Cavia_porcellus Locus RPLP2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus RPLP2
Cavia_porcellus
RPLP2
GeneScaffold_6449
SNORA52
2212..2347
4336
cttttaacattcgttgctccctagaatacatacttcggtttaggggaactaaactccac
atatctgatatccagcaggttgagttatatttatttcctctgtatcagctgcacagcagc
ctaaattctgcaaaaacatgagcaagtccattgcctttcaggaccccagagtatggcagt
ccttgacgcaagggatttatgtgttacatggaggacatcatttaaatactaaggtcagct
ctggaccgacaaggccagcgtggaggccggtcactctgattttgccatccccagggtgca
gggataaatcacttctaggccgctgacgatgccaccgcctctgtgctatgcttccagagc
tacctctttcctggtggggcgcctcgattgcataggacacggtcccgggagtctgcctcc
tgtaccagcttttgcggctcgcccacttctctgagcctcgccaggcatgggaccaccagt
cttggcgggaggttgaacctcgggttatcgcagccagagagctatcacctacaagacttg
ctccacccaaacccacgtgcagcccgcgaaagcttgaggccttccacttccggcaacggc
gcaacacgggagttgcagtttgtacgacaaggaagcgccatgagcgacgtggtcgcattg
tatgttgggaggtgtatcccacccctccaccccccgccccgtggcatgccagcgaactag
tcgcaggagggacctgacgtccccttcaggtcgatagacccgtctccccggagatttcgg
gagacactagctccatgctttacaaacagcatcggctctgaacttttgctgggcaattta
tcaattgggtaccagatcatggctcctcttctgtcgtcattggctgaccgctgcattacg
tcacttgtaggcgccctcgcgcagcgccgcacgcgctcggaggcttctgggtaacagttt
acccccgccccctgcgtcggcctcttcctttcgcagccggaCGCCGCAGAGGTTGCACGC
GTGAGGCCTGTCTGCTTCCATCTTCGAgtgagtaggcccgctgggccggggcgcggctcg
aggggtgagcgggagatcctagggaccccctggggcgggggcgtggagactgagccccgt
gtgacctcgctctggtggtctggtgtgggacggaggccacagtgaacacgccgccccgcg
ctctcggcccctcttagCATGCGCTACGTGGCCTCTTACTTGCTGGCCGTCCTCGGAGGC
AACTCCTCCCCCAGCGCCAAGGACATCAAGAAGATCCTGGACAGCGTGGGCATCGAGGCA
GAAGATGACCGGCTTAATAAGgtagttgccgcccttagtccctaacccgctgtgggcgcg
aatgtctggtgcctgtggcccctgcgccttgtgaccctgaatttacttcccgggagactg
agggaggcctgcgtcaccctggtaactagtgtggtccgatacatgtagtgcagttctgac
gtgtagcaagtcgggcgaggtggtgcgtgcctgtaatcctagcatcctggaggtctgagg
cagcaggatcccacatcggatcccagtcccggcaacctagtaagagcctgacccaaagta
atgggttagcatgtagctcaactaaagttctgaaataaattcctggttctgcaaaataag
aaaaaattatgaaagcagttttattccccatctacttttttgatagtgctgagcacctga
cccgggccttatgtgttgggcaaattttagccctagataattttaatagtcggttttttg
atcaacgtggttaacaagtttatacctgtactataagcagtaaaagactgagtattctca
ctgctgaggtggaatcttagcaactagttttagctctttttttttttttttttgtttgtc
tttttccttttcattgtatcaggcattgaactcaccactgcctgcttgcaaggcaggtgc
ttacgccactgagctaaatccccagcccctagttttagctcttaataactcaaatcaaag
aatcctgtgtacttgatgtttattaggttggcccatacaggtcaagcactcccctctggt
gattgatcgccggctgtggttgtctgtttcagGTCATTGGTGAGCTGAATGGGAAAAACA
TTGAAGACGTAATCGCCCAGGgtgagtttgtgtggaagcgtttttagttttatggtccat
tctaattcctgctggtcaggctgtggcctgccaggtttcgcttgtggaccacagcactct
ggaagcttgactcaaaagaatgagcacaggccctcatgggcttatgttggaggcacttct
ggacactttcaggaatggtcagtcagggctaccctaaaactcttgactacttgccagctg
tagtctctgggactggctgtccctatccccttgtcctttttggaactttggggcatttgt
aaatagttcatttggagctttctgtgagtgggttgggagtagggatgggggtgtcagcgg
tgaccagaggctcctggacccttttctgggcagataatttgctggtggcttcagatgagc
tggtggcacttgtttgaacactgatctcttactgtagcatttatgtccttgtgcatgtga
tgggaaagtcatgctcagtgaactgtgatccatgagctcactgctgtgaacagcattctg
atcactagggcaaggggacactgcccagaggtaaatgtgtttgtcctacttagctttgag
gtaaggtggccatggcttcatttctggaagataagatcctagattgaaactgcttagtgg
atcaggttaggggcattttcctacctctgtgtgtgtgtgggggggtggtctcacatcttg
gaagaacaggggatactgtcaaggggatttgttgagcgtgctgctgtacctgttgaaact
agcttccatgggtctgaacccctgactgaggacagggttttactcacccctacactgctt
tacagGGATTGGCAAGCTTGCCAGTGTGCCGGCTGGAGGGGCTGTGGCTGTCTCTGCTGC
CCCTGGTTCTGCAGCTCCTGCTGCTGGTTCTGCCCCAGCCGCAGgttagtgaaggctggt
gggtgggcagggggccaagtctcatagtcttcggctgacacaatggggtctggctgagcc
tgagggcggtgttcaccatgctgctgttctctctacagCAGAGGAGAAGAAAGAAGAGAA
GAAGGAGGAGTCTGAGGAGTCTGATGATGACATGGGATTTGGCCTGTTTGATTAAATTCC
TTTCCCTCTGCAAATAAAGCCTTTTTATGTATCATAAgcagtctgtgagcactttgtgtc
agctacacaacacttgcagcactcatgcttctgtacagactggggcagatgaagctgtgg
ttgagtaaggaggagcaggacctgtgtgggcctagaaaaggttcctagacccagagcaaa
gatttgtggcttctagggaatgtgaggccaactttttggggaaatgtggctggcaggggg
gtttgacctgagatgggtttgtttgggtgatatccagttctcaggtgcttcgtgcccagc
ggtggaggtggctgctctaggtttcacaggtgaaggctctgactgagcatgccttgaggg
tcaggtgtccccacagatgggcaatacttcatcctgcttcctcatcctgcaggtgtggag
gttgtctgtgagtagagggccaagtacttactgttactagctctttctaggtttgtttag
tttctaaaataccaaaaacccaaagttaaaggaaaggaaaaaaggtttctctgtttgtag
aggttttagttcccattggttccaaggtagggagggtagcacatggtagggggcaatagt
tccctattggaactattggtggtggaagatggcaaaaggaacgagaggaggagataagtt
tctttctgtcccttaagtattgtctataaggattagggcagtaccaattcagtcagtgta
gtgtcccagcaatcacttaacccttaatttcagcattgcactatgaattgaattagttac
tttacatttactctgaaaaaaaccctatgaccacatggggttttgttatggtttacataa
actcttgggttctggcgtgggatgtggggctaaggacagacaagttgtagccttcctgtt
tcttaaattcctctctagcctctggcactgatgtattccaggccatctgagggcactgca
gtgggcagggccagccttccgagaagtgaattctgtacctaagttgcgatggagctggga
gtagtatgcaaggagta
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1046, 1217..1340, 2132..2180, 3005..3103, 3218..3336
1218..1340, 2132..2180, 3005..3103, 3218..3294
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved