Cavia_porcellus Locus GNS
snOPY snoRNA Orthological Gene Database
Cavia_porcellus GNS
Cavia_porcellus
GNS
GeneScaffold_3355
SNORA1
35120..35252
39923
ctctgtgcaatttttaaaaatgcatacttttctactggcaaggaggtactgttggactg
agttgaggatataatttgacaatttacctcaccaggtatatttatcaatgaggaagcaag
acagacttgttccaaagctcctagtttcatttaatttttttcttagtttacttaataatg
tctttgagtggccacccttcagtgttttgtgtatgctcaagtgcacatcctccaacatct
aagaggcttctaaaaattcaccaaggaatgaatactgtatcaagaataaagccatcaaga
tatctgcaccaaaactgaaaccaagatgtcagctgaagaacataatcaggcttcggagtt
agagctgaattgaaatgcagcgccaaatgcaacagctgatacaaagaaaatactaagccc
tatcttctggcgttgagaaaactgaaaaagaccaaaagtaagggccctgaacgacggctc
cttaattcggaacttaagatgggtagagcccaggtgttatttgccaataggtcttatggt
ataggacaggtacactactcctgtcatttactttattgattagtgtttgctgactccccc
tgctttttttttttttttttttttcttcctgcttttcatttctttcctccagtttaaatt
ctctaacaagcgatcacaaacaggtcctaccagatcacagccctgttgtcttgccccttt
ccggcctcagtccagtttccctccagtctctttcccggcacggccccgcccgaagccccg
cccgaagccccgcccacgaccccgtcacgtgacgacgcggcgtgccctgcccactgcctc
gagttcacgtgatcgcgcgtggtgcgagagaacctgaccccagctgccggccttcacgcc
gcggtgttttcacgcggtagctcgtcggggcctggctcttcggtgatctgtgcgtcgctg
catcccctctgcttcgggttactccccgagcactgtcagccatgcggtttctcgctgtgg
ctccaggtgggccccggtggggcagtcaccgtcgcctgcccgcctgtagcccagcgccac
tgctcctcctgctgttgagcggctgcctggaggctccgggtctggcggctggctctcgga
ggcccaatgtggtgctcctcctcaccgacgatcaggacgcagtgcttggcggcatggtaa
ctcttctctttctgccccgcccctccactttcctggccgatttgctggcttctgactcgc
gtttgccgtttccccgcttgctccttctcccctaaccccagcagcctcgaccctgggtgg
gtttggttttgcctgcaactcaaggcccctttatgcaggtttgatgggcctaggactctt
gtttcgttttttgggatgattcatatgtaggcacagcactgtgcttttagtctggacgtt
acagcttgcaaaattttcgttcacatcttaaatatgtggacgccggttaaactgtgttga
accttcgaggaacaggtcctaaaaggagcgcacaagccttgattccttttcttttggatt
agaggatcagaggccaagttcagtttataaggacctagcccttctctgcatttgtggctg
tatataatgcttgtgcctggtatcaatataataagtgttaaaatgaactaatctggcagg
taagtcgttgagctattcagagtttttgtgccttgcaaaaatcaaaattcaattagtgta
attgaattcttggctgatgcattagacactgttagcggtccaaaagtattgtcatatgac
tattctttcccaagaatttattttactttaaagttatgggatttatgaccttcagaaagt
ttacccccaaatgccttgtggaagatgaaaaggaatttgtttgcctagcacacagactct
gaaatttttttttttttttttgtcttttttgagatggggtctcactacgcagttcaggct
ggccttgagctcactttgtagcccaggctggtctcaaactcgcgacgatcctcccacctc
agcctccccagtactgggattacaggcatgaaccactacgcccagcagactctgaactct
tgctgcaacacaaaaaccctgactggtctagtcctggatccagcctgttcctcatctttt
taaaaaacaatgctttagttctctttttttctttcagtggagtgctgagactatgaaaag
tctctggacaagaggttcctaattttttgtgtgtggtaacactagctcagtgtctcaaac
tactggttccagttatgtgaaatcaggtttgtgagtgactaccaacatttttgctcttct
gtggagtggaataaagtgaaaatctgtattttctctaatctgtattagagagaataaaga
tacactttatgttcataacataagatagtgtgtttcattttttgagacagggtctcacca
tgtatttcaagcaggccttgaactcactatttaaaccgcactggccgcaaactcttggca
gtcctcctgcctcagcctctcaagtgcagcgattacaggtgtgcgccaccacatgcaact
gagatagtatttatagccgatatttaatacatttttatcactattttattcctttcgcat
atgtctggtggccttttagtttctacccaatcatgttgatcgaatttttgacttactttc
gttcctagattttcctctattccaacatctacacttaccttcccgctcacaagactcaat
tcttgttgagtggttgtgtgtttatttgaggtttctttttagtatgttgatttgcttctt
taaattataatgaatttttttttttaaaaagatgtctgtactgaagaaagccaaaactga
atggagggaaaagtcaaacttaatgttctcaattcttaagaagatcctgactgacttttt
cagaatattctaccactaattgtcaaacacacctccaaagaggagacaggacaagaacag
tgtgtgagaacttagttggagccagcagaggaagaggtgtgttatagctgtgcttcagtc
atcacaggagctctctcctgaagatgctttccattatcctgaaaagggaactaaatttag
aggtggttaggaagtttggctaacattcatagcgctaggacaggccacacctgagtattt
tacccaggtttgttctcctgttctaaaataatggaataattctgacttatcagatgttat
tccacatactcctacccgtgtagtcacttagtccatagaacagaaattattcgggtgata
ttcaggggttcaggtggggtcaccagtgtctttaatatacatgtaagactttatcatttc
ttcattagtgtggagagagtgctctgaggtaaaagactacaaattactgctctagttggc
agagtcagcattagtcaacacccagaccaaggtcaatgaattacagccctcacatggttt
tgatgtaaggtgaaatatttgtcttctttgatacggtctttaagtagtggcaaaatttaa
tacttcactgcatttgtctcaggtatgatctgtgagacactgatcttatgtttttcccag
agaactctttttcttgactataaacataattatgcagtggacacgctgttcttcacagaa
gcacaagttctcctttttaaaatcattcatttgaggaagaaatgatatttggtcaaaacc
ataagcaaaaggaagagctattacgaaatagaagaataaatatgcccttgcttaaagcaa
aatgacttccatcattaaaagttagccttagaattgtgacagttgccaggcgtggtggct
catgcctgtaatcccagcatgcgggaggctgaggcaggaggatccttgctagttggagac
cagcctgggctacaaagtgagcccaagactagcctgaactgcatagcgggaccctgtctc
aaaaagacaaaaaaaaaaaaaaaaaaaaaaaagaattatgacagttatcaatacatggaa
ccaggaaagtaaatgacccattagtgttttatggaagaaattttgcttgggatcataaag
ttttcccatgcaagattgtaagattggctgcggcttaatgtctgtgtccttcactcatct
ggcctctgtccattcaagttagcgtggagtcctacagtttcagtaatgtagtttcttgct
gaggacttgtttgatgaagcacagattatggttattacttgtactactattggcaaggaa
tagaaactttttgttagatgaaaatcaaaattcctctgcagccttgcgtcacttggctct
gtcctattttctgatcttgcctttctctattttcttttctttttggactttctctaccac
actggctttgtctctgctcttggtacctcatcttcctctagcagcctctgttcttgtttt
ctttcagcctggaagcctcctcttccatatcttggcacaactgacctatctcaggactct
gggcagtagatttctctcctgaaagaggtctttcctgcccacctgtctaaaatagttcat
tcctcccaccaggtgcaatcacttcatcttggcttattttcttagcattccttactacct
gagatgattatctgtttacttgttaattgtttacatattgatcagtttgataactctcag
tcatgaccatgggctttttcccagcgtgcatctcattctcattttttctcttccagtgtc
tagtagtaacttcaatttttcatcaagccagtcttccatttaacttgctgttctttcccc
aagaatagcatctagtgatgttatggggaaacatggtgacattatgtctgaagattggca
caggttttctgcaattctagcactttctgggatcccattatggatttacttgtgaaatta
tcaaagcttatctttcgagtttataagattccctaggttttctattaatataaaggaatg
ggagaaagtaatctatatattgttgaaaatgaggctcttattattagtgtagtgatttat
ttagattgtcagtctttaaggaattaacacaaaatatatttaaactgttcaatatggtct
tagatttcaaaggtatttcagatcatcatgacttacctttcaatacaatgaaataagcct
ctataatggtagttttggctgtctggaatatgagcaatgattcttagttttcctattatt
tgtattgaaaacctttgtcctttgggatgaagttatgttctgtgtatttgtgagaacttt
acactttgaacaaaaaataaaaagatataaatgaagtaatttctgatggacttccatcct
gtcagaattcctatagtttcctgccacgtggttcaggtgctttaccgtgaggtaatgaag
gatctgatgccgggagcagagagttactagtgaaagagtatctgggttccaccactgagt
atgagatttgagagagtctttaaggctcagggacttgcctggctttcagaatctaagtgt
ggtcttctttcttaaagtgtgaacttctgcttctaatggtaaattcatacagagagagat
ctgccatgtctctctggagacagggctggtaacaaggaaagggcaccaagtttcattaca
ttagaattagcatcaaatatagtcctggtaatgcttccctcccagcttgcgttatgaact
cctatacttttccatacactacaactgacgataaccaaattcgtttggtttatgtccaga
atcataaccactctcttggaagttgcttaatgttgatagaggtgactatctgggaataaa
acgttgagtgacatataacaacataattttggtttgtatgttttaatttatcataagaag
ttgtataatggtgtttatgtctcttacagacaccattaaagaaaaccaaggctcttattg
gagagatggggatgactttttccagtgccgtaagttttgtaacaaatcttgtttgatttt
gtgtttaagtcctaagaagatacacactgttctgggaatttggcataatttttttggagg
tgtttttagttaaatgtctgatctaaaggacagactttaatgtgctataaattctttttt
ttttttgtctttttcctttttaccggtaccagggatcaaactcacgactgcctgcttcca
aggcaggcgcttatgctgctgagctaaatccccagcccctataaattcttttaattgaaa
tgttacttcctatcagttgaagattaattgtaggtattttctaagccagtttgtgctaca
actcagaatagagaattttatttaaaacctcactgaagtttgaaaatagattgtaaaaat
caagtaatatttatgctgggtaacttatctatggtaaaacctcatttatctccaatagcc
aactgagacaaaggtaatagcaaaatacagatgcagagatccaaaataaaatactagtga
cttaaaatcatgcatgtaacccagtaagtggaagtgtaggaatgaaaggtagcttcgtaa
cagaaaactcatggaatagtagcacagcgtatactgaagagcacagactctggaaccaga
ctgcctcattttgattatttttttctgtctgttttctactctgtgactttggctaagtta
atcgttctggctcttggtttctgcatttgtaaatgaagttaccaaaatctccatcaaggt
cgttgtaattaaatgagttgatgtatgtaatacataattatcagtactgaacctgaaata
aggcattgttgttaggaatgagacaggctttatgcttctcatttaatgttcagcactgtt
tagtcattgccgtaaatcttatggaaataagatataaaactattggtaaaacgtcaaaat
tattatgtccacctttttggattctctgcttagaaaatacaggaagattgttggaaaatt
ctttaatagaatttagcaacatagaaatgaaaaaaactgtcttccatgtaaaaagttaga
aaagtcagaaggagatgagaaaagatcataatagcaaaatacagactctaggaataactg
gtagtggccagaaatggttaagagctatgtatataaagttacagtacttcgtaataaaat
aaaaatacttgatatgtacacatgcaggtcattttctgtgggaatacaagcaaaatactc
taattcaaatcatagcaatacttttttagactcaagtgattctgtatttttgtttgtttt
tgttttttggacccagggccaaaaaaacatgctaagcatctgctgtgctactcatctaaa
ccccttaccttaaaataaaatattttttgcatagcagaagtcaaacctgtcaaggttgta
ttttcaaaggaagagactgcccaactaaaatattgtaagaatatactaaaagcagtatat
tagtggccataaaatcactgaaagaaaaagaattaggaattgttgatttaaaaattaaca
aaagtcagcagggcatggtgggtgcacttggaagacagaagcagaaggattgctctaaat
tcaaggccagccagactacatagttgaggacttgcttgaactacatagcaagatcttgtc
gccaaaaaaacagaagtcaaaggcaaaagtaaagcctttatattgtatttatttatgaag
tatttatattgtaataggaagtcaacagcccagaaggaaaaaaccaaaaatagaacaaac
cacatgaacagacttattattcacataaaggtagtcagtcagtttgcttgtggagaatgt
tcatcctcattagtatataaaaatgccatggctggggatatagcttataggcacaggtgc
ctgcctgcaagtgtgaggttgtgagtttgatcctcagtaccaaaaataaataaataaaaa
taccagtacaggttgaggcacatagctcagtagagcttatgggtatcatttacaagttac
tggttttaatcctcagcatcaaaaaactaaatccaacatgaaagtgtaaaaaatagtgtt
aagtctttcaaaggacagtatgtgattttagtataaatgtgtgcttgagtggtcagtcct
atccttccagtgttaacttttgtgaagtgacttggtgatttgtacaactatcatgactgg
gtaaaatggagaaagtttaatagtaggtaaactagataaatagataagaaatacacctgt
actccattagattgaagtagcatttttttaaatctttggttaagatcctgttccagccat
actgtgttccttgcatataaataccatttctttgctaagtgatactatgtgttggaattt
gtagaaagacaccaactgaaaagaaaatttattttctctatttgacttacctactttggt
gtctccactatgtggagttgtgaaattcatcatgtgtaaagaaaatctattctgtgagaa
actcaaggttcacagttatactgttaagtagcctcttttattctctttagaaatgatgag
aaatccatctgtctcatgtaacttactttctgctctttttttctctgtagtatgtgccaa
gtgctctttgctgccccagcagagccagtattctgacaggaaagtacccacataatcatc
atgttgttaacaacactttggagggaaactgcagtagcacatcgtggcagaagacccagg
agccaaatactttcccagcaatactgaggtccatgtgtggttaccaaactttttttgcag
ggaaatatttaaatgaggtatgttgcatggtctgttcattattcttgtaacagtgttttc
aatgggaattaatataattccagttgctttttctttactatcaattcgaggcatgttaaa
aggttcttaataatatatattttttttctaagctgcccactaaaagaacttacttacttg
agcatatttacatgcattagatactgtgtttttctgtttcatcatttatttaaaaattct
gtttaagaatgccagtcttccctttttggctcagaaattctgcttgtcatgtggctgtca
tggtgtctttgtttccatttcccctgtatcaggatccaagtaaaaaattttcgtcttagg
ctttttcctcagatttcatagcagtcatgccaagcctggtggcccacgcctgtaatccca
gcacttgtgaggctgaggcacaaagatcgatgcaaagttgagaccagcctgggctaaaaa
gtgagcttgcactgcatagcaagaccctatctcaagaagacccccgaccaaaaacaaaag
atttcttaaaagacttccctgaattttaacagttgaatgctttaagtttcctgacccaga
aggtgaaaacagagattatgatgaagggcaagtacccagagcctggggcaggcagctaag
ggaggggtgatgcctctttgtaacctgtcaggccaagtttcatgaccccaagtccaccac
attagaattagcttttagtcaaattccagggttattggaagtagcgtatttgagggtgct
tagacttaactcatacagttaaactggaaatgaagacagagaagatgtacattttcttac
atattttatctgtggtcactagcgttctcaatatctgatttgaattttccattctacccc
atcccccagtagttggggaaatatgcaacgttgtgggtttggaggacattcagtcagtta
ccaaatagtcatgaaaagtggaatgtgaaatacttggttatacagttgggactatgggtc
acaaagggaatgtatgcaactttgcgtggaaggtcatctgatgtagcgtaattttcaggg
attaaattctgccttaaatgagcagtattaaagctcgttgagaaaaggaggggacattct
gtggtctcttcactgacttatctcatcaggtaaattggtagatttcatcagaaggacaac
tgaaataataacccgatagtccatagtctgattattttggttgttactggccacaagttc
agttggactctgctgtaccaacatagctgatgatgtgtgataaaccacatggattttttt
tctgtagagggccaaatagtaaatgtcttagggttcacaggccatgcatctctaaagcag
ggtaaatactctgaaaacaaatgacagtgactatgttcagataaaattgtgagcactgaa
attttaatttcttgtaattgtcacacttcataaaatatttttcttttgattaattaaaaa
tttttaaaaagcccttagcatactgactgtacagaaccattggcaagtcagatttggttc
actagccatatattgccaattccagccaaagaagttggtgggattagagttcttttttaa
ttagcttgtgtgtttgggggaattgagcaaccattatgtttcaggcaatagtcctaagat
tctcagttgcttgttactgtcctggtcatgtctgaggtgttctaatgccctgcttgtctc
ttcagtatggatctctggatgcaggtggtctagaacatgttcctctgggctggagttact
ggtatgctttggtgagtcattactgatgatcatacacaatgctgcagatccaaagtgtgt
ttgatttctaatttattaccaacatacattttttgctttatcattaactgttttatttct
gtaaaagaaaatctgttgactggtgagtcactctctccagatgttttttctgtattatag
agggtttagcaatgtaatttactgttcttcctggtccatctgaggcttttaaactaggat
aaatgattgaaattgctaaaactgttagtcttaaataaagccctcatcaaaaaaatccgg
gtgagtattaatttgtaaatgccttttgtgtgccttatcactgtttagacatagtttagc
ccagcatgggtttagactttcgtattgtgtttagattttataacaaattttacttcctct
tttaaataggaaaagaattctaaatactataattataccctctccatcaatggaaaggca
cggaaacatggtgaaaactatagtgtggactacctgacagatgttctggtgagttgctgg
agctctatccttgcagatctggctcacatttaattgaagacttggcctagaaaacctctt
gtcttccttgtttgtattgtgtaatataaatgcacagtgatttaatctaactgccaaaga
atatttccagctgattaagaattcctgaggagttacatgtacatacattataaaagccag
actcagatctaatgttcttggaaaaaatccctttttcttaagactataaaaaatactttg
tacaggttttgctttataatgattcccagtcttgacctcagttttactaaaaagttaaga
cagcagcctaataggcctcatatgggtggagacataggaatatgggacttttttggattg
tgtgtgtaaaagaatgaagtcacatgaatttgggactctcctgaagtgttcttaatggac
atcttccatagaacatttatttactaaacagtttagcagctgttctaacagatagtgaag
caaagtgattctgtgaaaggtaaccttcttgtggcaagaggtttcaggtatgccttgtat
gtgtggacacgtacatttacccatttgttgcttccttagatgaaaatctgtttaaaaaaa
aaaaaggaaaggagtcacttagataacatttaagcagaatcctgaaggaggagaaggtat
gctatccaaatcaggggaaggagtgctgcagtggagggagtggtaacgcggggcccccgg
ttgaacaggcgtgtacctgtccagtgtttcagaaaccacaaagaagccagtaagactgga
ataaagtaggtaaatgggaagctgataggaaataattgctatcggtatctttggagttaa
tgctgggaataaatgaaggtgtaaatgaactagaaaatgaaagagaacatgcatgtagag
tgtttccatattcataaagtatgtcctgataagcagatgaagaatttaaattgatatgaa
atgaagccctgatgttggtatatttggggttttgttttgtttctggtgctgggactgaac
ctggagcctcatgcttgctgggtgctttaccactgagctacctcagtgtgtgggtttagt
attcatttagcctagctactttttggctagcataattgacatcttctgtgtattttcgta
aagttaagataacttcatccacctaatccactattcagagttctttgaggcatcaaagat
acatggtattccaagcttcattaatgtgaatactaaaatggccaaattatgatttttttc
catatggatgaaatagcaatttctaggtcatgtgaagttatcaggctagcagtttctttc
ttgtagtggtatgcatttctacttttttattgtctgaaaaacaaatgcattatttgaaca
gcatgcttgcatgtaaccatgaaatatgatcatgtgctaagatcagcagctaaaatgacc
ttctcctcaccagagggtgtttgtctattaagttctcaattatcaggtaggataggagat
gacagtcctttgttatgtgtcaggctaatgtctccttggacttcctggactacaaatcta
actttgagccattcttcatgatgatctccacgccagcccctcattcaccttggacagctg
cacctcaataccagaagactttccagaatgtttttgcaccaagaagcaagaatttcaaca
tccacggaatggtagcgttcccctaactcctgcatgaagccatatttggtataatgtaac
attcttgtcaggaagcctttgagccatgcagcaggttttctttcaagttcttttagagat
aatgctagagaaataagtcagagaaattatgttagtgtgaatgacaggatgaatttgctt
tactgatacagataaagttcttgccacacacccagcagctggagagtctgtgtggaatgg
taggggtaccatcttccccgaggacaggagtgtcactcaggctatcctggtaacctctgg
ctctcctccctcccagagcctgagctgagcccacagcagccttccctcagtaactgtcag
cagcctaagacttaggaagaaaagggctggcagtgcggtgtggttgaggagtgttgaata
gaaacactgagccagtacgtagaccacaattcaaaatcacaacaacccaaatacttgcct
cttgtgttggttaattttccctttctccgaggcttgcatagtaagtaatttcattatcct
cttattttccttttcaagacattgatccctgggaaaaatcctatcataccagtttcctaa
aacttcaggtccacatctagagagtccatatttaaataaaagctacctttttaacaacaa
aacaattcccatacaccattttttctgtttttctgttcacaaaacttaagccactatctc
caaaaccatgcttaacaggttacacttcccttggacaagctgttcaaagatgcctagttc
aaaggctgaaggtgctgcaatgtgtctataagacacaaaattaaattgcttgtaaaacgg
aagaaagagttgaagttggatccattactacagatttctgggtatgaaattaataagatg
cttaatgcccatattatccgtgtaaagtaagattccagtcttactttcatgttgtgtgcc
agaagagttaataaaagttgccatgaccaataagtttggaaacttttggttaaataagtc
actgtgctacagcacttctgagtcgtgtttgttttaacacgagttgatagtaaaatgata
tgttcgatagcatttctcaaacttaatactaaagaacaccttgaggaacataattttgga
gatagttgctcagagtttttttaatgagctctcagtggaaaaaataaatgctatatggga
aagcttttgttaaaaatatgacctctttaaatgggaaggaccttcctcatttggacttgg
aagttttaggaaactgatgtatgattttccctagagctctaaggtgatcagtattgtggg
gttggaaaatagagagcaatggaataatgatttattagccaaaacttaatgaaaggtaca
gttaacatttgtccattcatagttgcagtagacatgggatccacattagaaatttaatat
tatttaatattaaataatattaaatttaatattattttagctcagtgacagtgagtaaag
ctaaaatattattttagctcagtgacagctcattactcagtgacagtgagtaaagtccct
tattaatggtaacaaaggagcaaaggcattttatagttttgggagaggatagaaagctga
agaacaaatgataaattaagaactttctttttaaggaagatgggggaaaggagagaggat
ctggcattgctcatataggtttcagttcatttttattatctaggcatctagtaatttgac
ggtgatgacttgttcttaacattttttttttctcttaaaattttagaacaagcactggtt
aattaggcaagccaagacacctatgactaactcctcaatacagtatttagataatgcatt
taggaaaaggtaagagctactgctactttctcaaagtggttttaagaatagagaactaca
tcacacttgtcatcattgacacaaaagcagactgacaagtcagcggaagaggtgcgtggg
gcactgactgcctcaggagcaagtagtggcgcttttgcactcagatatatgaagcgaccc
agaaccgattaaatacatttttagggcttgttaaagaatattgctaagttgaaccagtgg
attgaaactttttttctcacatttatggaaaaggtcacctagtaagaaatcaacccatgt
atttgctttttctgtttattttctttcacagtatatttagtttagacccagaggtcagca
aacttttttctgtagggccagatataaagttagtaaatattgtaggctttcaggccaggt
gctgtctattgcaaccactcaattctgcttttgtagcataaaagggtgacagaacgtggc
tgtgttgcagtaaagcttcatcagaacagctcgcaggcaaatttggcacatgggccatag
ctaaccactaatttagaatgtttaacattgttgtagcacaggcctatgtgaatcaatccg
tagtaatctgtaccaaattgataacttttccttctgatctcttattgccagtagctgtgg
aaaataaagccaactggttgtagaaaacctagtttttttctttggaaaccttaactttgg
aatgagtgaattatgttctctaagtttctactcttgtggtggcgattctcaggaatagat
atttaggatttcagcctttggggtaattttgttgtttttctttggggaggattttgtttg
ccccttttttcaagatagtaatacctcagccagtgcctcaaaagttgtctttccaatctg
ttcacttccaggtggcaaactctgctctcagttgatgaccttgtggaaaaattgatcaag
agactggaatttaccggggagctcaacaacacctacatcttttttacctcagacaatggc
tatcacacaggtgagaggcagtctcaggtactcctgttacctttcaggaataaaagcagc
tgtggccggagttctagctcttgtacagctctgaacttgccagagggagggtcttgccat
cagaatgcttcttgccagaggattatgtcagtcccatatggagaaaccatttgctgaatt
atgtggtgttctaggagcaggagacgactgtattttaatggcaggctgtatggaagaagt
gaaaactaagctcagtgtcgaggaaaagtagagtttagtagggtagagatactctggaca
gaaaatccagtagagccaggtgtggtggtgtacacctgtaatctcagcactcgggaagct
gaggcaggaggattactgcaagtttgaggccagcctgggctatgcagtagaaccctgtct
caaaaaaaaaggtgatcttgtagaaaaaaaccttcctaagtcacagaattagtttttggg
gtatgtttgttttttccaaactagtaactgttccatgtccttgatttttgtcctttctac
ttggaccttctgtggttacaaatgccttcttctttgcctgtctataaattgaaaggaatg
tacctgaagcttctgatagaggagcagattgattaggcatttgatgtattattgtgaata
ttttaaaaattattttattagtgtatgtttgcaatatgtaatgtttacattcatcctagg
aagcagttacacatgctaacatgtcttaatcctatttattctccttccccttctctcctt
cctctgtctgtctctgatcccctttccccattttctttcttttttctttttagttcatgt
ttgcagcacataatgatcacattccttatgggtagttgggacctatatattctatgtttc
cttctgcctcctcttcccacattccatctcttggtccctttcctttttcaaaaggtctag
tatttgtttgtttttttatgggactgggtctcccttatatagctcagactggccttcagc
tcactagcctaggctggcttcaaattccaagcagttctgcctcagcttcctgagtactag
gatcacagatttgtgccaccacacccggctaaaaaacctatttttttaagcatttagtgt
caagattagtggagcagagtataggtaactcttataatcccacctagagtaagggacaaa
gaactctggagcccaggagtttgatggcagtctaggcaacatagtgagacgctttctcat
ttaagtaaatgcatacatacgaactgaaaaaggactgaggatgtaactcagagttggtac
agaggacctggattcagtccccagcaccacaaaaaaatgctaataaaataacctctgttt
tccagcatagattttcagctatatgtgctcactcttttgaattcctcattcattcttaca
tttttcttagtttttttttttcaaaaaggtttcaaaatgactaccacacatgtgattcag
ctcatcatttgattgtgcatctgactaattattatatatcgtgctctaaagttcacatac
actattcattttttggtctcctgagtttcacttgccactggtttactgggaattgtgagt
cttttgtcttttgtcttttagaacatcccacatgctgaatttggcagattcctgtcttat
gaggctgtctctgctcatatgtactcagcatttcctataggttggtagcaagacagactt
gacagaaattcctgtattcgggcacagatgtttcctcagcggcacctctttgcagatgcc
agcgttgattgatggctctggcggtttcagcctgatcccttcctatggacatttgccatt
gaagttcccactggtgattgttgccaaaatccattactctcaatagaagttgcaagatgt
caactctatgattctgtccttttgcatttacttgctggtctttcgttatcagttatttgg
atatgttaaaatacatttcgttcaggagtaacaggatatgtatttttgacccttttattt
gacagtatttggaagaactttattcagccatgatcaggttgagtacggtatagaaatttt
tatgtatttgtgtttcagtcctttttatgtatttttatgtatttgtgttttactcaattc
gtcctgttgtagaccagggaaacccttctcatttgttactgaaaaatcatcaactcatgg
gttttcatagcctgagaccccagcacatttaagatgttaagaaatgagaaatagtagaac
aaagaatttttagttctgatactgactaaatgaaacaaaatatgaaccacacgtttgtct
tggctccatctttaccttatgcattttgttttcaggacagttttctttgccaattgacaa
aagacaactgtatgagttcgatatcaaagttccactgctggtccgaggacctgggattaa
accaaatcagacaagcaaggtaagtgtggctgaagttggtactgtgtgcaggtaggcatc
tgcctgagaaaatgaggctgttcctcctaagagggctggttgggtgttcctcctgtgagg
atgaaggctgatcagtgtaagattttctgtgtttgtaagccttggaggtgattttttttt
ttccagctccctactacccactattaagtttgtttctcctaaatacatatgtcatatcag
catgcatgagctttgactatcttttagatagctctgtgttctagaacagtgattctcaac
atagtgtttatgaaaaccaccatctgaaagtaaaagagatatagtataggtttgggcatc
atctagaaaaaatctgattgacttccatggtgtggttaaggacccagcatctgcttttct
tcccttcttaagtttacagatgactctgagaggccccttggtttggcacccacttttctc
agggactgctcctcaggctttgctgtgtctgtgagtcccatcttggtaaaatgtaggttc
tcatttctgatcagccgaggtgatgtctgctgttgtgtgacctcccataggtataagcat
tagagatcctacactgaggatcgtttttctttcatcttccttttctttttgtgggatcct
tccttactaatatttttctctttccctggttcttgctctggagcaatcactatgtaacgc
attttcctgctcctgttttcatttggtttcagtgtcttttccacacctgatgcttatcac
ccagatttctagaggtggtgagcacctcaatctaaaacactctccttgagtactcagaag
acagtgataagctctgctcaatatgtcttcgctccttcttgatattcacaatttcattcc
atgttctatgaaatcagagaaaatgagcaaatacataatttaggctaaaaattgaaaaat
gaacatcaacatgggccagacttctgggtctattgggtattttgcctactttctcactgt
ctgcctttcacttcctaatataatgctgtcgttaaagtactattaaaattcttgcagaaa
gggaaactggccttcataactgtctttacaatttttcgtttgctcttaaagacctatatc
cctcaagctactcgcctcctgttacaaatgtcagtgctgtcctaacaagcctgctctttc
aaaggagacatgcaagtttggaaggtcattaaatcttacaagtgttgtattgaggtcggc
atttggagctgattgaggagaccatgccagcagtgtgtgcatttccaagaagtgggggca
ctgggaatgcgtgtgatcagtgcaccgaaggaggccaagtgagaatgcagtgaaatgtgt
cagccggctgcctgtgaagcaaactgttcttcttctctctagtgccatctaaatgtaaaa
tcagatgctgctttgtctgagcaatctaactgagacctgcttcttaggaagccattgcgg
tagtaactcacatttattattagtacgtggctggtggtggtctaagagtattacctgaat
cagtttgtttaatctttatgagatacactgttatccatcttacagaaactaaggtacaga
agttaactagtttgcctaaaattgtgtagataaaaagtatgagagccctacatttgaatg
taggcagtctggctccagagcccatacacttaaccattacactgtagttcattcaccatg
tatctgtaaagtgtcttctgctggcagagtacaccaggaaccttggatgcagcagaggag
agagcctggtccggtagcagcaggagcagcaagtgaaagcctctaaagcatttgtgcaca
gatgtggctgttgagaaggatgtagtgacaaaatgtttgcagaaagagtgctctgagcgg
agcagtaaacatgaaggcacagacagaataagctaggcttgttcgattgacagaaagtag
catttgtactgaactgcttttcttcagtgcaccatctctctcactccttatgtctgtgat
tcctacctcagaccctctgcctggccagttgcttttcctttaggactttagtttaagcat
ccttccctggaagtcactttggaccctttcctctgcatgaggtcagtccccttcctacat
gtttccagctggcctctctctcttgagtttgtttactgtgatgtcccaggaaagaggaac
tatctagacttagaatacataacccttaacctacctgctcagtgggccatccacaccagg
ttgagtggattttaccaaaaggtcatacagtaaatggcagagcagactgagagtgcaccg
tgcctgttctcataactcatgcttgtcatactgctgcgctaacaggtttagctggggatg
tgcaaaatgcttcagccaggggtacctgtcacgtgttggcagtcacgtcagtgccaggtg
tcctgtgtgagtgacatagggttgcatgtttagcagaatgagctgaaccatcaacagcct
gacagccaaagcagtgcacatttgactaacccatcgacttcgctgtgcgtcagctgttgg
ggagctggagcaggtgctgtatggatgccaaaggctgaccaaagttttcttccctgacca
gttactaatctagctctatatttggcagcaaaaattcttaaaagaatttttagagaggaa
aacattaataggaaaactagaatggcagaacatggcccagggaaaatagaactgaattgg
agtcaggaagactgcttcacttaagactttgaacaaaatagcctttgctttccctagttg
tgctcttgagacatctcacctgcattcctgagtagaactggatgatcccttgcttcactg
tggaagctggagctagggcacatccaggtggagcagcccaggatttggtgggtcctctgc
cttctcacacatgtatggtccctttcaccggtgagcctagggcaccttctggtgtgcttt
aaggcttttctccaataactcttcatgaattgtttagcatcagagcttaagtgtcttttt
tgaaacctgatgtattctcctgagagcctgttgccttcttttcagtaattatgaggcacc
atcatttttctagagctaaaaataagcaagttcaacacttggtattccttgctttcatga
cccatggttttctaggggtatttatttcatttaaatgtctgtgtgcttgcatccttaagt
acattttcaaactgagagactgtgatatatggaatgatttgttttggtcttatgaaagct
ttttctgtttccaatctaagtgtgataaaaagcagtgtcattctaggaacttgaaactct
ggtgttccatgttgtccatagaatctgttctaatgcttagttgtataaaactagaagcag
gtataattgtctcttgaattctttattcctactgtgtccagaagaaaccggccatctcct
gatatagtgtgcacattttgagactgcttctaaggcagaaccctagaagacagtttatcc
gtcatgttttgggaagatgcagtaagtggagacgtctaggaaaaagaatactgggatgac
agacttagggcatttgtgccagatcttagtgactctttatgctgaaattcacaggtcttt
ccattgcgcaaaacattaataaagtctcccatcttatagctgccggctgttgaagtgatt
atttttgagattagcaaccactgtctctctggttttattattttggtgtttaaccttttc
cttgtaaatctgtcttggacatgttaatagtgacttcctactcttcatgctacggataga
ctttgtcttctttcctgttgtgatcttctgcatatgcacatgcagacagcagtggtgtag
caggctgtttagtttgcctggaggattggaactaggacagttatctgtaacagtagatct
gtgtaatccctggagacgtagtgtggtgagtctttttcccagtgacatatggatcgcctc
tcttgattgtctactgtagaatgcagtttctgacagctgtggaagtatactatcgattca
gacccaggatatgtatttatcactggccctctgggagtcatcctggccatcaggaaactt
gacccttgatgaacaatgctccaaagatgttttgtatttcatgtctgtacttttggtttt
gttttttaaattaaaagtggcaggtttagttgtttgtttgttagtttttcctgacttcac
tgtcaccttaagtttcctcagcagctttgaagactattatttctttttaatgaaagtttt
tccatttataagctcttcattttgttttacttcttttgtttcttcatctgtaaaatgggg
ggagagttgcatcctgagattgtggtaagaaataaataagaaaaagttatttatcaggca
aagaccaaaaccaaagtaaactgtaattaattttttattaaattattcagacttgttcat
taaatctgacttcctatggactctcagcactaaaaagcttcagagattgaataatacttc
tactactgagaataaccagcacattttatatttttcaaagtgacagcactgctaaattaa
gcttaagattaatcttttattaaattaattaatcttaaatttaagcttaagattaatctt
ttattaaattaatcttaagattaatcttacctgctgaaatagtagtatttttatgtattg
agttactgtatataccatcaatttcatctgtttttattttgatgtgaataacagatattt
ttaaattacgtatgtggccgtattaatactgagctttatgccagcttaggccctattaca
agcattgtacacaaaagattcatataaacaaaaaaaaaaggatataaatacaaaacatgc
tctttaaattctgcagtgcttatttcccctttaaggaaacttgttttgtttttgacacag
ggtctcactgtgtagcacaaactggccctgaactcgccagtgagtgccagaattataggc
atgtaccaccatgcctgacttctttaaggaaacttttgttgatgtattgttaaaataagt
ttcccggagtcttaaccctattgcaaacattttttagcagtgttgtcactttgaaaaact
gtaaaatgtgctgtttattctcagtagtagcaagtattaagtctgggaagctttttaaag
tgctgggagtccaaaggaagtcagatttaatgaacaaaacctgagtaatcaagtgggaaa
acactacctaacctaacacttttctcatgcttcccaacaaggccattccacaggagtttt
ttaacatacataagtgccttgattcatgatcttaattccgtgattctggaaaagagggcc
acgtttgtatttgtgcagaaaagatggcctcagtagtgtctgtatctcatccagtgcaga
atttacaaacagaaacaaaattttgccaaaggtttctctttatgaaaaattgttcccaaa
taaaagtgtttgaggactgaggtactgatttattctcatcaataattgtctctgcagaat
aaaagtagatgtcacaggagcttctagtagaagccctgttttaagttttatttaaatata
tgaaagtaacattaaagaatggctgtacatatggaaatagtgactgctgtttgtctcaag
tggttcgggcaagggagcattgatataggtaagaaaggaaaagtgtgccagttttttact
ttttcctcattttcatagatgcttgttgccaacattgacttgggtcctactattttggac
attgctggctataacgtgaataagacacagatggatggaatgtccttactgcccattttg
gtgagtatagagccctcaaccaatcctgaactaaaactctgaaataaatttcaggtgtgt
aaagactaaaagactaaattttaaagctattaaatttgaacagcagagaacagaattttt
ctctgattttatggtaggatggagttttctaaagaaaaggagtgattggaacacatgcaa
actcttctgtacattcctcttcccctctgtgtccctaaggagtgatggtgatcctcgtag
agctttcagtgttaacaaatagcccactacagcatgaatgccataggtttgccaccacag
ccctagaaaaaccaccataaagttaagtgacaaacagagaaaatatttgcaatatggaaa
aaggataattaatacgagttgttagaaaaagaattgatatacaattagaaaactagaccc
cccccaaaagtgaattagaatctcacaagggaattagaaatggccaaagtaaatgcaaaa
aattacttcagagaaagttggtcaaagaaaggcttgactgaaggaggctgtgtcacatgc
aaactggcaaagacaaaaaataaaaatacccaaaaaataaaaacaaccagtatttacata
acttggaaaaattagcaattattcatattatatacacagaaatgtatgcaatataatcta
tcagaaggctagtttaacaagatgtaccctttcagaatacagtacacacagctaacagtt
tcatctgaataatcatacagaggaaacaaacccattcaagaggtattagagtacctacta
tgcccgaccctacacagttatgtatggaaaagtacctgcaaattaaggaagaaattaaaa
acctaaatacccactacagaattggttcagctgcacacagttaaacttagaatgttaaac
caatgctgatggtgtagctgtgaacacactgacttgggaagatgcctgccgtggggagag
aaggatgattcacagcagcacctcgtccccactaaaagtgtatgtgactgtgttcaggca
cagtttgggaggtgctaagcaccaaactggcttagtcatctgtggtggctcttctgagtt
atagcatgatacgtgacttactcattgatctgtctgattctgttgtggttttattaggca
atggattcttcatacaagagaagtgagtcacataaattataaaacacaagaaaaatccat
gaatcaacctccccaccgagaagaaatgttaccaggctggggatgtggctgagtggcaga
gcactcatctagcatgtgcaaggccttgtgttcaacctctagcatcacaaaatagaacaa
caccctcagtgttatcagtcctgatgctcctctgcatcccatcccttgcctgcaccacag
ggtcaatgccatagctcttctttctttgtcagattatcatgtaggtctcccaagaagtct
tagttagttgggtcaacctaccaagcttgggtcttgttttgagctctaaaaatgatactg
tactggatgtaatttgtttccaagatcaatccatatttttgttcataggaatcaaactca
ggacctcacacttgccaggcaggctctgtgctgctgagctatagccccagcccctaagat
caatccgtgttctctgctgcctaatattccattgtttaaatgcagcacaactttgtttta
tgtcagtcactgggcatttctggtattctaattttattacacaaagtcatagcattcttg
gatgtgtctctccatgaccttctgtaggcactaaggatacaggaactgcatgtgtttaag
tctataaatattactatgtggttttccaaaataatcagtttacattgccactatgtatga
gaatttctttagctctgtatgaaattgtcagacttgtcactctagtgcatgaaaaatgat
gtttgacctcactgtgcattcgttagtgagatgagtcattgctaatagtttaattgccat
acagttcactagtttaaaatatacattcatagtttttggtgtgtccacagagttttcaac
catcaccatcatctaatttcagaacttcctgttattccagccacatcatcagtcactccc
tctttgctctctggcccatcccacagcatctgctcttcagctttgtgtctacatttgtct
gtccagtgtccatttttaagttgctttaatagtaacttttcatctattgcttttgtgttt
cttcccttgtgaaatccctctgtatttttacctatcatattctatttttggcttgtcctt
ttcctatgacagagaacacaggacttgaatgtatgtgtgattgctttaatgattagtgtt
aaagccacatgcagtgatacagatctgtaatcccagctattggatttgtagctcagtggg
gagcactcttggttttgatcctcagcaccaccaaaaaaaactattaaactttgaagttaa
agttactgtctgcagagagggtggggtgaaaggtcacagcgcagcgcctgggctggggtg
gcaggcagcgggggagtgccccatgtgcacgtgtggagaagcggtggtacccgtgcacca
acagtacgcgtctccaccctctctctacagtcctgggcttttgcagcctccatcaccccc
tcactccctgctctaggcgaggagactgccttgggttgagtgactcgagtggagggtgca
gagagctcagagcagcacaacagcattgagcgtggtagtaaccacagcttctgcagatgg
ggaagatgagctcagagatgtagcaccacccagtgtcacacagttgtagaggttaaacca
gatcatcttcccagtgagctctagtgacaagttctacaaggatatgctggaagttggtga
actagcaacacttgcctatttcagtgacacggctgtagggtgcagtgtgcttagggtgaa
tcattcacagaaccagaagagactttacatcatgacagtaggtgccttgaaccttaccaa
aggctgggacaagaactaaaatgttaaatcatgtcttaaatatctgtgagaaagatggca
ctttcaataacatctatctgcatgtccagcaattgacctctaaaaagtttggcttagaga
ttattgtgacaaagaaccaccattagaagaagttagaacctgctgatgctcacgtgcttc
agaaaaaccttgaagtcgcttctggtcagattgcagatgcacaaaagacagataactgaa
caaattgtaaatgaactttcttgcacttgctgtggccacatataaagagaggcctcctaa
tcccctcccctcttcgttaagcactcttaccttgttctcggtcccccctcccacagcttc
cttttcctttaaattattaaaagttttaataatttcagggactttttaaaataatcatgt
ttggatcatttcagttctcatttttgtgaggtagttggattgaaggaagaagatctgttt
catagttaagatgtataacctaaaaacgaggtgtcagatgatctcagatttttaaacttt
ttttaaaatgtccttctttcacattgaagggcagagcctacaaatactgcttatttcaag
agataaaaagatgcagcagaaatctcttttctatacttcatagacaaatctggtgaattt
gtggtacttgagtttttaaagactgcggtatcagggctttagctcagcggcataagtgct
tgcttggccaatgcaagatggcaagttcaatcctcggtaccaaaaaaaaaaaaaaaaaaa
gactatttttgatatacttagctctagacattgccttcactctacctttcgtcctactga
gcactctcagaatttggactattgttatccttgtgagaaatactaagcttatttaggttt
ttaaagtaattgatttttctgttcttgctgataggtggggaagctgggtaggtagcgtta
aacactggtctaagaatttgagttaacctccttttttgttaatgagtggactggttgtca
caggtttgtttttcctgctgctgttactagaggcactaacatttagagtgtgagctggtg
aaattcaaaatttttaataccccagctagagataatagcctttaattgacctaaagaagt
ttattgtggtttagttttttcttctgtcctatttcttcagtaagcccaacagtatcatag
tgagtctaacgttagaagtggagttgaggggctggggatttagctcagcggcataagcac
ctgccttgcaagcaggcagtcgtgagttcgatccctggtaccaataaaaaagaaaagaca
aaaaaacaaaaaacaaagaagtggagttgatggccggggatttaattcagtggcataaac
gcctacttggcaagctcgaggtcatgagttcaatccccattaccaccaaaaaaaaaaaag
aaaaaagaaaaaaatggagttgatgtctttacagattaattcctaaataaacctgaagta
ggtggggttttttttttttgacatattttaagatacataaaggaaatcttagatgaactt
gtggcacaacaaatgcacttaatgtcaactaatacaggctgttaaaaacgttgccagtga
gtgtttgattatataggaaagaatatctaggctggaggccttagctcaacggcattaagt
gcctgcttggcaaatgtgacttcgtgagttcaatccccagcaccaaaaaggaatatctag
acagtattttttgagaatacatagttatactcttttacctgttgaagactatctcagatt
tgcttatactttgtgcctacaatttgattttaaggatttgggatttttaaaaaaaaggat
ttgggataagaggaattaatgaaaaaactccttctgttcttgggaaggtagaagcataaa
gtgctaatagtacaaacatcactgtgacctcctgccgacaggattggtttcatactagat
cattatctaacaaatagggagggttcagacaggttgatagcttgatgagatgtctgaaat
attcatgctttcctcccattgtgcaatcttgatacttgcaattttttagattgtcagtgg
tgactcaagacacattcttcatagacttaaaagcaatgcacaaagctttagttttctgtc
atttgactttaaaaggaagtttggtttgtaatgtttatcctcatatgtaaaagtctcatc
tccaaataagcaaaattactttatagaatgtttgtatacattttataaccttaaggtttc
atttggaaatgtgaaaataacaaagtaaaataaacttcagcagtctcaagtgccagaaaa
gttttgtaaagaaacatggttgatgaatgagtctgtagggttctactgttagtgaaaatg
tagagaccatgctggttggtctttgttatcagttgcttaatctgaatccaagtttagaag
aaatactgaacattaggcacctttacctaccttcagggataaatttcagcttgctcttgc
caagcaaagagtgcttcagttacagaaagtgtaattaccatgaagaattcagcctttttg
taaacttccagatatcaaaatagattttgatatataaatgaattttctgagaccacatgg
cttctatttctataactatttcacctgggccatccaagcggccctgtgaatgtatcctaa
atatagttattaaaaaccaaatagctacctcccaattaagtacatgttatttaaagacag
aagaaaaatattcaagtttgaaatgagtagacttcttgttgtttttagagtttctttttt
ccacactactaaatgacttaatctgtattcttagtgtttgtaaaggtttgtcctccatcc
agctggtgttaaataattccacccagttacagaaggtgtagatactgagcattggttcat
atgtctttgagccaatgaagactgatgtccattgtttagttggttattttgacaaatggt
aaaaatagtcttgagatgaatcagtaattctgttaactacaagaccatagggtaggggct
ggggatttagctcagcagcataagcacctgccttgcaagcaggcagtcgtgagttcgatc
cctggtaccgataaaaacgaaaaaagacaaaaaaaaaaaagaccatagggtatatccatc
atactttccaagggagatggttttcactgtggggaaaatagattaaaattttaccatgtg
ataagttgtatatagatctgtaaaacaatctgtagatctgtacaatatataatttgtcca
aattagttgtcatttgtgggtaagagttctaaaatatctccaaagcagttttctcatcag
ttgaaaagtccttcagaaagagaactatcaggaaaccatggtttgtggtagtagaaaaga
aaagctccctcagtttttggaggcaacaacttttaaagatatttaggtgaggggctgggg
gtttagctcagcggcataagcacctgcctggcaatcaggtggtcgtgagttcgatccctg
gtaccgataaaagtgaaaaagacaaaaaaaaaagatatttaggtgattacatttacttgg
tgcagttaaaaattaaattttttaagtttaacattacagttgcatctgaaataaacttat
gtgatgttctggttttttttaagttactcttagatttttttcccaaaatatgttgagatt
cggcctgtcaaacattccaggctttgatatatccagaactgattttcttatatggtttga
gtcatagttcgaattctgttgtttttcctccataggtagttgtttctgttgtatagctct
atcctggtaccagtatccttttgttttttagagctgtataattattcgtgtaggtgcttc
tttctgcttatttttaacaggaccctagccacctgtgtaagtaaacttctaatccgcttt
tcaggttacctgaaaaatgttggacaggtattatccaatttctaattggaaaaaactaga
tttattctataataaaaatcattctgttaatttctctgcacagttgtgtaagtgccactt
agaattagcaattgtctttgttcatgttttgtttttgaggttattcaagtgaaatacttg
aaaaaccatttgtagctatttaaagtaactaaaataaaatggacaactccctttattaca
ctagccacatatgtgctccatgcattccaacagcacagataccaaactttgggtcagaaa
attctactggactagaattgcagcctatgggccaaatctagcttgctccgtttttgaggg
taaagaacccagccacactcagctgtttatttagcctgtagctgcagaatagacctaaca
gattgtacaggcacagatcctaaatatttactttctgaccttttacagaaaaaagttaaa
accccatggaccaagaatctcaaactgggtcattagaatcacctagaaaactgagatact
aatgctgggttctgcctcctgattctgaattagatggatattgggtatttaagctccctt
ggtgattttaatgtatagcattttcaagacttggtgatctagtcttccaggtgccttttc
tcctcttgacagttaaccctcaagtgtgggctttgaggtgaggtcacctatatcacataa
gctttccactgacacctggcttctaaggctcaagactggcatggtgaggactcatggaaa
agaagatggcacttctgcagtccttgcttactcgtaattcctgggccctgaagctgcaca
gcattttttaggttacagtgttggagagggagttaggaaacagttctttctgtgactact
ttttcttggtattgatggccttgcacaaagtagttcccatttcaggctgtgtccatcctc
atttggcatcctcagaaaggcattctctcagtagtggcatttgcagcagtgcctgtgggg
ctcgttaactcgggctgtcccaactgcagtaagggctgtgaacggctgctgatgccacgg
gtcccaaaaccacgtttggcagcaccgtggctcagatttcactgtgcatggaaggcccct
gaggagcttagtaaaatgcagaccttggctcctcagagctagtgtggggctgagacaatg
catttcaaacaggctcccactcggcctttgaaccgaaaagccttagacgagcctatgcca
cgtgtgcctcagcaggctgttcatgtcattgaaagagtcacctcactaggctggtctcca
tctccatctccatctccatttcatctctagattattctcctggcttgtttgttctaaagt
acagctggcaggccggcctgccttttttgtttgcttgtttctttcttccttcctttcttt
ttttgagacaaggtctcactgtagccttgaactctcagcaatcctgcctcagtctccaga
gcgccaggattacaagcatatgccaccatgcaagactctaaagtactaccttaattatgt
tacttccccactcaaaagccttccattcttctatcccctaacattcttttatttacttta
ggaggtgaatctcactatattgtccaggttgatattgaactcaggtgatctgcctgcctc
agcctactgagcatctcagactacatgcatggtaccgtgccaactaccttatgttcttta
aagaacagacatgcagtgtgacgttcatggcctcttcctgtacgcatcccagcccacctc
cctatgctacattcctccctgtctgaaagttggtttcatgaaatcacacagccaggtgtt
ctgcttccatcctgtatgcacatacttttcattccaaacttgctctgcgctcttcccacc
ttccccatttccatgcctgtcttaaactgtcacatttcaaacgctgccatttctttcctt
tcacacccctagtgttcagtggcatggaggagttaatttgtggattgtactttcattctg
tggctccctgaaccttttattttttatttttatttatttatttatttatttattggtgct
ggggatcgaactcatgacctcgagcttgccaggcagacacttaagccactgagctaaatc
cccagcccctaccctgaaccttttacatcgttagcataccagccctgtttaaattttgcc
tcggtcttaccctagtgtgtattaggtaacacattctttggtgtaggcttcggacagttc
ttatgtaatgtaatgtgatcaatatacacagtaagcatatacattttaaaaattcactac
agtaatgatgggtgtaatcttagcactcaggaggctgaagcaagaggattgtaatgagtc
caaggccagcctgggctacatattgcgttcatagtgaactgtatagttcatgtagtgaac
gatgtagcgggagcctgtctcaaaacagaaaaaaaaaacttcattacagtaagacatgct
gtgattaaccccctcagagctcccctcctcacttcagacatacttatcccatcattctcg
ccactttctgaaacagttctggaagtcctcttttgtaaggtctttacatggtatgattaa
cagtactgtgacattgaggggcgtggaggactgctgcaagtttgaggccagcctgaacct
acacaccaagactctgtctcaaaaaaacaaaaaaactgtgaatgctgctgccaagtgcca
tgcagtggaaaggcaggctcataaaacattacactgtgtgttcatccaccttattcactg
gatctggcatcatgcaacttctggctcttcccccaaagacaaagtgaccacgaaaggtaa
atgttttgaatcagttcaggccattgaggcagccacagcagtgcaactgataatatgaaa
gggaacttccagcactgcttcaaaaagtggcaagaaggataagtgttcagtgctaggagg
agtatttcaaggggaatttaaagattcgctgttctggttttttccactataccctgtaag
tggtatttaatctgaactgagcaacttgtcctgtgactttgattcttgatttactatatt
gttggtttccattccaaacctgtttcacagaagtcgtcttcagaaggaactactaagtgt
ttgtagcatttgaccctcacttttaaggctctataataccaaacacaatgctccataggt
ttcatatgcattcagtttaaccatttcctttagatactagatgaacattctggctgattt
gcaagctccctttcccagtagactaagaatggtattatccttatcataaccatatgcctt
tgctttttttccctagagaggtggcagtaatttgacttggcgatctgatatcttggtgga
atatcaaggagaaggccgcaatgtcactgacccaacctgtccatctctgagtcctggagt
atctgtgagtagtagcttgcactgacttagacagctttctcactacagttcagctagggc
aagtgttgaaacacttgagtatcgctgttttgtcatctgactgtgggggtttagattgac
aaaggtaattcagtaatctgagaatgctgctgctggcctgtcatcagaatgcatactttg
atgtcttttagttatgtaacaaattcatgaatctgcccagattcttagcggttctcttcc
tctttcctactcctcccagcagcagtaccatttcctgttagggatggtatcacaggcacc
tgatagacaggattcccatagtgatggccatcatgagtgtcttgcatggatggcaggcca
ggcaggtcatgaaggtggtaccagccaggctggccactctttggagaataagaagtagag
tttcatgtgaattttactcttctgataccagaagtggtgacgcagtaaaggactaaccca
cagtggaatagcagagcctgtggaagataggatgaaatgagctgcagttaggtcatatgt
ggtaacaacactcttaagtaacttacatgactggtgtgtggctataatcccagcatgtgg
gaggctgagagcagatcatgagttcaaaaccagattgggctacatgatgaaagcttgtct
caaaaaaatgaatgacttaaagcctcattctagattagagtgggcactgttgattggtgt
ccaaaattggtcggtgtggctgaaattgagatacagggaatgcttccatcacaataaatg
tttacattggtgacagtgagacattttggctaataatgaaaaatactggctggggattta
gctcagtggcataagcgcctgcctggcaagtgcgaggttgtgagttcaatccctggtaca
aaaaaaaaaaaaaaaaacggaaaaatactgatgcttactattataaatgaatgtttgtaa
atgaatgagtgtagctcatgtgacaaaataccaatactatgtatggtttgaattctggac
tcctaaaatataaattgccagaagaaatttgggtaataagaccctaagagttttgaagtt
gtcattgtccataaatcaagtagaggtaaaagatttgtggcaaggcagatgaaatgactg
gattaagcatcaattcctttaacaagaggtatcttgaagacaaccacattaaaatgatcc
tgatgaatattaaatcacatgtaaaatttcttaagtaaaacttaattttaaataagtcat
ttatttatctgcagatgaatccacagagctcattttagctttttttttttaatctttttg
gatagttcctaatagtccttgaagtgactcatttgctcattacaactaattcttggcagg
agattagcagacagggtgacaacaacctttgaatggcagagtcacatattttcctcatcc
agtaaaccatcagtaaagaaaagcacctcccttccttttttgactcagtgggtctctgga
agctttcctcatctctgtcccattgtacatctggcttcagccaactcacttgcccctgta
agcagctaggtttttgtttccctggaagaagggtcctcatttaactttataaatgtgtct
acagcaatgtttcccagactgtatttgtgaagatgcatacaacaacacctatgcttgtgt
gaggacaatgtcagcactgtggaacttacagtactgcgagtttgatgaccaggaggtaag
agggacgtgtcccatccccttgttgttgtcctgccttactgggtgggtttaccacacaag
tgcagttcccagggtgctccctagggaagatgaggtgtccctctctacaccccagcttag
gtctcctcagttaagagagttccttaaggccatggttatttccctaagcatgatgcttct
gaatgaggtttctgctcacaccaccatccagttccttgatagctgggtaaaagtaaagca
ccgcaactttaatggaggtgagaggaactggagtatttcctcgaaagctgaccagcagct
gacttattcagaaactcctgttcccctcactacagtcctgtgcttctctctttgggcaag
ggcaaaggccccagaacttcatccttgggagaaagtggctttttggccaacagagactag
tgtaggttatctgaaggagctcatagctccagtccctggtgatctcatatcagcagcatg
tgctcacccacctggtcctactccccatctaaccataaggggaggtgtttgcctgcattt
ctcatgcagctcaggaacatgttgggccacgagcaagagtttccctccaactcggctttt
gttcctcccttttctataatgtttgtcagtctgatagctagatgtggtgacctgagggca
gctacatgacgccatagtaggcaccatttgcctgtgacttctagattgtcattggacttc
actttttaaaaagccatgccttcaaatgttaactctcactgtttatgactaagtcctgtt
tctgaggccatgccagcaagttcctatctgtgtcctgtgctgcaactacaagagggtagt
gtcctccccgtgctttcccaactgcctgaaagaacagggtgtgcaggtggcccctcccag
cttggggccatcgacccatagtgcaccaggcacagatgcactatgtctcaagtagagttg
gcctccctgaggacctgaagatgagaccatagtccactggactttggtttatctccctcc
tccctttgcatttcagaataactcacattatgagtatctgttcaaaaataacctggcctt
ttttctttcttccattctctaggtgtttgtagaagtctataatctgactgcagacccaga
ccaaatcactaacattgctaaaactatagacccagagcttttgggaaagatgaactaccg
gttaatgatgctacagtcctgttctggaccaacctgtcgtactccaggggtttttgatcc
cgggtaagcttcttgtctctacttcacctggttgtctctagtggttctgatcttctggaa
gaggagggaacgtgatggctcatttttccttggagttgctctggagtgggagtgctctgt
gtctacttgaaagcttggctcttcgctgccgtctgctgcttcagctgcaggcacagccct
acttccctgtgtgagacactttctcttctgctgtgattcttgtcatggtacagctcagtg
acacctaggcttcttgaagctttaacactgttcccacagcttcctcaacaccctagttgt
agaaagttgaatatttatagtaagtttaatattttaaatgtatgtaagattaggtgtaaa
ctaatacatatataaaccttccatacatagagctatcaaagatgtctgtctctgccaagc
caggttcattctacttgtacctcttacatagtagcttgtcagcaggatgctggtggacag
tgtattatgcatttgagctagtaaggtaagaagactgtcacttgaagattgtgaggttaa
aaatcagagtgtcactgggaaagcattatttcagttcttacatgacactataggaaaagg
aattcctgtactaagttgacggaaagctataatttatttaaccatattcatgttaaaatt
ttgaaacatagccacacacattgctttacatattgttgatggccacctttgcatctcaac
agtacagctgagttgttgagacactgtgtagctgtacttccctaaaatatttatgatcta
gccctttattaaaatgtcagccaatcacaactctaaaataataaacatcccacaattttg
tttttaagacagtaaattgcagtgtcatttttcacccacactggccagtgtaattcttca
catctgccaagtcccagcctccagttacctttcagcatttactctacattccccattgaa
cggtaaaatcagtgcgtttttcattttgtgctatgcatttaacatgaatgccatgctact
ttattggcagccagagaggaggctatctatattcatcagccagattcagacacatctgag
gtacacacttgtgttcctttctgccagtctgagtataagcagggggctgtgaaaaaacaa
aatctagctgttctctgccacctttcaagattaaccttaggtttttctcctctcagctta
cactacataaccttaatgcttgctggcttacagtcatgaaaatgttcttttaagtcctca
tgttttgtactagactttcccagggtcttcccatctggtgatctgttccttttatatccc
ttcttgttagttttcttactaatgtcctaatgaagtacttagtgacttgttaattcatgt
gacatcctcattttctcatctccagatacaggtttgatcctcgtcttatgttcagcaatc
acggcagcatcaggacacgacggttctcgaaacatcctctgtagtgacagtgtgcagcct
cccacagtcggatccctgcacacctatctctgatgaagtgagcatagtaggtgtctgtag
gtcatctttgagaacacacctggaagagctttggactggctgttttaagtcctgtttgaa
aagcaacctaatcagttgacttccttgtgcaacttgttaaactgtgaactctgtccacga
gtcaggagtgactttcctcagtctttccctcagatggtactgaactctcctgagtctttg
ttcccgctgtatcatttctgttctggggccacaattcttgattatcccctgtgtggttaa
agtctgaatttgtgagtccattcagggaaatggcagtactttaggacaaaaaagaaggaa
acttgttatatagcctaacctaaaagcaaaggatatgcataacatttcagactgagcact
caactgtcaaaaatactagcatcacctggcttgaggaataaccatcagagctgaatcatc
tgattaagaataagttccattgtttttaaataagtagagatgcattgtttataaaaatct
atcacagtgggataaattaaggtagcaaattcaaaacttgttagccaaattctgtttgtt
gctttaaggttgtgggctgatgctgtacaagtggctcctgaaggcagtgaatgtctactt
tccagtggccgccaatcccatggagggccagtcaacactggtagtattaaagaggcatct
tttgttttgagacttcctccttgaaacaggctgaggagattggggagaagcccttttgtt
tgctgggagcctagatagggctcttgggttgacaggtaggtttggacttgtatgaagtgc
ctggcctgcagtgtcggtgccatgtgtgaagtcattttgactatctacattttgctgtca
ttctcttgattcaagattcacaaattgcttctagttgatacaaagtatcaactacttcac
cccagcttactccttttcagacag
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1195, 5909..5968, 8570..8776, 10505..10570, 10989..11087, 12623..12790, 14566..14648, 15551..15669, 18035..18138, 23898..23999, 34336..34443, 36064..36174, 37282..37442, 38845..38923
1001..1195, 5909..5968, 8570..8776, 10505..10570, 10989..11087, 12623..12790, 14566..14648, 15551..15669, 18035..18138, 23898..23999, 34336..34443, 36064..36174, 37282..37442, 38845..38923
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved