCTTGGGTTATAT
AACCTCTGGACTCAGGGAAAAGTGCTGCTCTTAGGATTAGTTTCCATTTGAGTATGATAG
TACAAATGAGAATATTACAAGGGAAAAGGCAGGGTTTTTTTTCTTAAACTTCCTTTTAAA
GGTTATATATTTTTAGAGGAACAGGTGCGATNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNAGCCACAGTGAGGTAAAGCCCTGTATCAGGGGCTCTCCATCTTGATGTC
ACGAATAAGGTTCGCTGCTGCTCCCTGAGTTTAGCTTACCATTGCCAAGACACTCGCCGA
GATCAAAGAAAAGGCTTTACTGCAAAACCTCAGGGCGCATGCGATGTCAGCCGCGCCGCC
AGGGCGGCTCCCACGTGGCAACCCGAGCTCTCGCCACTGCGCTTCTGCGCAGGCACAGCC
GAGGACGCCCTATGGGCCTCGCGAGCCGGAAGTGCCCCTGCTAGTTCTTTCCGGTGCTTT
TTAGGGAGCTTCAGCTGCAGGCTGTACAATTGCTTTGTAGATTCGTGACCAACCGCTGCA
GTGCGGGCCCCCTGCGGCCGGCACGCTGAAGTCGAGAGGACATGGTGGGTCGGAACAGCG
CCATCGCCGCCGGCGTGTGCGGGGCCCTCTTTATCGGATACTGTATCTACTTCGACCGCA
AGAGGCGAAGTGATCCCAACTTCAAGAACAGACTTCGAGAACGTGAGTGGGTCCGCGCCT
CACCTTGGCGGTTGCTTTGCGTACAGCTGAGGAAGATATGGCGCCGTCGCGCGGCCCAGG
GGTCCTGGTCTGGGCCCTTCACAGGTTCCCTCCATTTTGAAGAAGGATCGGCCCCATTTT
GTGTTTCCCTCTCTGACTGTGTAGATTATCCTGACTTCTGTTGCTATTTGGGGTGGGAGC
AGCAGCCTAGGGCCTGCACTGAGGCACTGAGCTATACACCCCCACCTCTTTTGTATTTTT
AAGATAGCGCGCAATTATCCGGGCTGGGCACGAATTTTGGATCCGTCTGCCTCAGGCTCT
CAAAATGCTGGAATTACGGGCTTGCGCCACCTCGCCTAAGTGGTCTCTTTTTACGAAATT
CACCTTTTAAAGCTTCTGTTTTTCATCCAGGATTCGTGCTTTGTGTGTGTGACTGATATT
AGCGTCAGCCTAAATTCGCAAATTCAGATCCTTTGTTGATACTGCATTCTTAAACCCTCT
TGGCAGCTTCGCTCTGAGTGCTTCCAAGATATGAGTGAATGCTAGAGAAATTGCGGGGGA
GTCCAAAGGGCTGCGCTTGTCTTGTGGCTCAGTCTTATTTCATACCTGCGACATCTTTTA
AGAGAGGTTTACACCATAGAGAGAGATTCAGTCCCTTGAAACCATCGTGATCCGGGGATA
GCTTAATTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTTCGTGCTGGGGT
TATAAGCACAAGCCACAACGCCTGGCTAAATATTCGATAGCTGTATAAAATCAGATGACT
CCCACCTGCTCCTTGTTTCTGAAAAGAAATGTTTGGAGGTGCCCACCATAGTTCTATTAT
AAAGAAGTCTCAGGCCCTGGGGATTTGGCTCAGCGGCTTAAGCGCCTGCCTTGCAAGTGT
GCGGTCCTGAGTTCAATCCCCGGTACCTATAAAAGGGCCAAAAAAAAAAAAAAAAAAAAA
AAAGGTTCCAACGTAAACACTGATCAAATGTAATTATTGGAAGACAGATATCCTATACTG
TAGCTTCAAAAATGGATGAGTGTGTTGGATTCAAATGCAGAGCTCTAAGAATGGATTGGT
TTTTATGAAAACTTTAAGCAAGTGATTTCTGCCTAAAGAAATCATAAGCGTTACTATTTT
AGACAAACTGAGGAATGTTTTTGAAATCTTTTCCATGTTTTAAATTTTTTTTAAAAAAAA
TTTTTTTTCGTGCCAGGGATTGAATTCATGATTTTGCACTTGCCGGCAGGCGCTTGTGCC
GCTGAGCTAAATCCCTGGCCTCAAAAAATTTTTTCGGTCTTTTTGAGAAAGGGCTTCTAT
ATGCAGTTCAGGTTGGCCTTGAGCTTACTTTGTAGCCCAGGCTGGTCTCAAATTCGCTAC
ATGTCTCAGCCTCCTTAGTGAGCTACAGCGCCCCGGTAAAAAAAATTTTTTTAATCTTGG
TGAGAAGAATATAAGTGAATTACTATCTACACCAGTAACTTTAGACAGTTTCAAGCACTG
TTTTTCAGTTTTTTAGCAAAATGACCTTGTTATAGTACTGTCACTGACATATACTAATAG
ATGAGTGTAAGATTTCTTTCTATAAACAAAAGTTTGAAATAGTTGCTAGCAAGTAAAACT
TCCATTCAGAGTAATTTTGCAGTCTTTTCAAAGATAATTGTGTAAGTGGCTGGATTTGGG
CATTGTGTTTCTAGGATGTTTTGTTTCATTTTTTTAAAATTTTGAATTCTTAAGTGAATT
TCAAGTAGAATACATCACCAATAAAAAGGATTCTCAAAGCAGGCATTTGGATTATTGGCT
TTCTTGATTTTTTTTGAAAGATATTTGTTAAAAATAAGATTTGCTATTAGGTTTGGAATC
TTAATTTATTCAGACCTTTTATCTTCCATTAGAATTTTTTTGTGCTAAAAGTTGAACTCT
ATCTTGAGTACCTTAAGTGTGTGCTGTGCCACTGAGCTACATTTCAAATCTCCAGGGGAT
TTTGTTTTTGGTTTTTTGTGCTGAGGATTGAACCTAGGGCTTAGCATTGAGCCACATTGC
CATCCCCTTTTTGAATTTTTGAGAGCATCTCATTCAGTCTTCCAGTCTAGGCTCAAACTT
GTGATTGCTGGTCTCAGCCTTCTAGAGCATTGAGAATATAGGCATGTGCCACTACCCCTC
ACTTCCCAGTCCTTGTAAAAATTTTATTGTGTTTCTCCGGCTAGTCTCAAACTTGTGGTC
CTCCTGCTTTCATTCTTGAATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NTTCAGAGTAATTTTGCAGTCTTTTCAAAGATAATTGTGTAAGTGGCTGGATTTGGGCAT
TGTGTTTCTAGGATGTTTTGTTTCATTTTTTTAAAATTTTGAATTCTTAAGTGAATTTCA
AGTAGAATACATCACCAATAAAAAGGATTCTCAAAGCAGGCATTTGGATTATTGGCTTTC
TTGATTTTTTTTGAAAGATATTTGTTAAAAATAAGATTTGCTATTAGGTTTGGAATCTTA
ATTTATTCAGACCTTTTATCTTCCATTAGAATTTTTTTGTGCTAAAAGTTGAACTCTATC
TTGAGTACCTTAAGTGTGTGCTGTGCCACTGAGCTACATTTCAAATCTCCAGGGGATTTT
GTTTTTGGTTTTTTGTGCTGAGGATTGAACCTAGGGCTTAGCATTGAGCCACATTGCCAT
CCCCTTTTTGAATTTTTGAGAGCATCTCATTCAGTCTTCCAGTCTAGGCTCAAACTTGTG
ATTGCTGGTCTCAGCCTTCTAGAGCATTGAGAATATAGGCATGTGCCACTACCCCTCACT
TCCCAGTCCTTGTAAAAATTTTATTGTGTTTCTCCGGCTAGTCTCAAACTTGTGGTCCTC
CTGCTTTCATTCTTGAATATCTGGGATTATAGACATGTAGACATGTGCTATTGTACAGGC
TCCAGCTGTGTTTTTTTTGTTTTGTTTTGTTTTGTTTTGTTTTTGTGACAAGATCTTGTA
GTCTAGGCTAGCCTGGAACTTGCAGTGATCCTCCTGCCTCAGCCTCCTGAATGCTGGCAT
TACAGGTCTGTGCCACCATATCTTGTGCCTGTCAGGACTCTTAAAACAATCTAAATCTTT
TTAAATAGTGTCTCGGTTTGTTGTTTGGATTAGCCTTGAATTTACCATGTAGCTCAGACT
GCTTTGAATGGTGACCCTCCTACCAGTCACTGAGTTCTGGGATTACAGACATGTCCCACC
ATGCCCAACTTAATCTAAATCATTAAGTAAAATTTAAACTGAGCCTAGTGGTACAAGCCT
GTCCCAGCACTTGGAAGCTGATATGGGTGGATGGCACATTTAAGCCAACCCTAAATTTCA
TAAAACACCTTCTCTGGGGAAAAAAGCTCCAACTAGTGCCATGTACAGAAAAGTTTTATT
TATACAGTACTTTATAAATGATGCACCATTTGGCAATAAGTGTCNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNTTCTCGAATAGCAGTGACCTAATTCTTTCCCCTTTACACAT
CCTGTATAGGTTGGAAATGGAAACTTGTGCTTCTGAGGTTCAGCTGTTAGAACTATCTGC
ATCCTATGAATTGCTAGACCTATAGACCCAGAGGAATAGTAAAAGATTCTGACCAGAAAT
GTCACATTGGTAATAACTTGACTAGGACTACTCATGTAGTCTTGACAGCTTGCAAGAAGG
CCAGAGATCCTCGATTCTAGAGTTGGGAATGTTTTGCAAATAGAAATGACACCCACAGCA
ATTAGACTTTTTTTTTATTCTTGTTTTGGTAATGGCAGAATAAAAATATTACATTGCATT
TCTTGTAGGAAGAAAGAAACAGAAGCTTGCCAAGGAGAGAGCTGGGCTTTCCAAGGTAAT
ACTTAAGTTTGCTTTTTGTTCGGATTATGTTATAAAAATATTAACTACTTTAGATGCATA
TTTTGAGAAAGACAATTGATATTGAGACATTGACTTTCTGTTTAAAGTTACTGAAGATTA
TCCAGTCCTTGAGCATTTCCCCTTTATTGGCAGTAACAGCAAATAGCTTATTGTACAAAG
AGGCAGTAAAATGGTCTCCCAAAAACAATTACACCAAAAATGTTTGAAATACTTTTTACT
CAGCTGCTTCAAATGATAGAATGTAACATACTGATTTAGTTTTCTTTGCTCCAGCTCCTT
TCAAAGAACCACATACTACTCATTTCCAACTGATCAAAATTACTGGTACCTGTCTAATCC
AAATTTTACCTTGTAGTGCATAAATCTTTTTATTCATCTTTTGCCTTTTATAGGTCCTGT
GTTCATGGTTATTTTAGTGACTTCATAGGTTTATCTACTAGACAAAAAATGTTCTGTGAC
ATATGTAAGTAAATAAAACATTAACAATTGTGCATGCTACTTTCCTTCTTACTGAAATTA
GTCGTTTGGATTTCAGAGTATGGGTGAGACTTATCTGTAGTGGTTCTTTTACCTTAAAGC
TAGGAATAAATAAATAAATGTTACATTTTGTTATTTTGAAACAATTGAGCAGTGACATAA
CTAATTGAATAGATATGGTAACAGTAAAGTGAAACTGGGAGAAAACTACCTCGCTATAAT
ACATCCAAATGACCTAATAAATCCAAATGATCCTTCTGAGAGACAGTGTTTATTGTAAAC
TTTTCTTCCTAAGGATGTAGGAAAATAGAGACATCCGTAAGTGAGGTTTTTGGTTTTGTC
TTTTGGGTTTTTTTTTGGGGGGGGGGTTGTTTTGTTTTGTTTTTGTTTTGCTTTGTTTCA
TGGTGCTGGGGATGAAACCCGGGGCCTCCCACATACCATTGAACTACGTCCCCAGTCATT
TTAGATTCAGAAATATTATAAAAATTTTACGGTATGATAGGATAATCAGTGAAAGATGTC
TCTGCTTTCAGAAATTTATGGGCTTTTTTCACATATTAGATCATAAGAGTATGTATAAAA
ATCAAAAACTATAGAAGTCTTAGGTTTTAGTAGGGGCTTTTGAGACAGAGCCTTACATAT
GATAGCCCAGAATGGCTTCAAACAGCAATACAGATGTGTATTACCACTGANNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCAAAATAGTAACATAAGTGCAAATAAAGCT
GCTAATAGTTTGAAATAACAACTAAAAATAGCAGGGATCAGTATGTAATTCATATTACTT
GATGTTACATTTTAATTTTTAAATTTTTTTCATTGTAATCCAAATGAAATGTTGAATCAA
AAGAATAAATATAAATAAGTTGTTAAAAAAATAAATAAATTGTTTAAAAATCTACAAAAT
GTGAAAATAAAATAAAGTACATAGCTGGATGTTGTGGCACATTCCTATAGCTCCCAAGAT
TTGAAGCAGGAGGATTGTGAATTAAAGTCTAGCTCTGGATTATGTAGTGAGTTTAAGACT
GCCTTGGACACAGAATAAGGTCTTGTTTAAAAAAAAAGAAAGTAGTATACATGTGACATA
TTTTCTCCTTACACTTGATTCTCCACTTTCTAAGAACTATTCAGGTAATACCAGTCTGAT
CATTTAAAGTAGATATTAAACTTTTGTAGGTGTTGTGATCTGTTCAATAGAGTGAATTAT
TTTTTCTGATATTCTGTGTGTTGGTTATAGTTCTACAATAATTTTTCAAAACAGTCTGTA
AATATTTTGTTTCCAATTTAGTTACCTGACCTTAAAGATGCAGAAGCTGTTCAGAAATTT
TTCCTGGAAGAAATACAACTTGGTGAAGAGTTACTGGCTCAAGGTAATAGTCCTTATAGC
TAGATAGAATTCTTCACAGCGGTACATATTTATGATAAGGGGAGTTTCTTGTAGTCTGCT
TTTTAACATTCGGTAAACATTTCAAGGCAGGTTTTTGCACACTTAATAATGTGCAGATTA
TTTTATATACTACTGGCTCTAGAAAAAAATAGTCATTATGAATTTCTGTTTTCAGTGATG
TTTTTAAGTGAGTTTTAAGCTTACTTTATTATATAGATGGTGTAAGTAGTTTATACAAAT
GAAGACACTCAAGTAATTTGTGGTATATAACTGTAGTATAATACAACTAATAACTGAAGG
AATAAGAACTAAGACTGTATTTCTCAACTTTGCCATCAATCTTCAGGTTTTTTCCAGTAT
TTATAAGAAGAAATGGCTAATAATAGTGCCAGAGAACATTAATTCATCTAATCAAGGTCA
CACAGTGAGTTCATGACACCTCATTTCAGAACCAACCAGTTGTCACCGTAAGATTTAAGC
CTTAAGAGCTTCTGTCATAAAAAATGATGTCANNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNCACCACACCTTCATTAGTTGGCCTAACAGAAGACATGGGAGCTGA
TATGGCATGGCTTATTCACTAGGCATAAATGAGTCTGGACTCCTTCAGACCTTTGTTGTA
TAAGATTTCAGTCTGGTCCTGTTGAGGTGGGCTTAGAGTTTGGAGCTATTTGGCTACAAT
TCCAAACTCTTACTCAAAAGTACAAGGTACCATGTATAATATTTAAAAGATTAAAATATG
TATAACTTAAGAGTTAATTAACCAGGTATTGTGGCTCACACCTATAGTCCCAGCACTGGG
GAGGCCAAGATAGAAGATTTACAGTGAGTTTGAGCCCAACCTGAACTATATAGCAAGACT
ATCTCAGAAAACCCAAAAAAAAACACATAAAAAGTTAATTGAGTATTCTGTTCATTTTGA
GTTCTTTCAACAAGCCCAAATCAGCCTGCTTTTTGAAATAGTGTGTATATCATGTGTGTT
AATTTTGTAGGTTTGTGCAATTGAAAATTAGTAAAATGACTGGAAAATTTTTTGTGAAAT
TTTATGTTGTAACTTAATTTTTCTGGTCCTTGTATGTATTAGACAAGCATCCTACCACTG
AGAATAACCTTCAGAATAACTCAGCTAGTTTGAAAAAAGATCAGAAAATAAAAGCTCCAG
AGATCTGAGGAAAAACAACAAGTTGGAAAGCCAGTAGTCTAAATCTCTTAAAATTAGACT
AATGTGATTCTAGCCTATTGATATCAGAATCCTTTGTTGAGTGGTATATGCCATTTGAAG
GGTAGGCATCGGTAACAATGTTACTTGGGTAACTGGCTTATGTATAAAGAGGTTCATTAA
AGATCTGCCTCTTCTCAGTACTGCCACAGTAGTTACTGACTTTGCAACCCATGAACCTTT
AACAATAGCCTAACAGTGCTTTTGGAAAATTGACTTGTAAATGGTATATTCTGAAATGTG
TGAGTTCAGGATAAAACCTAAGTTTCTCTCTATGAAAACCACCTCCTTTAGTTCAGTTAA
TTTTGTTTACATTCTCTAGATATGTTTTGGGAATGCTAATTTCAGAATACAATATTCCTA
GGCTGGCATAGTGGCATATACCTCCCTGTGTGTAATTCCAGTTATTTGTGAAGTTGAGGC
AGGAGGATTGCAAGTTTAAGGCAAGCTGGGCAACTTAGTAGAGACTGTCTCAACAAACGG
GCTGGGAATATAGCTCTGTAATAGACCCCCTTGCCCTTGGGTTCAGTTCTCAGCACTGCA
AAAAGAAAAAAAATACTGTACCATGTTCCTTCTTCAGTGGCTTTGAGCCAAAAGATGGAA
TGGTAGAGCATAGAACAATTATTTTAAAAAGTCATTGCTATTCTTAGTTTGTGTGGGAAT
GATGTTTTAAATTCTTTTTAAGTTACATAATGATTAATACGTAGGATATTAAAATGTCAT
GCTTCTTTTGTTAATTTGAATTTTTGATATGGAACTGGTAGTATGATCATTTTTAGGTAA
TAATGTATAAAGTGTTAGTGTTTAAATGTCAGTATGGGTGAACTTTAGCAAAATTTGATT
CTTTGACTACAAAAGAGTTATATTAAACTTTGAATCCTGATTAATGCTTGTGATAATTTC
CAAATTTAAATTTTTATTTTATTTTTTTCAGAGAATTGTAAGTGCTCAGAGCTTGGCTGA
AGATGATGTGGAATGAAAAATCTCAACATAATAAAATCTCAAAAGATTTTAAAAATTCTT
AGCTTGGAAGTTGAACAACTGTGGGGAATAAGGGCATATATGCTTGTTTATGGACTGTCC
TACACTGAAATCTACCAAAGTTAGTGCTTACTTTGGGTAGATTCATTTGTCTTTTATTTA
TTTTTTCCCAGTGAAAGTGTATTTTAATAGAGAGCTTTTCATTTTATAAAAACACTATGA
GTTACCAAAATATGGATTTTGTTTATTCCTTAGACCTACAATTAAAATGTACATATATCA
TTAAAAAACGCAGTGCTTAGGCTTAAGAAATAGGCAAAAGGGCTGGGACTGTAGCTGAGT
ATACTTGTCTAACATGCATCAGGCCTTAGATTTGGCCCCAGCATCACAAAAAAGGAAAAC
AGTGCAACAGTGTAGGAGAGCCATGAATGTACATTTTTAAAGCTAGGCATTTTCTTATAA
ATGAGAGTTGGATAGACTTGATTGTATTTTTGAAAATATTAAAATGAAAGCTTCTTTCTT
TCCATTTACTCTTAAACATGTGGTATGCCGCTGTGCTGTACTAACAGCTCCACCTGTTTC
CTGTTTATCAGTCTTAAACAGTTTTATTTAAATCAGTGTACTTGGTGTTTCTGGGTATGT
ACTTGTATTTTAAGTACGTGTAACTACAAGTAGTACCGGGAATTAGATCGGTGTACCTAA
TCTCACCATATGAGCTTCACCAGTTGGAGTCTGCTCACTCTCAAGTCTAAAACCAGGGGA
TCACTTTTGGTAATTTTGAAGTGTCCCTTTCAGTTTCTCCTTTTGGTTCTGTTTGGCGTC
TTCAGATTCACCTTCACGAACCAGGGATATAGCACAGTGGCACCTCCCTGGCAAGCTCAA
GTTTGATTCCCGGTACCACAAAAAAATTTATCAGTTCACCTTCACCTGAGGAGTGTATTT
GGCCATCCAGAACTTGTTTTGTTTTGCTTTTTAATTCTGAATTTTGCATGCTTGCC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1121, 7748..7794, 9681..9762, 10392..10534, 12271..12315
1001..1121, 7748..7794, 9681..9762, 10392..10534, 12271..12312
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved