Cavia_porcellus Locus TNPO2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus TNPO2
Cavia_porcellus
TNPO2
GeneScaffold_3081
SNORD41
7525..7596
11846
CCCACTTGCCCTAGGAGGTACCTTCACAGTGCTGGGTGGGGAGCAGGGCCCCTTGAGAC
TTGGGAGTAGCATCTTCTACCCCCTGGGAAACACTGCCATCTTGTGGAGTTTGGTGAGAG
CGCCTGGCTTCAGCTGGGCTGCCAGGTGGTTCTGCTGCCTTTAGGCCTCCCAAATCTGCT
GTATTGCCTGTGGGTGTCCGCACTCAGTGGAGTCCCAGCAGCTGTCCTCTGTGCTCCCCA
CTTCCCACCTCCCTCCTCCCACGCTCCTGTTCATACATCTCTCTGTGAGCATACTGGGCC
TTGCCTCCCCTGGGCCTTTGCCCTGGCCACACTCTCCCCAGATCCCTGGATTTCTCCTTC
CTAACTTGCTTTGTCTCTCTCAGGTCTCTGCTCACATGTCAAGGTGTCACCCTGATGACA
CCTGCTCTGACCCCCAGCTTAAAATTGCTCTCTTCTCTCTCACCCCTTGCCAGCCATCTT
TTCTCTTTTATTGCCCCCTTTGGCATGGGGCCTCCTGGTTCTCTCACTTTTTTTCCTTTT
CCTCCTCTTTTTTTTTTTAATTTATTGGTTTATATTTTAGTACTAGGAATTGAACTCACG
ACCTCGTGCTTGCCAGGCATGTACTGTGCCACTGAACTGTATCCCCAGCCCTACTTTTTT
ATTTTGAGGCGGGGTCTTGCTAAGTCTCTTTCAGTTACTCGGACTGGGCTGAACCTTTCA
TCCTCCTGTCTCAGCTTACTACAGAGCTGTGGTGACAGCTGTGTGCCCCGTCTTCACGTA
GGCTGGGGCTGGCTCACAGAGAGATCAGAGGGTGTTGGCAGAGTCAGCTGATGCTGGGGC
TGTGACTTGGCCCGAACACTTGCCTGGAATGCACGAAGTCCAAGTGTGATCTGTAGCACC
CTCAGCAGAGGGGGCCATGTAGGCTGCAGTGGGGTGATGAGTATGGCGGGCAGGGCACAG
GGCCACCCCGAGGCCGCCTCCTCTGCCTAACTGCCCCAGGTATTCTCATCACCACCATCG
CCTCCAAGGGGGAGCAGCAGATGTGGCCCGAGCTGCTGCCTCAGCTGTGCAACATGCTCA
ACTCAGAGGATTACAATACTTGTGAGGTGGGTGGTGGGTTGCAGCCTCCGTCCAGGTAGG
GACCAGGGCCTGGGCTGGGACCAGGCCCACCTCCCCATCTTTCCATGCAGGGGGCCTTCG
AGCACAGCAGAAGATCTGCGAAGACTCCTCGGAGCTCCTGGATAGTGATGANNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNGTTTTTTTTTTTTTTCCCCTCCCGCAATACTAGGA
TGAAACTCAGAGACTTATACCCCCCAGTTCTTTTTTTATTTTTTATTAAAAATTTTTTTT
TTTAGATATCAGAGATGAACTCATCCCTTCCCTTTTTTATTTTTTATTTTGAGACACAGT
TTCACTTAAGTTACCCAGACTGGGCTCAAACTTGTAATCCTCCTGCCTCAGCCTTTCAAA
TTCTGGCATCACAGTCACAGTCTCATGCCCAGCTTATTAGGATAATGGGTGGGGGGCTGG
GGCAAAGGCTGAGACCAGAGTAGACAGTGGGGTTGTTTCATGCAGACAGGGAGTTCTGTC
AGGACTCTGCAACTGTGAGGTCCACGGGCTCTGCTGAGGGTCCAGGCGCACACCTGCTTG
TGTCCCAGCCTGGCTGGCTCATCCCGTCGCAGCCATGTTGCCTTGTGCTGTGCTGGGGAC
CAGGTGCTGCTGCAAGGTTTCCAGTGTATTCTGAGCTTTGGGAGGTACTGGGTGGCCAGG
TCTGGGTCAGGAGCTCTTTTGTGGTGCCAGGAATGATGTCATCTCATTACGATGGCTAGA
CGTAGGCTGGTCCACGTGGGAGTGCACAGCCTGAGCCCTGCCAGGGCCGCTGCCCGAGCT
CCTCCCCGCCCGATTCCTTGAGCAGCCTCTCTCCTGCAGGTTGATCCCCATCCTCGTGAA
CGGCATGAAGTACTCCGAGATTGACATCATCCTGCTCAAGGTCAGGCACAGGTGGTGAGG
CCGGGGCTGTGCTGGGCTGAGGTCTCCAGTGTGCTGAGCCCTTTGCTTGCCCCAGGGGGA
TGTGGAGGAGGATGAGGCGGTGCCTGACAGTGAGCAAGACATCAAGCCACGCTTCCATAA
ATCACGCACGGTGACGCTGCCCCACGAGGCTGAGCGACCCGATGGCTCTGAGGACACAGA
GGATGATGATGATGACGACGCACTGTCTGACTGGAACCTGAGTGCGTGGCTCACTCTGGG
GACGCAGGGTGGCTTGCCTCCTTGGCAGGGGGGACGTCCTGGCTGAGTCTGCCTGCCTCT
GTGCCCTGCAGGGAAATGCTCTGCAGCTGCACTAGATGTCCTCGCCAATGTGTTCCGGGA
GGAACTGCTGCCCCACCTCCTGCCCCTCCTCAAGGGCCTTCTGTTCCACCCTGAGTGGGT
GGTCAAGGAGTCTGGCATCCTGGTGCTGGGGGCCATCGCCGAGGGTGAGTCCTGCCTGCC
TGCCTGCCTGCACCCCGAGCTGCCTGCCGCTGCCCTGCATTTTAATGCGAGTCTTGGAAC
TGGCCTGGCAGTGCTGGGTGGAGGCCTTATTGTCCCTTTCTGAGAACTCCTGGTTCTTTT
TTTGTTTGCTTGTTTTGTTTGTTTGAAACAGAGTCTCACTATGCAGTTCAGGCTGGCCTT
GAACTTGTGAGGATCTTCTTGCTTCAGCCTCCTGAGTGCTGGGGTTAAAGGTGTGTGCCA
CCCTGCCTGGAGAACTCTAGATTCTTGGTCCTCCCCTTGGCCTGTATTCCTGAAAGGAAC
CCCAAACCCCAGCATGGAGGCCTTTGGCTTGGTTCTCCCAGGCAGGTCCAGCTCGGCAGG
CCGGAGGGCTCTGCAGCTGTCATACACCTGGTGCTTGCCACTACCTGCACATTACTCCAG
ACCCCCAGGGTCTCAGACAGCAGGTCCCAGAGTCAGCGTCTCTTTGCTGCAGTCCCCAGG
GCACTGCTGGGCCTCGAGCATTCCTGCTGAAGGAGAAGTGGCCAGCAAAGGCGTTTGCGC
AGATTGATGCAGCCCACTGTGTTGCTGGTGGGGTTTTTCAGCTCCTTTTCCCAGGGGCAC
ATAAAGCATGGCTTAGGGCAGGGCTGTGGCCTTTGCTGCACATGCGGTCATGTGTGACTG
CGTCAGAACCCAGAACAGCAGCAGAATCCCAGAGCTGGATGGCTTAGTTGTTTTGTTTTT
TCAAATCTATTTTAATAACAAAGAGAAAACAAAACAAAATTTCAAAACACATCCATCAGG
GTAGCAGTGGCGCATATGTTGCACATTGTCACCCCCAAATCATTTCCCCAGAGTGCAAGA
CATCTGCATTCAGTTATCTGAACTATACTGGCACAAATCTTTCTCTTTGGTGAACTCCAA
GAAATCAGTAATCTTTTTTATATACATGTATGTGTGTGTGTCTGTGTGTGTATACATAGT
TCTTTCAGCTTGTCACACTAGTAAGACAACACAGTGTTTGCACGTGTATCTTCACGAATG
AGTATGTTCTCAAGTTGCATCTATTCACCTATAAGTCTCTAGCTTATCTATGACTAAGGA
GTACTCCATTGTATAAAAATGTCTTTTTTTTTTGTACCAGGGATTGACTCAAGACCTAGC
ACTTGCCAGGCAGGCACTTATGCCACTGAGACAAATCCCTGGCCCTACCACATCTTTTTT
ATCCATTCCTTAGATAATGGGCATTTAGGTTGTTTCCAAGTCTAGCTATTACAAATTGTG
CTGCTATAAACATGGGTGCACATATATCACTGTGGTATGATGTTTTTCATTCTTTTGGGA
AGATATATAGAAGGAATAGCTGGGTCGAATGGGACTCTATCTAGTTGTAGTTTTTGAGGA
ATCTCCACACTGATTTCCACAGTGGTTGCACCAGTCTGCATTCCCACCAACAATGGAGAA
GGTTCCTTTTTCCCCACAGCCCTTCCAGCATTTATTATTGGTTGATTTCTTGATAATGGC
CATTCTTCCTGGGATGAAGTGAAATCTGCGCTTTTTAAATTTGCATCTTGAATNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGATGTGGCTCAGTGGAGTGTTTGCATG
GCATATGCAAGTACCTAGGTTCTATTCCCGCACTGCAAAGAAAAAGAAAAAAAAAATGTG
TATGCTTCGTGTAATCCCAGCACTCTTGGGAGGCTGTGGCAAGAGAATTGCAAGTTTGAA
CCCGGTTAACTCGTGACTTAGTGAGACCTGGCGTCAGAGCAAAAAGGACTAGGGATGTAG
CTCAGTGCAGAGGCCCTGGATTCAATCCCTAACATGTTAAACAAACAAACAAAAAACCTC
AAGGGAAAGGTTTCTGGGTGTAATGTGTGTCCTGTGTGAGGAGCGTGTCTTATCTTGGGC
AACATGTGTGCATCTATTAAGGGTAGTCTGTGTGCAGTTTGTAGTGACAGGGAAAGGTCT
AGAGAAACTGACTGCAGCCTGGTAGAAGTAGACTACAGTCTGAGTATTGCAGAGATGGGA
GCAAGGCTAGCTTGAACACATAGTGCCTGGAACTAGCGCCCTACCTCAGCTGCATCCTGG
ACACCCTTGTCTTTGCCTTCAGTAGGTACAATACAAAAGCCTGCTCATCCTCTTCCACCT
TGTCTTTAAGACAAGTCTCGATATGCAGTTCAGGTGGGCCTTGAGCCCACTTTGTAACCC
AGTCTGGTCTCGAACTCGCTGCAATCCTCCTGCCCCAGCCTGCTGAGTGCTGGGATTACA
GGTGTGCGCCACCATGCCTGGTTTCCACCTTGTCTTAACAGCCCAACCACCACCACCAAA
AAAAGAGAGAGATGCTTGATTCTAACAAAAAGAAACTAGGCTCAGTTACGTATACCTGTA
ACCCCAGCACTCTGGCAGGAGGTTCACAAGTTGGAGTCCATCCTGGTGAATTTAGAGGAA
CCCTGTCTAAAAAAGTAACGGAAGGGACTGGCTTGTAGCTCAGTGGCAGTGTATCCCAAT
GGCTGATCCCAGGACCACATCGGAAGAGTAGGACATGGTGTGAGTTGGTGGTGGGACATT
GGCTTAGTGTGCTCAAGATGCTGGGTTGCATCCCCCTGCACTAGAGACAAAAAGCCTCAG
CTACTCAGGAGATGGTAGTTCAAGGCCAGCCTGGATAAGTTAGCAAGCACCTGTCTTGAA
ACTAGAAAAATAAAAAAAGAGGGCTAGAAATGTATGTTAATAGTGGAGTGTTGCCTCTGG
GTTCCATCCCAGGACTTCAAAAACAGTTAAAGAAACACGCGTCTAAGGGTGTCAAATGAG
AAGTGCTTTGGTGCTTCCAACCCAGCTGGGCTGCTGTGCTACTCCTGCATCTGAGAACCA
GTAAGTAGCCAGAAAAGAGCAGCACCAGATGAGATGCAGCTCGTGTTTTCCTCCTGCCTG
TCTTTGCCTCTCATCAATTACTCGAAGTGACTGTGCCTGTTTCCCCACACCTTTCTGTGA
GGACACCATGCCTTGGTCTTATCCCAGGGCCCTTTTTTCTCTGGTTTTTAGGCTGCATGC
AGGGCATGGTGCCCTACCTGCCCGAGCTGATCCCACATCTTATCCAGTGCCTGTCGGACA
AGAAGGCTCTGGTCCGCTCTATCGCCTGCTGGACTCTGAGCCGCTATGCCCACTGGGTGG
TCAGCCAGCCGCCCGACATGCACCTTAAGCCCCTGATGACGGAGCTGCTCAAGCGCATCC
TGGATGGCAACAAGAGGGTGCAGGAAGCAGCCTGCAGGTGACCTGACCTCCTGAACCCAC
AACTACTCTGAATGCCCACTAACCCTGAGAAGTGATGACATACTTATGTGACTGCTGACA
TGCCCTGATTTCTCTGTATTCGTACTGGCTGATCCCATGGGCACCTTCCTTCCCACCTGC
CTGTGGCTGGTGCTGCTGCTGGGTCCACTGAGCCCTCTGCCTCATCCTCCCCCCAGTGCC
TTTGCCACCCTGGAGGAGGAGGCCTGCACGGAGCTGGTGCCCTACCTCAGCTATATCCTG
GACACCCTCGTCTTTGCCTTTGGCAAGTACCAGCATAAGAACCTGCTCATCCTCTATGAT
GCCATTGGCACCCTGGCAGACTCTGTGGGCCACCACCTCAACCAGCCGGTGAGACCTCAG
AGTGGTCCCTCTTCCCCAGTGACAGTCCCAAGTCACATATGTGCCTGGCCATCGGTGTGG
CTGAGATCTGGACAGATGGCCCCTTTGGACCCGCCCTACCCTGCTCCCAGTCTAGAAGGG
AGGTAGTTCTGAGACACTGGGGTATGCCCTGTGCCAAGGAGTTGGGAGGCACCGATGTGG
ACAGGCAGAGGAGCATTGTCCTCCACCCATGGAGCCCTACTTCCTGCCTCTCTCCCAGGA
GTACATCCAGAAGCTGATGCCCCCACTTATCCAGAAGTGGAATGAGCTCAAGGATGAAGA
TAAGGATCTCTTTCCCCTGCTGGAGGTGAGTACCTTCAGGTCCCTTCCCATCACCCCCAG
GCCCTGCCTGGTATCACCTTGGTGCTCCCTCTCTCAGTGCCTGTCGTCAGTGGCCACCGC
CCTGCAGAGTGGCTTCCTGCCCTACTGTGAGCCTGTCTACCAGCGCTGTGTCACCGTGGT
GCAGAAGACACTGGCTCAAGCCATGGTGAGCACCTGATAGCACCTACCCACTCTGCTGCT
GCTCAGCTCTGGCTTGCGCACTCCTCACTCTGCTCCCGCCCTCCTGTACCCAGATGTACA
CCCAGCACCCCGAGCAGTATGAGGCCCCCGACAAGGACTTCATGATTGTGGCATTGGACC
TGCTCAGTGGCTTGGCTGAGGGCCTGGGTGGCCATGTGGAGCAGCTGGTGGCCCGAAGTA
ACATCATGACATTGCTTTTCCAGTGCATGCAGGTGGGTAGGTGCCCTGTGCAGATCAGGA
CCTTCTCTGGCCTTTTCCGAGGACTGGTAGTGAAACGGGCACAGTGACCACACCCAGCAG
CTTATGGGAGGTGCTAGGTTTCTGCTTGTGCCTGACAGACATCAGGGGAAAGGAAGCCTG
AAAAGAAAAGCTTCTGAGTGTTTAAAAAGTGATTCAGAGCCAGGTGTGGTGGTACACCCC
CATCATCCTAGGACTCTGGGAGGCTGAGGCAAGATACTTGAGCCCCGCCTGGGCAACTTA
GCAAGAATAAGGAACTCTTTTAAAGGGTCGGGAATGATCTTCAGTGGGAATGAAGGCCCT
GAGTTTAATCCCCAGACCCCAGAAATGTGTTTCAAGTAAGGCAAATAAAATCTCATTAAC
GAAAGCAAACACAACTTGATAAGATGTTCACCTGTAACCTGAGCTCCTTGAGGCTGAGGC
AGGATGATCTCAAGTTCATGGGCAGGATAGTAGATGTAGCTCAGTGGTAGTGTCCTTTGG
CTGTAGGACCTCAGCCTTGCCCTCCAAACGATGAAGACACAACTCCTGGGAGGCCCATGA
CCACATTGGGATAGGCTGCCACATTGTCTGATAGGCTGCCCAGCCCATTCCACAAGTTCA
TCTACTTTCGAAGAGTAACAAAGCAAACAGGGCTAGCGGTAGAGCTTGACAGTAGTCTTT
AGCTTTGCACAAGTGAGGCCATGGATCCCATTCCTGGTTCCAGCATGAACAGCGTGAAGA
AAAAGAAGCAAACAATGTTGAAAATCAAAAATAGAAAATGTGAGGCTGATTGTGTTGGTT
CTCTCCTGTCATCCTAGCACTGGGAAGGCTGAGGCAGGAGGATTGCTGGTTGAGGCCAGC
CTGTACTACACAGTTTAAGGCTAAGCTGAACTGTATAGCAAGACCCTGTTTCAAAAACAA
AACAAAAATAGAAATGTGAAGGCATCTGCTGTCCTCCTCGTATAGCTGTCTCTGTCTCGG
TGATTCATGGTAATGTAGCTGCTATGTAAATAGTCAGGTATGTGCTACTCTTCAGAGGGT
GATGATCAGAGAGAGGCTGCATGTGAGCAGGACAGCCGCAGGGCTTCTTATGCAGTGCTG
GACCACACTGCTGCTGGCCAACAGCCCTGGTCCTTTTGGTTTCTTTCTGAGCATTTTCCA
TCCCTGGTTGGTTGGATGAACCTGCAGACGCACAGGTAGCTGTGGATGCAGTTGGCGGCA
GTGATGTGTCTCTGCAGCTGTGTCCCTAGAGCTGGGTCCCAGTAGGGGACAGGTGGCTGG
AGCCTCCACCCTCAGGGCCAGGAGGTATACACTGACCCGTCTCCACCCCCTAGGATTCGA
TGCCTGAGGTCCGGCAGAGCTCTTTCGCCCTCCTGGGGGACCTCACCAAAGCCTGCTTCA
TCCACGTCAAGCCCTGCATTGGTGAGCCCCTGTCCCATCCCCAGCCTTGTGTGGTAAGAT
GTGCCCACCCAGAGAGGACCATGACCAACTGGGATGTGTCCGTACTGCCTGCTGGCCAGT
TGCAGGAGCTCATCCACGCTGGCCTTCCTGCTTACCCCTCTCCTTCCCCACCAGCTGAGT
TCATGCCCATCCTGGGTACCAACCTGAACCCCGAGTTCATCTCTGTCTGCAACAATGCCA
CATGGGCCATCGGGGAGATCTGCATGCAGATGGGTGAGTCTTGTCCTAGCACGGGTGTGG
AGGCCCAGCTCTAACTGACAGACTCACAGTTGACTAAGGCCAAGGGAACGCAGTGGAGGG
TTTTCCTGGGGGCAGAGTCAAGGGCTGAGAGACCATCTGTGATTGGTTTTTCCAGAGGTA
TGACTAGAGGGCAGCTTGGATTGGACAATGGACGATGGTTGGCCAACTTGGGCTACTTTT
CCCAAGGGAGGGGACTTCTGGGCAGTGTGGTCTCCTCAGTCTGTCCTGGGACTCTTGAGA
AGACTGGTGTTGGGAAGGCCGGGGGTCTGTCTGTCTGGCCCATGGCTTCAGCTGGGAAGC
AGCCAGAGGTGCTGCACTCCCTTAGTGGCTGTGGCCTTTGGGTGGCCATGGGTCAGGAAG
TGGGTTCGGTACCCTTGCATGCCCACTGTGAGTGCAGCAGGCAATGCAGCAATCTGCTTG
GCGGGTTCCCAGGGGCCGAGATGCAGCCCTATGTGCAGATGGTCCTCAACAACCTGGTGG
AGATCATTAACCGGCCCAACACACCCAAGACACTGCTGGAAAATACAGGTGGGTGTCAGC
TCACCCGCCTCTTGTCAGTGGGGCTCTGGGCTGGCCAGGGAGGGTGTCCTGGAAGCCCTC
GATGGGGGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNN
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1105, 1190..1198, 1201..1249, 1251..1323, 1852..1933, 2034..2156, 2257..2375, 3579..3639, 3715..3880, 3971..4123, 7251..7476, 7676..7847, 8098..8184, 8257..8364, 8453..8611, 9953..10040, 10194..10292, 10752..10846
1001..1105, 1190..1198, 1201..1249, 1251..1323, 1852..1933, 2034..2156, 2257..2375, 3579..3639, 3715..3880, 3971..4123, 7251..7476, 7676..7847, 8098..8184, 8257..8364, 8453..8611, 9953..10040, 10194..10292, 10752..10846
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved