Cavia_porcellus Locus ZNF605
snOPY snoRNA Orthological Gene Database
Cavia_porcellus ZNF605
Cavia_porcellus
ZNF605
GeneScaffold_632
SNORA73
15762..15965
21583
TTTCTTGGGAAAAGTACAGGTAGCATGTGTCCTAGTGTGAGGTGAGAAAGAAGCAATAT
AAAGATTTCCTTAAACCTTTGTCTTGGGCTGGGGATTTAGCTCAGCAATTTAAGCGCCTG
CCTGAAAGTGTGAGGTTATGAGTTTGATCCCCAGTAACAAAAAACAAAAAACCAAACAAC
AAATAGGGGGTCTTGCAGTACCCTCTGCCACCACCTGTTACAGGCTGAAGCTATGGCTCT
ACTCAGTCTCAGACCCAACATAAACTAACCTTGCAGTCTCCCGAAAGATTATCTGTTTCA
TTCCATTTGTTTTTCTGATTCATGTTTTTCTTTTGTTCCAGGGCTTATTTGGAGGTAGGG
AGCCAACCTACTACGCTAATGAAACATTTCCATTTAATAGCCATTTTATATTTACCATAC
TGCCTAGGAATGAGTTACATTTTTACTTACAGCATCTATGCCAATTATTTCATGTAAATT
AATAATCCCCCCATCAGGGACCATTGCTATAGAAAGGATGAATTGTTATTATTTCCAGAC
TTTCTTGATGTCTCTGTAGAGCAGTTTGGTGCAGTGGTGTGCTTGCTAGGAGTGTTTGCT
TGAACCAGTGAGGTGAGTAGCTTCAATGCGGTGTTCATGAGTAGAAGCCAGGACGTGGCC
CAGCAGTGGCCAGCCTCAAAGAGACATGTCATCTTCCTTCCTGTTTTTTACCTAATAGGA
CTTATTTGCATCTATCACATATCTAGTGTTTAAATGATCTGAATTACTAGAAAGAGAAAA
ACAAGATTTAGGTTCCTCAATGAATGACATCATCTAAAATAACATGTCTGCTGTATCTGC
AGGCCCTTGCTCTCAGGAACAAGACAGTTCATATGCAGCAAGTGAAAAAAGGCTTCAAGA
ATGAGAATGGATTCTTACTTTCCAAACCTTTCACCAGAGGACTCTCTCCAGTCAGGACAG
ACAGAAATTCCAAACCAGCAGCTTTCCCAAGATCAGTAGAAATGATTGAGTCACAGGTGG
GTTGTTTATTCTCTTGGAAGATTTTTAAATTTTATTTTATATTACTTTTGTGGTATAATG
AGGCTTACTAGAATCTCTACACAAACAGAAAGGTCTAAATACATTTAAATCATAATAAGA
GAAATANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTGCTTCTTGATCAATTCTG
CCAGTCTATGTCTTTGGACTGGTGAATTAAGACCATTAACATTGATGGTTAAAACTGGTA
TGTACTGACTTATCCTTGTCATGTTATTTTCCTGTTGTTGGCTCTTCTACCTCACACCTT
TTATTTCTTCCCTCTAATTGTTTGCCTTCCTTGGTGGATTCCTTCTGTTGGGGCTCATAG
AGCTGTAGTTCTTCTTACCTCTTTCTAGAATATCTTTCAGAACATTATGAAGTGCTGGTC
TGGGGGGGGGTCATAAATTTCCTCAGGTGTTCTTTGTCATGGACGTATCTTATTTCTCCA
TCAATTTTGAAAGATAGTTTTGTGGGATACAGCAATCTGGGTTGAATGTTGTTTTCCTTT
ATAACTTGGAGTATTTCACTCCAAGCTCTCCTTGACTTGTGAGTTTGTGCTGAGAAGTCA
GCTGTGATTCTGATGGGCTTTCCTTTATAGGTGATTTGTTTCTTTTCCCTAACAGCTTTT
AAGATTCTATTCTTGTGTTGAATTTCTGGGATCTTGACTATGATATGGCGGGCTGCAGAT
TTTTTTTGATCATTGCTAATTGGAGTTCTACATGCCCCATTTATTTGTATGTCAAATTGT
TTTTCTCTACTAGGAAAGTTTTCTCATGATGTCTGTGAACATTTTTTAATGTCATTTAGG
GTATCTCCTGCTTTTTTATTGACTGCAATCAATCTTAAGTTATTCTTCTTTGTCTCCCCT
AGCAGCTGTTGGGTTGATTTCTCATGGTTCCTTGCTTTTGAGAAATCTTTCTTTTCTTGG
TCACTAACTGCAAGCATGTCTTCAGTATTTCCAATCCTGTCCTCACATTGACCTAATCTA
CTTTGAATACTTTCAATGGAGTTTTGGTGTGTTGTTTTTTTTTTTTTTTTTTTTTTTTTT
TGTCTTTTTCATTTTTATCGGTACCGGGGATTGAACTCATGACCACCTGCAAAGCAGGTG
CTTTATGCCACTGAGCTAAATCCCCAGCCCCTTCAATGGAGTTTTTATTCTGGATATCTA
CTTGAATCTGCTTTATGGATTCCATTTGTTTCCTATGCTACATTTCCATAATTTGCTTAA
ATTCTATTTTTTTGTCTGTCTGTTCTCACATCACTAAGTATGGTGTGTATTTTGGTAATC
TCTGTAGTAGAGAGATTATTTCTGATTTCATTTTTTTCTAGAGTCTCATTTGATTGCTTT
GTTGTTATCACTTCAGAGAGACCTGGTGGGAGGCATTTGTATTTTTCTACCTCATTGCCT
CCTGCATTTGCCTTTGGTGAACTGTATGTCTGGAGTTGCATCTTATTTAAGTGTCTTCTC
ATTTCTTTTTTTTTTTTTTTTTTTAGTTTAATTGCTGGGGTGATGTTTGTAGTTATGTGA
GTTGCTTTATTGGTGGTATTTAGAATGCATAGGTGATGATTACTTCTCTGAGGTATCTTC
CAGGTATAGCTGGTTTTGAGGGTTTAAGCCTGTTGGAAAATCTTACCTTTTCAGTTTGTT
GGAGAGGCGAAGGTGTTGCTGTTTGACCTAGTCCCTGGTTCTTTGGCACTGTGCCACCAA
ATTTTCTGTGACCCTTAGTCTCCATCACAGATTATCAGGGCCAACAGCTGTTTAGAACAA
TTATGTCAATTTTACTGTAGTGGTACCAATAGCATCAAACACAAACTATAAAGGAACAAA
CTGAGCTAACCCTTAATTTGCAACTTTTAATCAAATGAAATAGCTTTGTGATTATATAAC
AAAATGTAAAACAAACCAGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTC
TGCACAACCGATCAATCTAGCTTCATCTGCTGCCTACATCTCCACATTTTCTGTTTTGTG
GCTACACGTGATGGGTGGTCAGTTGAAGTTAGAGGTGCTGTGTTTGGAGAATTCTATAGA
TCTTTTTATTTGGAAGCCTTTTCATTTTGAGTGAATTTACTCGTTTAAGCTAAAGATTTC
CAGTTCAAGGATTTTAAATCCCTGCAGTTAGCAATTTAACCTTGTACAGTGCATTAATCC
ATAATGGTGGTCAATTACCAGTATAGCTGGCAATTTTTCATAAAGTGCTAGTGATTTAGG
TTTTTTTATAGCTAACATTTACTATGACATTGTTTTATACCTCTTGTGGTGTGTACTTTT
CTGCAGAATGTTCAAGACCAAGTTAAAGTGAGACCTGTATTAATTACAGTCAGTCTCTTG
TTACCTATGAAGGTCACTTACAGGAATTACCTGGGAACCATGCATAGCACCTCTTAGTAC
TTTTAGCAGTGTCAGCCATTTGGATGAGTCCTGGCCATTGCTTGACAAAGTTGCTTTTTG
TGAAAGTTTGTGAGATTTATCTCTTTTGGTGACTCTCATTAGACACACTGATGATCGGTT
TTGTCTCTTTGATCAGAATCTCTTCATAATCTCTTTGATCAGAAGACCAAGGACCCATTC
GCTGAGTTACAGGATGTTGCAGCAGAGGTTCTCTATGTGCTGGGTCCTAACTGACTTTGG
AGGGCCAGGGCCAAAATATTGGCTATCCTCTTAGCCCATCCATCTCTCTAATTTTTGTCT
CTAAACCTCAGTTGTTGAACATCCTGAAGAAAAGTTTAATGACATTAAGTTGTAATGGAA
GCAATAAGCTTAATATTACTATTATATCTGAATATCAGGCACTTTTGAATGTAAAATGGA
ACCATTAACCATGGATGTTTTAACATTTGAATTCTTATAAAATATTAATAGTTACATATT
CTGCACAGAAAATTAGAAATTAAAGCTATCATGACAATCATGATGACACTTTTTTTTTTT
TTTTTTTTTTTTTTTTTGGTACCAGGTATCAAACTCACAACCTTGAACTTGCCAGGCAGG
CACTTATGGCACTGAGCCATATCCCCAATTCCTATGATGACATTTTTATAACACACCTGA
ATTTCCATCTTGCAAAAAAATACTCCTCTTAGTCAGTCATCCCTGTCTAATACATAAGAA
GCTTTTACCCAACTTGTTGACCTTTAGTGAGATATATATCTCATAAGTTTTTGTTAAAGG
CAGAGGTCTAAATATGAAAAAAAAAAAGTCTATCACCATAAACAATCCTTGTTGTATATT
TTGGAAGGCCTGTACATCTGGAGGTGTGAGTACATTTGATAACAATTAATTGTCACAACC
ATATGAAAACCTTTGTATCAGAGCATCTTTAAATTAAAAATCATATTGTCTATAATGTGT
AATCTTTTGAGAATGACCAGTAAGAACACATCACAATTATTTATTTTAATAACTTTACTG
GGTATGTCTTCCATAAGGCTCTAGAGATCACTGGGGCCTCCCATCAATGAAAAAAACTGG
TTGTTACTAGACAGCCGCTTTCTTGTTCATCAGTTGAAGTCCTGTCCAATATTCTCCCCC
ATTCCTAAGGGATTTTTGTTTAATTTCTTAGTAATTCCTGATAACTCGTGAAAATTCAAT
CACAACATTTAACACATTATTTTGAACAATGAAACTCTCATGTCATAATGAACAAAAATA
TACATTACATTTACATAACCAACTTTAGCATCATTTTGAATAGCTGGCAACTCAGGTGGA
AGCATGTTTTTTAAATTTATAACCCAAAGTAAACTTTGATCAAATGATCCAAAAATCCAA
AAGACAAAAGAAAAAATTGTTGAGTTCAAATAAAAAACAGTTCACAGATATGACAGACAG
ACAAAGAAACAAGTACACAGCTTTAACAAACTAGACAGAAACATCTTTACAAAATCAGAG
CATACTCAAATATGTTTGACCAAATTTGAATTATAATAAGTTTTTACAACTTATATTTTT
TACAACTATAAATACACTAGTCAGATTTTATTGTAGGTAACTCAGCAGAGATCTTCTGCA
AGAAGATCTTGGAAAGAATAAAATGTTTTGGGGCTGGGGATTTAGCTCAGCGGCATAAGC
ACCTGCCTTGCAAGCAGGCAGTCATGAGTTCGATCCCTGGTACCGATAAAAACGAAAAAA
AGACAAAAAAGAAAATGAAAAAAAAAAGAATAAAATGTTTTAGTATATACAATTAGCATG
TATTTTTTATTTTATCTTGAGACTACTAGGAACTTTTGTGTCCCATTCTTTTATGTATCT
TTCAGTTTGGTTATTTCTGTATACTCTTACCACCTATTTAGACCTTTGATTTTTCTTTCT
GGTTACAATTTCTTGGACATCCTGGGTCAATTTCTTTAATTGGCCCCAGGTTGGCCCTGG
CTTTATCCTGGTTTATCAGTTGTGGTGTGGTCTCTGAGGCATCAGTCATGTCATAGGACT
GAGCATCAGCTTCTTTGAGGTGAAATTAACTTTTTTTTTTTTGTCTTTTTCCTTTTTATC
ACTACCAGGGATCAAACTCACAACTGCCTGCTTGCAAGGCAGGCACTTATGCTGCTGAGC
TAAATCCCCAGCTCCTGAAATTAACTTTTTTTCTGGGTCTAGATAGCTTGTTCTGGTACC
CAGATAAGCTGTTCAGCATTTTCTGGAAAAACACAAGCATACCCTCAAACCCAAAGTAAC
AATGGACAGTGCTTTCATTGTCCAGTATGAAAATCTCTCCAGAGGACTCTTCTTTTTCCT
TTCACCGTGATTGCTTTTCCTGCTGCATTAGTTCCATCTTTATTATANNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCAGGCCACCCCAGGCAACTCTCC
ATGCACTGCATCATTTATTTGCATTCTTAAAGATCAGTTATTGAACAATTAACTTAAAGA
ATAACTTTTTGGGCTGGGAATTTAGCTCAGCGGCATAAGCGCATGCCTTACAAGCAGGCA
GTCGTGAGTTAGATTCCCGGTACCAATAAAAAAAAGACCAAAAAAAAAAAAAGAATGACT
TTTTATCAAAGACAGAAATCTTAGCCTGTAATGTAGCAAAATTTCTCTGAACTGAGAAGG
CAGAAATTGCCATTTGTGGCTCAGTTAAGGCTGAATGCTTCTCTAGTGGGGCAGGGTCTC
CTTGTCCCTCACTGCTTCTTTCTTATCTAATTAAAAGCAAAGCCAGAGAGCTTAAGCTCT
GTTGGTGGTCTTCTTGCTTGGGCTTGATTTTAAAGTCATGCTTCAAGACAAAGCCTTTGT
TGTCCTTTTAAAGACTGAAGTACTTTTTGATGCAAATCCACAAAAGTAAAATTCAGGAAT
CAAGCGTGCAACAAACATATCTATATATCTATGTACATCTGTATAAATCTCTGGTTCTTG
AGACTGTTGCCCCATCTTTAACAACTAATAAAATCAATACATTTCTTTCCCTTTTGTTTC
TTGTAAGCCTGTTTGTGTCTCTCTGGCTTCTCTTAAGCCTGTTTCTCTCTCTGGCTTCTC
TTAAGCCCATTTCTGTCTTATCCCAGGTCCAATACCTGGTATTAATATCAGTTCATCACA
GTGATGAGTAACTGACCACTACCAGTGCACTTTTCCCTTTTGCACTCCAAATGAGAAGTG
TCCCTTGCCCACTGTTCTTACTCCAGTCTGTGTTCATGCACCAATTCTAGCATCCAGCTG
CAGCTTTAGATGTTGGGGGAGCAGGAGGGGATAGGAAAATTTTTTTTAAAAAGATGAAAG
ATGGGGTCAGGTGGAGCCCTCTCTTCTGATGGGAGAAAAAGAACTGTTCAACCACTGTAG
GGGATGTTCATTTATACATTTAGCAAGAGTAAAGTCATGTGACACCCCTTTGCTAGCATC
CCATTGCTTGGATTGCCTTGGGGCTTGGAACAGCTTGTTTGCCAAGGCATTCATTGCTCT
CTGACTGGCCTGCACATGTGGTCAGTCTCCAGCTTCAGCTGCTCCCTACATCTCTGTACC
ATGTGTTACCCCTGCCCTGAAAGTCTAAAAATACTTTTAAGTGTGATTTTTTTGTACTCA
TTTTTATATTTCTAGACCCTCTTAGAGTTTCTAGAACCTTAATTGATCAATATCTGTTTT
AGAAGAGAGCTAAGAGAGCTAGGTAGAGGGAGAGGAACGGAGACACTTCCATAGCCTAGG
AGGCTCCGAAAGAGGACATTCCGGGACAGGGCACGCTAGTAGGAACAGCACGCTGCAGTG
ACTTCAGTCACATGTTCTGCTCTCAAACAGGATTGGTGCGGAGTGTTTGGCCTGGATGAC
GCCGCTGACTAAGACCCAGTAGGCTAACCCAAACCAGGTCTCAGCGCCTGCTGCTGCACC
CTAGTAGTGAAGCCTTCAGTAAGTTGACCTGGAGGGGCAGGCCCAGCATAGGCTGCCCAG
GTCTGTGTCTCCCTAGTACACTGCAGTGGACAGGAACACCTAGGCCAGTGCAATTCAAAC
AAACTGTAACTGACAAGGAAAAAAACTGGACCTCTATATATGCTTGTATGGCAGGAACAA
AAAATATGGGAAGAGGGAGCAACAAGAAAGGGTCCTTGGCCCCCAATCCTGAGAAACATG
CAATGTCAGACATGGCACCAATAGACATTAAAGCGATATCTCCAGAGCTTCATAGGCGAG
TTTAGGAATGAAGTTATTAACGACCTAAAGCAAGATATAAGTAGAATAGTTAAAGAAATG
CTAAGTACCGCCCAAGAAAAAACAGATGGTGGAATGGAAGAACAGAAAAAAAGGGGAGAA
TTGTTTGATGGAGAACATAGAGAAAACATAGAATATGTGAAACAGGTTCAAAGGGATTAC
CAGGAAACTAAAAACTCTTATCGAAAGCTGGCATAACAGTTTGAAAGAAACTAAAGATAG
ATTATCTGAACTGGAGTGCAGATTTGTAATATGAGAGCATGAAATAGAAAACTTCCTAAA
GATAAGAAAAAAAACCAAACAGCAATAAAACAAAGTCTAGAAGATGATAAGAGGATCTAT
AACTTAAGAATTAAGAACATAAAAGAAGAAGTAGGGACACAAACAAATGGACTACAAAAT
CTATTCACAGAAATAATCCAAGAGAATTTCCCTAATTTAGCAAAAGGTAAAGATACTCAG
ATGTATGAAGCATACAGGACCCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNACTACCCCTAGAGGAAGAAA
TGCGCTTTTCTTTGAAGGCCCGGAAGGGTGACTGTCATTGCAAATAAAGTCCCAGCATCC
CAGAGTTCTGTACTATTGGACCCATTCCTGCTTAGCTAAGAACTGCTCTCCAAATACCCA
GTGGCACTCTTTGAGAACCACTGTGCTTAACTAAAGACAGCCTCCTCTTTCATATTCTAT
GGACTGGATAAATAACTCAATGATAGATATTTTCCTTTTCTTTTCTTTTCCTTTTCTTTT
GGTCTTTTTCATTTTTATCGGTACCGGGGATCCAACTCACGACCACCTGCTTGCAAGGCA
GGTGCTTATGCCGCTGAGCTAAATCCCCAGCCCCAATGATAGATATTTTCATAATACTTT
TGTTTATCTGTCAAAGCATAATGTGCAATTAGTATATCAGGTTAGTTATCCATAACTATC
TAACAAAGTACCCTGAACCTCAGTAGCTAAAAACAATATTATCTCATAGTTTCTACGGTT
TGGGGAGTGCCAGACACCTGCCTCACTGGCTGTGGATCTGCATCTGTGACACAGTAAGCA
GGTTGTCAAGAAAGGCTGCACCTGTCTGGAGGTCCAATGGGAAAATTAAGTCTCAATTCT
TTGCCATGCGGGCCTTTCCACATAGCTGTCCTGGTGGGGCTGTTCAGAGAAACAGTTCCC
AAGAAGGAAATCATATTTTCTTATAACCTAATGTGGGAGGTGCTGTCCCATCACTTTGTT
CTGTTCTGTTCACTGGAGTTAAGTCAGGCCAGCCTGCTTGGGAGGGACGACAAAAGAAGC
AAAGGGCACTGGCCACCAATGAATGAGAGCCCTTCTGTTCCATAAGACCTCACAAGACTC
GCTTCTGATTCAGCAGGAATTGTGCTTTTCAGATATCGTTTGAGGACATTGCTGTGGACT
TCACATGGGAGGAGTGGCAGCTTCTGAACCCTCCTCAAAAGAACTTGTACAGAGATGTAC
TTCTGGAGAACTACAGCAGCCTTGTCTTCCTGGGTGAGATACTCAGTGTGTATCCATTAC
TTGCAGGGGGCTTACTGATTTGGATATAAGTTTTAGGTATCAAAGAGGCTGGATATCTAA
ACCGATTTGGAAGATTTAGTCATTTGCTTCATTTTACAGCCTTTGAAATAAAAATTTCTC
ACACTTTAGTCTCTTAGCTCAAGCAACTGGGTCCAAGTCATTTGTTTTCCAATTACCAGG
TTATCAGATCATCAAGTCTGATGCAGTTTTCAAGCTAGACCAGGGAGAGTCCTGGATAAT
AGATGATGAAATTCTAAGTCAGAACTTTCCAGGTGACAAATATTCGATTATGTTAGAAAC
AATGGAAGTTATCTCAGGTTTTTGGTGATAAGTACTTTCACAATGTTGGTTATATATTTT
ACTTAAAGTTCCTAAATAGTTAGGTTCAAGACTGTTATCTTGATTTACTGTGGTTTTTAT
TTAATCTTCTCTATGACCTAGTTTCCACAACTGTCTTTCTGTTTTGCAGTACTGGGGATT
GGATTCAGGGCCTTCATACTGAGCTGCATTCCTAGCCCCCCCCCTTTCTTTTTTAAATTC
TGAAATAGGGTCTCACTAAATTGCTGAGTTGCTTGGATTGAGATTCAGCTTATAGTTCTT
CTCCTTCAGCCTCCCTGAGTGCTGAGACATGAGACACTATACCCTCTCGGGTATGTACCT
ATGTAGTACACAGATCTACAGCCAGTCATCTAGAGCCCTGCCTCTTAAAATAAAGTAGTT
CTTTTTAATTAGCTACCTTCTCTGCCTTCTTCCCACCCTCAAGTCTAACCTGTAGAAACA
GGCTGCTATCTTCCTGTGAGAGAAAAAAACAATTTTTTCTCATTTATTTATTTAGTTTTG
TCTTTTTAAGTCAGGGTTTCACTATACAGTTCAGACTGGCCTTAACCACATTATGTAGCC
CAGACTGGCCTCAAACTCACAGCAGTCCTCCTGCCTCAACCTCCTGAGAGCTGGGATTAC
AGGCGTGCACCACCATGCCCGGGCTCTACCACTCATGTTTCAGTCCCTTCTGTTCACTTT
ATATTAAGTGTTTCAAGAATTATTTGCATTTGCTCCGTGAGAGTAGTTATAAATAGGTTA
GCGCCTAGTGCACTAAGGACATTATCTTATGTTGAATTACTCTGAGAAAGTCTTTCTGGT
CTTTCTCTTTTTTTGGTGGTGGTGGGGAAACCAAGGATCGAACTCACAACTGTGCGCATG
CAAGGCAGGCGCTTGTGTCTCTGAGCTAAATCCCCAGCCCTAGTCTTTCTAGTCATATGT
GACTTGAGGTTGAACTTAAGTAGCTGTCACTGATTTTGGTAACATTGGCAAAATATTTTT
ACTGTGTATTCAATCCTAATGCCATTAAAGATTTTGAGCTGTCCAACGTGGATACCCTGG
GAGGTCACTCTCCCCGGGCTCTGTCCAGGTGGCATAGGGGAGCATAGGGCTCTGCCCCAT
GATGTACAGTCCCTTTCCACAATATTAGAGAAGAAGCTGGGCCTTGTGTCTGCGCCTCCA
TATTCCTACAACTTCTCAGAGTCCTTTGGGCAGTGACTGAGGAGATAAACCATGCAGAAA
ACAATATCTAGTAAAAATAAATAAATAAAGGTTCTGNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNATATATAGATTAAACTATAGATCCAACTAAAATCGCTTC
TCAGCCTTTTGGCTAAGATCAAGTATAGATCTAACTAAAACGGGATAATGTCCCTAGAAA
AAAGTATTAATACTGAGGCCTGGGTAACTCTTAAATAATTCCACAAAGCAGCTATAGTGA
TGCAGAAGTTAATGATGTCAGTAATGATGTCAGTGATTCAGTTACAATTTTTTTTTGAGA
CAGGGTCTCACTATACAATTTAGGCTGGCCTTTAGCTCACTTTGTAGCCCAAGCTGGTCT
TGAACCCATAATGATTCTTCTGCCTCGGCCTCCTGAGTGATGGGCCTACAGGCGCGTACC
ACCAAGCCCAGATCAGTTACAATCTTGAATGAGAATGTTTCTTAAATGTAACACTGGTCA
AGATACTTCTGATTCTTATCTTTGAGGTGTAAAGGTAATAACTTACATTTACTCTGCATT
ATATCTAGTTATTTTGTCACTCTCAAAAAGGGGTACTACTATTACTTTTCTGTATATTTA
TTACTCTCATGTTTCACTGATTGTTAGACTCTGATGATTGTGTACTCAACTTGTGAGGCT
CTGTGATGCTTGGGTTCTTAGCTGTGAGGGTCTGATAATTGGTACTTATGTGTAATTAAT
GTTCTGAAGCTAATAAAGTTCTGGACATATAAAAGAAAATCACAGATGAATGTATGTGTT
TATAATTTATTTCTGTTAACATTTTCAATGTCCCATATGTAGATATTATTTGAAAGTTCT
CCCCATCCCAGGATCTTAAGCTTCATTTAAAAAACTTAATTCATATTCATAATTATTGAG
TATATTACATTTTTTCCATTTTAGAAGTCTGACTAGACAGTAATTCCAAAATACGGCATC
AAGACAATCAAGACAAAAGTATGCAGACAGGCCACGGATATGATGTTTTGGGGAAAATAT
TTAATTCAAGCATGAATTTTGTTCATTTAGGAATGAGACTTCATGAATGTGCCTCAGGAT
AAAAAAGTTTGAAACACCCTTTTGATTTTCTTATTCTAAAATATAACTGTAGCAGAAAAA
ATTTGATGAGCTCAGTAAAAAAATTTGTTTTTATAAAACACCTGACAATATGTTTGGTGA
AATAAAATACCATTACTTTAATAAATTTAGAAAAACCAGCAGCAAAGATTCATGGCTTAT
TTCAAAACATGTAACACATATAGGAGTCTATTTATATATGGAATGTGGCAAAGTTTTTAA
TAAGTCACCATTTACTGTGCACCAGAGAACTCACACAGGAGAGAAGCACTACCAGTGCAG
TGAATGTGGGAGAGCTCTCTCAAAGTCCTTGCTCACTTTTCACCACAGGACTCACTCAGG
AGAAAAACACTATGGGTGTGGGGAATGTCCCAAGGTTTTCAGCCAGAAGTCACTGCTCAT
TCTGCATAAGAGAACTCATACTGGAGAGAGGCCCTATGCATACAGTGAATGTGAGAAAGC
CTTCGGCAGAAAATCTCAGACATCAGGTAAAGACATCAGGTCATTCACACAGTAGAGAAG
CCCTATGACTGCAGAGACTGTGGGAAAGCTTTCTGCCAGAAATTGAAACTCATCACACAT
CAAAGAATTCATACAGGAGAGAAACCCTATAAATGTGATGACTGTGAAAAGGCTTTCTTT
TGGAAGTCACAGTTGATTACTCATCATAGGTCTCATACAGGAAAGAAACCTTATACATGT
AATGAGTGTAAAAAAGCCTTCAGCAGGAATTCACTCCTCATTCGGCATCAGACGATTCAC
ACAGGAGAGAAACCTTGTAAGTGCAATGAATGTGGTGAAGCTTTCATTAGAAAGCCACAG
CTTGTCAAACATCAGGTAACCCCCACTGGGGAGAGGAATCACCAATGCAATGATTGTGAA
GAAGCCTTATTCAAGAGGTCACAACTAATGATACATCAAAAACTTCACTTAGGAGGAAAA
CCTTATGGGTTTGTGGACTGTGGAAAANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNTTCTGTAGGAAACTTTCAGTGAGAAATCCAGTCTCATTCTTCACCAATGAGGACCC
ATACTGGGGAAAAGCCCTTTGAATGTAGTGACTTCAGGAAAGCTTTTACCTGGAAGCAAC
AGCTCCTGAGGCATCAGAGAATTCACACAGGGGAGAAGCCCTTCAAGTGTAGTGAGTGTG
GGAAAGCTTTTGTTCAGAAGGTGCAGTTCATTAAACATCAAAGAAATTACACTGGAGAGA
AAACCTACAGATGTAGTGATTGTGCTAAAGCTTTCTTTGAGAAGGCACAGCTTATCATCC
ATTAGAGAATTCATATAGGAGAGAGGCCTTACAAGTACAGTGAATGTGGGAAATCTTTCA
CTAGAACGTCACACCTTATGAGGCATCAAAGAATTCATACAGGAAATAAATATTATGGAT
GTAGTGATTATGGGACCACAGGAAGTCACAATTCATGCTACATCAGAGGAATCATGTGAT
ACAGAAGCCATATAAGCACAGTGACTGTGGAAAGCTGCTCTCTAACGTCACACAGACACT
TTTGAGGATGTATATCAGACATCCCTGATAAGAAAGTAACTACTGGAGAAGCATTTATAC
AGAATCAAGAGTCACTAATTCAGAAAAGAGGTTGTAAAAGTAGACAATGTGGAAAACCTT
TCTCCCAGGAGATGCACCGCATCACCAGTTGGATGATACCCCATGGTAAAATGTTACCAG
TATTTTTTTTGTCTTTTTCATTTTTATCAGTACCAAGGATCGAACTCACGACCGCCTGCT
TGCAAGGCAGGTGCTTATGCCACTGAGCTAAATCCCCAGCCCCTAAATGTTACCAGTATT
ACACTGCTGGCAATACAGTAGTTCAGAGACTTCAAGTCTAAAGTCCAAGTATTCATCATT
TAGAAGACCTAAACATGAGAAAAATGGTTGTACCAAGTGAGTCAAAGGTATCAGGACATG
GCAACTCACTGAACTGTAGACAGTGTGTACAGAAAGGAACACTGAATGTTACATATCAAG
TAATTCATACTGAGAAGTATCCTGATAATTTGAAGAGAAGGATAAGCATGATCCTGTTAA
AATAATACCATGAGGAAATTGTATTTACTGTATATGAATTATTAGAAAATGTAGTTAATT
TTAAATCACATGTATGTTGACTTAAAAGTGAAGAATTTTGCTTTTTGTTGTGAAATTACA
TAGATCAGATTAACTCTCTTGCCTTAAACATCCAGAAACAGTACAATATATGTGAAATAA
TTATTTTTTATTCATGTTTTTAATTAACCCATTATACTTATAAATATTTGTGGGGAAAGT
GTGGCATTTTGATATGTGTGTACAAAGGCTGATGATAGTTCATGGTAAGTGGTGCTCTAC
TCACTTTAGACATTAACTGTTTCCTTACATTAGGAACAATCAAAAACTACTTGGTTATTT
ACTCTGTAATGTGCAGCTAATCGATGTTAAACACAACAGCCCTG
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1015, 14252..14372, 18804..18808, 18812..18958, 18962..19015, 19018..19458, 19461..19466, 19470..19946, 20101..20112, 20115..20149, 20152..20401, 20405..20536, 20539..20583
1001..1015, 14252..14372, 18804..18808, 18812..18958, 18962..19015, 19018..19458, 19461..19466, 19470..19946, 20101..20112, 20115..20149, 20152..20401, 20405..20536, 20539..20583
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved