Cavia_porcellus Locus TCP1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus TCP1
Cavia_porcellus
TCP1
GeneScaffold_341
SNORA29, SNORA20
4175..4313, 10091..10220
12919
AACAAACAAAAAAAAAAAAAAAAACAAAAAAACTGAGGACACTCACAATAGGAAGAATA
AAATTTAAAAAGGAGTAACAAGAGTAAGTGAAAGAAATGAAGGCACACTACTTGGATTGA
GAAAAAGTCTGTGAGAAGAGCTTCCAGCCCCCATAGGGGAGGTACTGGGTCTCTTAAAAT
CCTGGGATTACGGAGAAGTCTATAGTAGAGAACTGACAGAGGTAGAGGACCGACCCATCC
ATTTGTGGAGAGGGGCTCGACTGCTTGTCAGGCTAGCGCTTCAGCCGCTGAGCTAAATCC
CCGGCCCTTACAAAAGGTTTTTACATGAAGTGTGGTGGGGCCCAAAGCCCACTGAGGGTG
TATAAATCTCAATGCCAGCCACGTGTGGTGACACTTGGAAGCCTGTGGCACTCCTGCGTC
AGGAATTTGAGGGCAGCCTGAGCTACATAGCAAGTACAAGCCCAGCCTGAGATACAGAGC
AAGACCCTGTCTCAAAAATCAAACAGTGCCACCCAAAACAAAACAAAAACACCCCCACCC
AAATACAAATAAAGCAGGGTGCAGACTAGGGTCATGTACTTTTAAGTTTATGCATGCTTG
CCGATCTTGAGGGAACACAGTCACCTTTATGTATTAGTTTTCTGACATTCTGACACACTC
GTCCTTTCTGTCTGAATTCTCGACTCTTGTCCCACGGCTTCCTGATATTTATCTCTCCTT
GCTCATCTCTCATCCCACACAAATACTAAGCCTGTGCCTTTCCGGTTCCTCATTTCCGGC
AGATTCGTGCCCACCCCCACCCCCAGCCCCAGCCATTCCCTCTTTCCCGCCGTGCCTTGC
GGCCAGCCAGCGACGGCCCGGGTGGAGCGGGGCAGGCGCTGTGTTACCCAGCAGCCCCTT
GGGCGTCATTGTGGCGTCTCCATCGCCTCAGTCAACTCTATTTCCAGGCCTGGGGACAGC
TGTACTGGTTGTCAGGGTTTAGTGCGGAAACCCTGGCGAAGATGGAGGGCCCTTTGTCCG
TGTTCGGAGACCGCAGCACTGGGGAGGCGATCCGCTCCCAGAACGGTAAGGCGCTCGAGG
CCTGTGTGGGTTCGACCTGGGCTGTCGGCCTCGCCCCTTTACGTCCCTCAGCACAAAGGG
TCCGGCGCCCGCTGCGGCCACGTGGTCAGCCAGTGGGCGCAGCGAGTCCAGAGACCCCCC
CGGGAGGAGCGCGAGTGCCCGAGCTGGTGTAGAGATGGCGCCCCAGCCGGTAAAGCGAGC
CCCCGCCAAGACATGTGCGAGCTGCGTCCCGCCGCCCGGCTATAGAGAAGCCAACCCGCG
TGGGCGTCTGTCCCACTCTTCGGGCTTCCTCCTGGGACCATCGGCCAGGACACGTTTGAG
TTCGCCTGCACATTTGGCGCGTAGGCAAATGCATATAGAATTTAGGTGACTTACGCTGCT
CCCTTCCGGTTATCTACTGTGGATGTCTGGTGCCCCGATTCTCGCTCAGATCTAGTTTTG
GTGTGGAACCTGCCGTTGATAGCTTCTTACAGTGAATTAAGTTAAAGAAATGCTCGATTC
CATACGAGTGTGAGCGAATCGTGTTTATCCTAGCGAACACTAATAAAAATTATCAAATCA
GTTCTGATACCTGTGGCAGTTACCTTATTTTTTTAAAAAATAAAGTTCGTTTTCCCTTGA
ACAGATTTTAAGTAACATTTAACATCTTGACTTTAGGACCACTGGATTTGTGTTTTAAAA
AATGAGATTGTGGTAATTAAGGATTTTTTTTTTTTAAAACCTGCCGGCTGAGGGTGGGAA
GTTAAAGGCCAGTATGGGCAACTTATAAGAGACACTATCTCAAAGTTAAAGGGCTGGGTG
TGTTACTCAGTGATAGACGCCTTGCCTAAGAAGCGCGGAGACTCGTGCAATCCGCAGCAC
CCATACAAAAAAAACCTGCTTCAGTGTGAAGGGAAAGGTTGTCACTGCCCCCTCCAAGGC
AGAGCATAACATTGTAATTGGTGGTTGATTACTTTTGTATTTTATGCGGCAGTAAGCTCC
TTAAAACAATGTGTTTGTTAAATACTCTCCAAATGAAATTTGCTACCCTTCTTTGATAGA
CTTACAGCAGGTGATTTTTTAAAATAAAAAGGACATATTTACATAGTTTTGGAAACTTTA
CAGCTGTTGGATGTTTTTTAGTTCTTTAGGCTGAAATAAATGATTGCTCTTTAGAAAAAG
TTTTCTAATGTTATTTCTTTTTTATTTTTTGACTGATTATATCTACAGTTATGGCCGCAG
CTTCTATTGCAAATATTGTAAAAAGTTCTCTTGGTCCAGTTGGCTTGGATAAAATGTTGG
TAGACGATATTGGTGTAAGTACATTTAACTATTGTGTCGTTCACTGTTTTTACTCTGTAA
ATTGTTTTTCTGAGTGGTAGTGGGACATATACGTTAAAGTTGAATGTGCATCATAATGAG
GCTATGTTGATTTAAGGGGGCATCTTGTTCCCAAAGGTGATTGATGTGACCACTTTGTAT
TGCATACTTCCTAGGATGTAACCATTACGAATGATGGTGCCACCATCCTGAAGTTACTGG
AGGTAGAACATCCTGCAGCCAAAGTTCTTTGTGAGCTGGCTGATCTGCAAGATAAAGAAG
TTGGAGATGGAACTACCTCAGTGGTAGGTGGGCCAGCCTTTAAAGAATAGTCATTTTAGG
GGTCAGGGATTTAGCTCAGTAGTTCAAGTACTTGAATGGTAAACATGGGGTCCTGAGTTC
AACCCCCAGTACCAAAAAAAAAAAAAAAAAAAGAGTCATTTTGTCACAGTCATAGCCATA
AGTGAGTCATTTGATCTGGGCCAGAAATAAGAATAATTAAGAAGGAAAATGTTATTGTTA
ATATTATTGTTTGGCAGATAATTCAGAAACAAACTTTAAAAGCCAGTAATTATAGATAGT
TTGAACAGTTTTAGTAGGAAAGGAGCTTGAGATGATTATATATACCATTTTCATTTTAAT
TGAAAATGCAGGCTATGTTGGTGCAGGCCTATAATCCCAGCAGTTGTGAGGGTGAGGCTA
GACAAGTATAAACAAATAGAGGGCCAGGAAATTCCTATAGCAAATAGATACTTTTTATAT
TTTAAATGCTGACAGGTGATCTCAAGAACTCAGGATTGGAGTGTGAAAACAGATCACCAC
TGTGACATGTTGTACATATGTATAAGCATGACTAGTTTTGTTTTTTTGTTGGTTTTGATT
TTATCTTTGGATTTTTGAGGCAGAGTTTCACCATATAGTCCGTTCTGGCCTCAAACTCAA
GGAGATCCCCCTGAGAAAGTGTCACCTGACAAGGAAGCTTTCTCTTTTAAAATATGAAAA
TGGTCTTTGACCAAGTAAATGATAAAATGACTTAAATAATGTAATTTCTCCCAAAAGAAG
TTGAAACTTTAAAAATGTTTTAAACAAACAAGTATGTCTTAGTGTTCCTTACAAGAAGAG
TTTTTGAATTGAACTGTAGTATACAGTCTAAAATTGTACAAATTACCAGTAGTTAGGAAT
ATAGCTTCTCTTGAGTACCTGATGGTGAAAGATGTGTTCTGATCTGTCGTGGAGCTAGTT
ACAGCATTTTTCTGGGTTCTCTCCGGTTTTATCCACTGGCGTACAGAATCTTGAGCACTA
TTTTTGATACCCTGTTACTTTTTTGCTCACCATCACTCTGCTGGTTAATAATGCCCACTC
ATGTTAGTGTTGTATTTTAATGTGTTCATTGCACAGATTGAGAGTAAGGCATATTTTGAC
TTCTGTGGGTGGGGGATATAGCCCAGTGGCACAGCATCTGTCTGGTAAACAGGAGGTCAT
GAGTTTGATTCCTGGTACAAAAAAAAAGAAACCAGGCACAAAAAATCATATTTAAGCCTG
TGAATGTTTTCCCAACAGGTTATCATTGCAGCAGAACTTCTGAAAAATGCAGATGAACTA
GTCAAACAGAAAATTCATCCCACATCAGTTATTAGTGGCTATCGACTTGCTTGCAAGTAA
GATTGTGTGTAAACCAAATTTTATTGGCTATAATATATATGTGAACAGTCTGGGTCTTAA
TGTCTTCATTAATGATGTCCTTTTAAACTTGAAAGCTTGTCTTTTAAAACTCATGTGGTA
ACATGTAAGGTAAAAAAACATTGGCCAGTATTATCTTTCCCATTTGACTACCACATTTTC
TCCTGTGATAGATTTTAGTGGCTATGCTTATGGGAGAGATGAAAGTTGCCATGATCTGAA
GAGGGAGGGCTTTTCAGTGCCCTCCTCCTATATGGAATGGCTGAACAGAAAGACCATTTC
CTAGAGGGTTTTGACATGATGTGCAGTGTGATAGAGCCAACAGGTTTCAATAGCAAACTT
GTATTTTTCTCTCCACACTTTCAACAGGAAGCAGTGCGCTATATCAGTGAAAACCTCATT
ATTAACACAGATGAACTTGGAAGAGATTGCCTGATTAATGCTGCTAGAACTTCCATGTCT
TCCAAGATTATTGGAATGTATCCTTAAAAATTCCAGTGAAGTTTTTTTTTTTGGTCTTTT
TCCTTTTTATTGGTACCGGGAATCGAACTCACGACTGCCTGCTTGCAAGGCAGGCGTCCA
GTGAAGTTTAAAGTCTTCTTAATGGAAAAGGTCCTGGGGGTTGGACCCAATTTGAGTTCT
TCTTAAAATATCAATTTATTGCAAATTGAAAATTATGTTAGAGATAAGTAGTGGCATACT
GAATTGCTTATTGCCTTCCCTGCATTTCTAGGCTGAAACAGGAAGGTAAATAGCCTGTGT
GGATGGTGATAATAACTAGTTATTATCACAAACAGTGCTTCTTTTCTTGGGTGAATAAGA
TTGCTGAAAGAAAGTCCTTTTGACTTGCCCTCGCTCTTCATGTGTACCCTCTGTTCGAAG
TCTTGTTATCCTTAATTGTTGGTACAGAAATGGTGATTTCTTTTCCAATATGGTAGTGGA
TGCTGTCCTTGCTGTTAAATACACTGATGCCAGGGGCCAGTCTCGCTATCCAGTCAAATC
TGTTAATATTCTGAAAGCCCATGGGAAAAGTCAGACAGAAAGCATGCTCATTAATGGATA
TGCTCTCAACTGTGTGGTGGGATCTCAGGGTAAGTCTGGGATTTTGTCACAGAGTGAAAT
TATGACAGTTGAAGCCAACTCTTTTTGTACTTCCCATGCAGTACTTCTTTTTGTAACTTG
AGCATACATAAAATGTTAGGATGAGTGTACTGAAAGAGATTGTGTCCTCATAGTGCCATT
AAGTTCTTCCAGGATTTAATGCACTAAAGTTACAATCTGAATGTGTGTGGTTGTGTATCC
TGTAATATATTTATTATATGATGTGATTTAAAAGAACTTGATGTTTTATTTCTTACAGGC
ATGCCCAAGAGAATAGTTAATGCAAAAATTGCTTGCCTTGATTTCAGCCTGCAGAAAACA
AAAATGAAGCTTGGTGTACAGGTGGTTATTACAGACCCCGAGAAACTGGACCAGATTAGA
CAGAGGTATGTTGAGATTTTTACCTTTAAAAGAGAGTGTTGCTTAATTATATATACTTGT
GTTGGATCAGCTGACAAGAAACCAAAACAATGTGTGGTGTATTTCATACATAACAAATTA
TCAAAACCACTGATTTTGTGGTTTATAGAAATGAAGGTTTTGTTTTTATTGTGGGTTTTT
GGTGATTTGTTTGCTTGTTTTTTGATAGTGTCTTGCTAAGTCATCCAGTCTGGGCTCAAA
GCTCAAATTTGTGATCCTCCTGTGTCAGCTTCCCAAAGTGCTGGGGGTGCTGATATGACT
ACCTGCCATACCAAGAAAAAGTGAGCTTGTAAGTGCTTTTGGAGGACTTTTAACTTTTTA
TTCAAGTCAAACTGTTTTACATAAGCTCCAGAAAGATTAGAAAATATGGTAATATTTTAA
GTGGGATTTGTAGTGATGTAACATATGAAAATGTGCGTTTTTATGGAATTTTGGTCTACT
GAGTCTTAAAATTCACTATAAAAAAAGCCATGATGAACTTGTTTCCTCATAGAAGCAGTA
TAGAACTCAGTAGTTTAGAATTGACTATGCTTTGTTTAGGGATTTTAGGTGCTGGTATTC
GTTCACTGGCATACAGGAGAGTTGTTTTTGAACATAGTTTGACTGCTCAAGAAATTTTGG
CTCCCCACTTCCACTTGGCCCACATCATTCCAACAGTTTTATTTTTAGGCTGAGCATAGT
GGTATATGCCTATAATCCCAGCACTCAGGAGGCTGAGGAGGGAGGATCACTCAAGAGTGC
AAGGCCAGCCTGAAATACATAGCAAGAGCCTGTCTCCAAAAAATACAATGAAACAGCGAT
CCAGTACTTTTATATGACATGATGTATATGTTTATGGGGTGTGCTGTGGCTTTTCAATAT
ATGTATGTAGTGTGTGATGATCAGGCCAAGGTTATTGGTATATATGTCCCCGCTGACATT
TACCATTTCTTTGTGTTGGGATCATTTGCAATCCTCTCTACCTCATTTTTTGAAATTATC
AGTTGTTGACCTTGTCATCATACTATGCTGTTAAGCACTTGAAATTATTCCTCCTAATCT
TAGCACTCTACCTTTTAGCCTTTCTCCCTCTTTACCCCTCACACAAGTACAAACCTCCCC
TAAGCTCTGATCACCACTAATGTATTCTCTGCTTCAAGGTATTTTGTTTTTTGACCTTTC
TTCATTAGTTTGAACACACAGCTGAATTAAACAAGGATGTTTTGCTGTGATTTAGGAGTG
GTCTTTTAACCATCAGCATACACATACTTTAACCTCTTTCTTTCAAAGACCAATGCTACA
GTAATGTTTCCATAGTCTTGTTTGTTGGTTGGGTTTTGTCCTAGCACCTCGCTTCATTGA
TCTTTCTCAATGATACCTAACCGTTCTCATGAGCCCACTTCAGGTTCTTCTATCCCTAAG
TAAAGGGCCTGTTCTCCTACATGCCACTCTACTTGCTCCCTGTCCCTCTATATTTCTGGG
GGTGGGCATAACATAAGAGTGACTTACGCAGAACTGTTTACTGGTTCTTCACTTGTTATC
TGCTCATTACCTGTTTGCTCCTGTGGAGGGCAGGTGTTAGAGTATGTAGACTTCTTAGAC
TTTTGAACAGGCCTTTGTTGCTTCTGCCTTAAACCACTTTTAGGGGAGGGCTGGCTCGGT
CATGTTGACTTTCCTGTGTTCTCTGGGCTGTCATCTCATAATACTTCCCCTGGAATAGCT
CATTTATCCCCATGAGTTCAGATATTTATGTTACAAATTCCCAAATGTGTTCCCGATTCT
AAACACATACATTTATCAATAACTGAATCTTTTTAGGCATCCTAAAATCAGTATTCTAAA
ATTAACTTGAAATATTCCAAGTCCACTTTGGCTTTTTAGTAATGGGGACTCCTCCACAAG
GCAACAGACTAAGAAATGAGTTTAATTCTTTTCTGCCTAATAGAATAAGTCCTCAATTTA
GGAATAGTCAAGTTACGAACTTTCATAACTATGCTGTATAAGACTGACTTTGTCAGATAC
AAATGAATGCAGAACATTCTTCCAGAACAGTACTCATTTGTAAATCCTGGACTTTACCCT
GTTTCTTCCAAACTCTTGAAGACCATTTGATTTTTTGCCTCCAAATTAAATGCAGCAATT
TCAATTTTCTTGCCTAGACAATTGCAGAGGTAGCCAAACTAGTCAGTCACAGAGAAATTT
TCTTTCTGCCTCAGTCTGAACTTTTCAGTGATACAGATCAGCTCGCTGCAGTCCACATGC
CATAGGTTTTTCACCTGTGATCTAAACTGTGCTCTGTTTACTTTCCGTTATGTGTTTATC
CAAGTGTATTGTAGCTCTGAAAATAGAGAAAATGATTCTCTTCAGTTTGTAGCCCCAGTC
TGCCAGTCCCTGGCATACTAGCTCATAGGCAGGGGAAAGTAGAAGTAAGCTGTAAAATAT
CTGGATGTGGTGAAGCGTGAGTTTAATCCTAGCTACATGGAAGTGTGCGGCAGGAGGATC
ATGTGAGTGAAGGGGTTTACAACCAGCCATGGGCAACGTAGTGTGGACCCAACATAAAAT
AGGATGACTAGTATAGCAGATACACAAAATAGAAGTACATTGGTTTATTATTATACTTGA
ATATTGTGTACTGTGACAATTTAAGCTATAACTGTATACAGTAGAAGCACAGGAATTATA
CCTGTATCCTAATCACTACAGACATACAAGTAATGTATGGCACCATGATGTTAGGACAGC
TCTCACATACTTAGGAGAGAAGAATTTTAGGGGTTCATTATCTTTTGAACCACTGTTCTA
TATTTGGGCTGTCTTGTAAAAAAATGTCATGAGTGTGGCACATGACTGGACCTAAAAAAC
TTGAGTGGTCTCATCTACTCACATGGCTTCAATATAATGTTTTGAATCTGTCTTTATTGC
ACTTTACTGGTCATTTCCCTGATGAACCTTACCATGTCCTATTATCTTCAACAACGTATC
AAAGGCTGTATTGTCCCAGGACTCCTGATTTCCCAGCCTACCCCTAAACTGTATTTTACT
CTAAATGTCACTGTACCTCCCATTACCTAAGCCATAAACTTTGACTGTTATTTTTAGCCT
GTCAATAGGTCATCCTTAACAATATTCTTGTCTCTTATTAATATCTCTTTTTGTGTCTTT
CATCTTTCCAGTATGTTTTACATATCATCATCAGGAAATCCTTTTGAACAAATTGAATAA
TGCCAGTTTTGCTAAAAAACAATTACCAACTATTTTAGCCAACTAGGTGCATTAATATGG
GCTACAAGTTTTTTATCTTCTGTTCTGCAATTTGAACTCTGCACCCCTTTCTTAACCTCT
GGTCCTGCCTAGTGGGCTGGATTTGTGCCTCTCCTCCTTGGCAGATGGTGTCTCTGCATA
CCACTGTGATAGAATTGACCCTAGAACTGTGATTGGTCATTTTTCCCACTAGATTTGGGT
AGCAGTCTTTTTAGTGTTTTCACATAACACTTGTTGATTAAGAACTCAAATTGGAGTTTG
GAGAGCAAAGTGGTGCTTTCTCATTGCTTAAAATTTGTCATAAATTAGACTATTAAATTT
AGGTTTTAAGTTGGGAAAGAAAGGTTGATAGAATTTAATCGGCAGCTATTTCATGGAAAA
TGCCTAAAGGAAGTTATAATTGCATTATTAAAAGGCAGAGAGGGTAACTTGGTTATTAAA
ATACTTCTTTTGTAGAGAATCAGATATCACAAAGGAGAGAATTCAGAAGATCCTGGCAAC
TGGTGCCAATGTTATCCTAACCACTGGTGGGATTGATGACATGTGTCTCAAGTATTTCGT
GGAGGCGGGAGCTATGGCAGTTCGAAGAGTCTTGAAAAGGGATCTTAAACGCATTGCTAA
AGCTTCTGGAGGTAAGTCTTCTGCCAGGTCTTGGGTAAAATGCTTCATGTTAATATGTAT
GATGGTCTTTGGGGGAAAGCTATAAACCTGAGATCTATAGTGCAACACTTTTGCCATGGG
TTTTGTGGCCCATGATTGTAATCCCAGCCATTAGGAGGCTGAGGCGGCAGGAGCACCACA
ATTCAAAGCCAACCTAAACATAGGCCCAGTCTCAAAAAGCAAAAAAATTAAAAACTTAAA
GATGTTTCTCAGAATAAAACATGATGGTAAGATCATTACGAGAACAAAGAATGGTGGTAT
ACACCTGTGATCTCAGCACTCAGGAGGCTGAGGTAGGAGGATTACAGTGAGTTTGAGGCC
AGCCTGGGCTACATAGTGAGTTCAAGGACAACTTGAACTGAATAGCAAGGCCCACTACCA
AAAAAACAAAACCTAACAGAAAATCATCATGAGACTATTTCCTAATGGTGTAACTCTCTT
AATAGCAACTATTCTGTCAACGTTGGCCAATTTGGAAGGTGAAGAAACTTTTGAAGCTAC
AATGTTGGGACAAGCAGAAGAGGTGGTACAGGAGAGAATCTGTGATGATGAGCTGATCTT
AATCAAAAAGTAAGAGCCGTTTGTGAATCCTAAGGCCATGCTGATTTTGTTGTGAAGGAC
GAATACATTTCCTTCCCATTTATTTGCTGCTGTAGTCTGTCAGTGACATGAGCAGTTATA
CGCGTGGGATACAGTAGTGTTGGGCCATTGTACACTGAGATGAAGTGGCTACGTCATCTC
TTCTGCATGGTCTGGACATGTTTGGTCAAGGATGTCAGGGTCCTGTGTAAGCAGAAGTTA
ACCGGGGCCCTCGCAATGAATGACTGAGAATTTCAGGTTTTTTCTCTTCACAGTACTAAG
GCTCGTACATCTGCATCAGTTATCTTACGTGGGGCCAATGATTTCATGTGTGATGAGATG
GAGCGCTCTTTACACGACGCCCTTTGTGTGGTGAAGAGAGTTCTGGAGTCCAAATCTGTG
GTTCCCGGAGGAGGTGCTGTGGAAGCCGCCCTCTCCATATACCTTGAAAACTACGCCACC
AGCATGGTAAGAGTGACTTCTGAGGGCTGGGAGCTTAGCTTGCACCTGATCAGTGTGCCT
TGTCTGAAACCTTAGCTGCCGCTGAGTTCTTCTTCCCAAATTTTTTGAAGAGACACCAAA
CTGTCTTTCTCCTCAGGGGTCTCGGGAGCAGCTTGCCATTGCGGAGTTTGCAAGATCTCT
TCTTGTCATTCCCAACACGCTGGCGGTGAATGCTGCTCAAGACTCCACAGATCTGGTTGC
AAAGTTAAGGGCTTTTCATAATGAGGCTCAGGTTAACCCAGAGCGTAAAAATCTAAAATG
GTGAGCATACAGTTTCTTTATGTTTTTCTTGTCATCTACTTATCATGACTAATTGTACTT
TTAAAAAAATCCCTTTCTATACATTGGGAACATGACATTTGAAATGGTGGTCAATGGGAA
TGGGGGAATGTCAGCAAATATCAATCAGAGACTTGTCAGAAGATTTAAACATTACAAGAG
GTTTATTGTTTGGTCAGTTACAGCTTATCCAATGGGCAGTGACTGTTAAACTCTGGTCCC
TAACCTGCTTCTCTGGTTAGAGTCATAGTACTTGCAGGAAAGTCAGATTTAAGGATGAGC
CACGTTTATGTTCAGGCTCTCCCCTTAGAGAGACAGGAGTGGCTTCCGCAACTCCTGAGG
AATATCTCTTTAGATGATTTGACCCTTGTGAGAATATCATGCGGTATATTTAAATAAACC
AAGACAGTTGTGATATCACTAGGCAAAATGTTTTCATAGGGACACAGGACACATTAAGTG
ATTTTGGAATTGGGGCTTTCCGTTTGTTGTTTTGTTTTGTCTTGAGATAGTCTCACAATG
TAGTTTAGCCTGGTCTTGATCTCACTGTGAAGCCTAGGTTGACTTTGAACTTGTGGTTAT
CCTACTGCCTCAGCCTCCCAAGTGCTAGAATTAGCAGTCTATGTCAGCATGCTGGGTTTG
GAATTAGGGTTTTTTGTTACCATTTCAAGGCTTTTGATGGTACTCAGTCCTGCCCTTGTC
AATCATAACTATTTATTTTTAATTTTTTAGTGCATTTTTGTAGTACATAGAGTTAAATCC
ATTGTGGAGTGAAGGTAACACATCTGAATGAACTACTTTAGTCTTATTATCGAGAGTAGG
GAGAATTAATGAACTGCTTAATCAACTTCTAAGAGATCGTTTACCCAGGTTTTTTAATTG
CAGGATTGGTCTTGATTTGATCAACGGTAAACCGAGAGACAACAAGCAAGCAGGTGTGTT
TGAACCAACCATAGTGAAAGTCAAGAGCTTGAAATTTGCAACAGAAGCTGCAATTACCAT
TCTTCGAATCGATGATCTGATTAAATTACACCCAGAAAGTAAAGACGATAAACATGGGGG
TTATGAAGATGCTGTACATTCTGGAGCCCTTGATGACTGATGTGATCTCCCTTTAATTTA
TATTAATTTTAGGTGCAATGTCTTGTGTCCTGAATATTACACATTAAAGTACAACAAGCT
AACAGTTTTCGTTTGTGTGAAGTAGGAGATGAGTTTATTCCTAGTTTTGGTCCTGATTTC
ACAGTATATTACTACTTAGTACTTCATTAATTAAAAGAAAAAATGAGATTTAATTTTAGA
CATAATGTGGTTTTTGTCCAGCTGTTCATACTCTGTGAACACATTGCTGTTCCCATTCCA
CCTAAATGCACAGGGCCACAGGCCACGCCTTCCACCCGTTCTCTCCAGTGTGTGTAACAG
GGTCATAAGAGTCCAACGGCTGGGTGCTCCTAGAGGATGACTTTTCTTTAGTGTCCTAAA
GGTAAAAGATTTTTCTCCTTGTCATCCTTCTCCTCTTCTTCATATGGACTGAAACTTCAA
ACTGAGCTATTTATTACCTTTCCTTAATTTAGGGTGTTATTTTGTCTCAGCAAAGACAAA
TATTCAAGACTTATCCATTGAGAAACATTTTCTCTTAATGACATTAATTCCATCCAGCAG
GTTAAGAATATTCCCTGAAAGGTACCTTTAAAGTATAACAGTTAAAATGTTAAGTACATG
CACCTGCTCACTAGGGTGAACATGAACATTGTGTACTGTAGCATATACTAATTAAATAAT
AGCAGCCTTGGGATATAGCTCAGCCGCATAAGCTGCTGCCTGGCAAGTGTTGTAGGGTCC
TGAGTTAAGTTCCCAGTACCAAGAAAAAAACAAAGCACATGAAGCTGGATATGGTGCACA
CTTTAATCCCAGCACTTAGGAGGCAGGTGGGTTGTCATGAGTTTAGACCAGCCTCAGCTA
CAGGATGAGTTTAAGGCCAGCCTGAACTGCATAGTGAAATTGTGCCTCAAAAAGGTTTTT
TTAAAAAAGCAGGTAAAACCTGATAAGAATAACAGCCAGGGATGGTGACCCACGCATGTA
ACCCTAGCACGCAGTTTCCA
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1064, 2268..2353, 2534..2662, 3918..4015, 4406..4516, 4947..5128, 5398..5524, 9255..9430, 9905..10028, 10313..10505, 10636..10799, 11703..11919
1001..1064, 2268..2353, 2534..2662, 3918..4015, 4406..4516, 4947..5128, 5398..5524, 9255..9430, 9905..10028, 10313..10505, 10636..10799, 11703..11916
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved