Cavia_porcellus Locus ENSCPOG00000000429
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ENSCPOG00000000429
Cavia_porcellus
ENSCPOG00000000429
GeneScaffold_1989
SNORD100, SNORA33
1320..1395, 1666..1800
2956
TCTTCTTAAATAAGCTTTTACATGACATACCAAAGCTAAAGTCCTTGGAACAGGCCTAG
ATGATGTATTGGCCCAGGAAAAGATTTCAGACTATTCAAAAGTTTTTTTCTCTTTATGAT
AAGATAATGACATTATCAACATTCTATAAAATATCACTCAAGTAATTTATCCAGTTCTCC
TCAAAAGAGCCAAATGATTTGTTGTCTACTGACTGTTTCTGTGATGTCAAACTAACTTAC
AAATTAAAAGGCTCTGTTTAAAAGAGGTAAATAAAGGTATTCAGTTCCTACNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTATTTAGTTTTGGATTAGGATGTTTAGTT
TCCTTTTGGGATTGCGTACTATTGGTGGAGTTGTTATGTGTTTAAATTTTGATGTGAGTT
TTTAGGGCTTCAAGCCTGTTAAATACTTTGCCAGTAAAATTCACTTGGTAAACTACTAGG
ATGAGTGCAGTGGAAGTAGTACAAATACTTGGATATACTAAGGCAGGTAAATGAAATTTG
TTACAATTTTCTTGGCTCAGCAGTAATAATGCAGTGGTGCTTCTAGGTTTGTAATAAATG
TCTTTGGTGGTCTGCATCTAACCCAAGAAGGCTTTGGGTGTGTGAAACAGACATAAAAAA
TGGACATAGCTTGGCCACATGTTTTTTACTTTACTGTATAAAAGTTTTGGGAGGTGAATT
GAAGATCAGTATTCCAGTCTCCAGCCATCTTGTGGCCTGACAAGTTTGTCACATTGGAGC
AGTTTCACGATATTTATAGTGTACTAATTAACAGGTGTGTTTCTCTGTTGCTTGTATTTT
GCCCATACGGCCAATGCAAAGGATCTTCCTTTAGCAGAGCCAGAGTAGTGGGTTTAAAAC
TGGAGCTTTGGCTTCATCACAGTTGTGTTTTGTGTTTCAGACGCCAAGCTCATCTTTGTG
TGCTTGCATCCAACTGTGATGAGCCCATGTATGTAAAGTTAGTGGAGGCCCTTTGTGCTG
AACACCAGATCAACCTCATTAAGGTGAGTGGCTTTTTCTGTACTGCTCAGAGCAGTCTTG
GTTGAGTTGGGTCAGAATTAGGACAGTTGCTGTCTGAGGCTGATAACATTCTGCAGATAC
ACTCATTACATGGGTTTGGCCTACATCTATGCTGATTATCAAAGCATTTTACATCTGTGG
AACTAAATGTGCATTTTGGCTAATAGAACAAAAAGGTGGGGTGCTTAGAGTGGTTTTGGT
GCTGTGCATGATGACAACTGGCTCCCTCTACCGAACTGTCTTGAGGAAAATGCCATGTCA
CCCTTCTGATGACAGCTACCTTTCAGGCTTTAATGTATTTTGTCAGTAGCGTTATTGTCA
GCTAATACAGTGTTGTTTTTACATTGCCTAATAGGTTGATGACAACAAGAAACTAGGGGA
ATGGGTAGGCCTCTGTAAAATTGACCGAGAGGGGAAACCCCGCAAAGTGGTTGGTTGCAG
TTGTGTGGTGGTTAAGGTAAGTCGGTATTTGAAATTTTGGGGACCTCGTAAGGGGGGAAA
TGTAGTCTGAACAAGTTTAAAAATGTTCTGATAAGCCATGATTTCAAAGCCAGCTATGAA
TCTGCTTATCTGTAAGTGTTTGTGCAGAAGTGTAACACCAAAAGCTGGCGATAGTAATGC
CATGTTACGAGCCTTAAAGACATCATTGAAGTCATTAAGGTCCCTGAAAATGGCTACACG
TTTTAACGCTGGAAACATTTTTATAGGACATTCAAACCAGTGGGAAGAACTAGTGAAACT
TGAATAATAAATGCATGTAATTCTTTTTTTTAAGGACTACGGCAAAGAATCTCAGGCCAA
GGATGTAATTGAAGAATACTTTAAATGCAAGAAATGAATAAATAAAAATTTTGGCTCACT
TTATTCTCTGGCTTTTTATTTATGGCAGTAAATTGAGGTTTGTGTTAATGAAAAGACAAG
TAACACGCAAAATGGCCATTCACAAATTGACTCATTTGACTTTAAAGCCTATTCATTGGC
TCCATGCTGAGACGTTGAAAGGTGAGCAGTCTCATGTTTTAAGTGGGGAGTGGGCAGTCA
TCCTTGTAGACCATCCCAAAACTACAGAAAAAGGCTGAGCTGAGCTGAGGGTGCAAACGG
TGATTTGCAGAAGCTGGGTGAGCCAGGAAATGAGCAGTGTAATAAGCACGGGGCTCCATG
GAGATGTGTGTTGTTGGTGCAGCCTACATTGGCCTGATTGTTGCAGAAGCGGGAGATCTC
TTACAACACAGCCAGAAAACCCCATGGAGAAAATGGCCAGTTGGATTTCGAGACAGTCTG
GTTAAGGCCTGGTGTCTTGAAGACCAAGTTTTATTCAAGTGAGTTCAATGCTTGTGTTAG
TCCCCACCTGACAGTAGAACCTGTACTGGTTATTAGCCTGAGTGCTTATCTATATACTCT
CCCAACATGGATAAAGGGATGCCGCCCAGGTTAAAAATGTTGACTCCAGTGAGACTAGCA
GCTTTAGAGCTGTTGTGCTGGTGAGATCTGGAATTGAGCACTAGAGTTGTCAACTCGGTG
CTGCATAGTTTCTCTTTTTTTGGCTTTTTTGGGAAGGGGATTTCAGTTCAGGCTGGCCTT
GAGCTCACTTTGTAGCCCAGGCTGGTCTCACCACGATCCTCCCCACCTCAGCCTCCTGAG
TGCTGGGATTACATGCATGAGCCACCAGCGCCTGGCTCTTGTGTGGTTTTTCTAAGGAAA
GCTTTNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1102, 1474..1575, 1894..1956
1001..1102, 1474..1575, 1894..1953
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved