Cavia_porcellus Locus EIF4A2
snOPY snoRNA Orthological Gene Database
Cavia_porcellus EIF4A2
Cavia_porcellus
EIF4A2
scaffold_70
SNORD2, SNORA63, SNORA81, SNORA63, SNORA4
2154..2222, 3608..3734, 3979..4156, 4421..4552, 4737..4872
7390
ttttagaagcccacgaatacaaatactcctttttagtaagccgcctgtgttgctcctag
ctgaaacatgccgcccaaagcggccttgcggtttatctaagcagcacgtttacttgcttg
aatctcaaggcatcaatatctcacatgagaggcaattaaaactgtcttaaaacaaacacc
cattgagatcaggatccaggcctatctggtccgagagagcactcagctctacccgccaga
agcgtcccctgaaattccggctgccaggaccctcggtggtcctgagcgtccctgccgctt
gcaggcgttaatcacggccccgtcggtcatcctctgcaccggccagttcaaatccttagc
attactgggaaaagaccgagggacggcagaggcgacagaagagcagccagccccgcggcg
tccggcggtgacgcggccggccgggcgggttcgggggcgcgcggggctaccaccttcccc
ggcagggacgcggttcacaccgccaggactcaacagtggcgggccccacgcacggcacga
gtcccccgcggcgcgcagcacggagccttcgttcttccggcacccgggggagccgggcag
ccccgcagccgcgcgccgcacgccgcacgcttccgccgcccgcctctgcgtcggggacgc
ggaaaccccgtaggagcagggagggcgggcggggacgcgagtctcttcaccgctgctgca
atattcttccgccgcagaacaaagagtcccaggccgcctccgggcctcgatattggcgac
ctcactagtagtatggaaaaaataggaaatctgaatttttctcgttgactcgctttgggc
ttttacctgaggtaacaacaccagggtcctaattttgtgaccgaccggagggctacaaga
aaattcctccgcgcgaaacgggttccggccgcgaggctataaaaagcgggcggcccggtg
cggctgtcttttcagtcgggcgctgagtggtttctcggatcATGTCTGGTGGTTCTGCGG
ATTATAACAGgtatggcgccctttcggcgggaggcgttgagtggggaaggtcacggagcg
cctggcgttttcgcggggggcctggaggtaaggagctacagctccacgggcgtctctagg
gcacaggtcttctgtgcctttcgagaagcttccatcatgggaagggctacggggcgacag
gtcgaggggacgacagcattatggtgacggggactccaaaggcgcttgagaagcctggcg
cctttgccaccctgtgggacacggcgtctcgtaaagggccgtggcgcagcccgcgttaag
cgcggtgcggcaggcggccgacgcatggttttcggtcctcagcccggctcggggccctgc
gccgtagcggagggggtggtggccgggagctgccgggacgggccgcgggggcgccggagg
gcggttggcagcgcttcgccggccgcctcgcccgcgtcaatcacccggcttgcgcagagt
tgggggcggagctcggcgcgtggcgttctcgcgagagccttggctcccgaaacgggagcg
gccccgcacgggcgtgcggggaaaggggctggtgggtggcggagcgcggtgcccgcgtcc
gcggtgccagctttgttagctgtcggagggcagagtacactggtggggaggagtgatgtg
acaaagcgggtcataaaaggcaggcgcgctttaaaggtggggcacaggtggcttggggaa
gggatgttgcctaactgcagtgttcttgccagCAGAGAACATGGAGGCCCAGAGGGAATG
GACCCCGATGGTGTCATCGAGgtaagaaaatgggtgtggggcttggatctgtgacatggt
gggtgcttggcatccgtgtttacgttagtgtttttcgacttacagAGCAACTGGAATGAG
ATTGTCGATAACTTTGATGATATGAATTTAAAGGAATCACTTCTTCGGGGCATCTATGCT
TACGGTTTTGAGAAGCCTTCAGCTATTCAGCAAAGAGCTATTATTCCTTGTATCAAAGgt
aaaaggaaactcgttggctctttaagaaagtaaattcagtgttccacgtagactttggag
cataaaagggaaatcaaccgcagggggtctactaccacctctctgtattcctaaaagtga
aatgatggcaaatcatctttcgggactgaacctgaaatgaagagaatactcttgctgatc
gcttaattgtttgggcataattcatgttccaactggaatacatggtgtgaagtagaagtg
acaatttgatgtgggatcagtaaatatgtatcctactttttttagGATATGATGTGATTG
CTCAAGCTCAGTCAGGTACTGGCAAGACAGCCACATTTGCTATTTCCATCCTGCAACAGT
TGGAGATTGAGTTCAAGGAGACCCAAGCACTAGTATTGGCCCCCACCAGAGAACTGGCTC
AACAGgtattgatagtgtagttcaaaaaaaaactgcttgcgtgttgcataggtttcaggt
ttcacaactgtgaagaatttaaagcttagcataactcggtcctatcagagccccctctta
attttctgtgcatgcagggagtatttgttcaaagataagcaggaactgggtgtgtaggta
tgttttttaggtttgtatgctgacatttgagaatccaaagtgttctgctcagggtggact
aatccagatttgaagattgaatgcagttgtgcaacatgaaaactgcagtgacatgttacc
atttgactgtctcagtagtttgtgatgcatctgttgcatgctatgttttcaaagctcact
gttgtattggctttgaagtaaacctaataaagcagtgggctttattaaggtccagatccg
aataagactcagtacattgtgggaggaaaaaaccccaattatttgccctattgtatttat
ggaacttgggtttattaacaaattattacacagtgaaggataatatagggaatgatttct
ggggcaataggatcccaaacaactgcacaaaacattaaagagaatgttagcttgaaacag
gtcagtcttgtttgaagcttaaaaggggtgttatgctctgcatgcttagaagctgttggc
agaccaggtattttgccattatgctttggaagttagtttattctatagggtaataattat
ggtcttttgggttttagATCCAAAAGGTAATTCTGGCACTTGGAGATTATATGGGAGCAA
CTTGCCATGCCTGCATTGGTGGAACAAATGTTCGGAATGAAATGCAAAAACTGCAGGCTG
AAGCACCACACATTGTTGTTGGAACACCAGGGAGAGTATTTGATATGTTAAACAGAAGAT
ACCTTTgtaagtgtattttaagtgtattgcttgttgtaattgtcaaatcttggagaattt
ggagatgatacagtatgacttaattattaacagCTCCAAAATGGATCAAAATGTTTGTTT
TGGATGAAGCAGATGAAATGTTGAGCCGAGGGTTTAAGGATCAAATCTATGAGATTTTCC
AAAAACTAAATACAAGTATTCAGGtaagttttattttatcccctcatagttaaagggatt
agattttaatgcaggtacagttacaatataactgaagtgttctattgtcgttccccctgc
ttaaagtatttgatacattactatctctgtctaacatcattccatggtgagacagagacg
cttggtctcaaacatttttttcttgactatcactgaaaattacactacgagcttgtgtga
caacataatcattgtctccaggTTGTGTTGCTTTCTGCCACAATGCCAACTGATGTGTTG
GAAGTGACCAAAAAATTCATGAGAGATCCAATTCGGATTCTGGTGAAGAAAGAAGAACTG
ACCCTTGAAGGAATCAAACAGTTCTACATTAATGTTGAAAGAGAGgtaatttgattagtt
agaaatacagctagattttaccttcttgtataagcactgtgctaaaattgcagaaactag
gatcatgtcttggtttttgtaataatgctagcagagtacacacaagaagaaaagtaactg
cactagaccctaaagactggggtggacctctttcttaatgtccagtgtcctttgtcttaa
ggtttggtgcaatatgtcttcaggcttactgttaaaaattctattgaaaaatgtgactgt
cattgactgtaaatttttctttgaaaatacctagGAATGGAAGTTGGATACACTTTGTGA
TTTGTATGAGACACTCACCATTACGCAGGCTGTTATTTTTCTCAATACGAGGCGCAAGGT
GGATTGGCTTACTGAGAAAATGCATGCCAGGGATTTCACAGTTTCTGCTCTGgtaagtgg
tggtactagtattgctgaggagaataaacatacattcattaaagcaggattcagactaca
gcatggctgtaaagtgctgtgttgtcgttccccctgctcaaaataaagttgtttcttaac
tatacctgtctgccatgcctgtgtagcagccagggacgcttggtctcatacatgatgaaa
ctgcaacttggcctacaggtgattcttgaattagcttactgcatttgtttacattcatac
agCATGGTGACATGGATCAGAAAGAGAGAGATGTTATCATGAGGGAATTCCGATCAGGGT
CCAGCCGTGTTCTGATCACTACTGACTTGTTGgtaaggtttttaaattttttctaatcta
ccaaaagttaaatttcaagggtaaagtttttaaataagctttaccaatctaggctatttg
ggagactaaaagaccacactccacagtgaactataccactcagtatagttcattactatt
ttgtggctacattacataggtaatccagttttttaaaatttgatcagagttttgaacata
cttctttgtgctttagGCTCGTGGAATTGATGTGCAACAAGTGTCTTTGGTTATAAACTA
TGATCTACCTACCAATCGTGAAAACTACATTCACAGgtgagcagagcatcctgaccattt
gtgtagctggcgaaattcatgtgtattcctacgaactgtaggaaaggtatggtcaaatca
gggtgtagattgtttgaaaagagcagtttagtaagatacagttaaaattacacttgggaa
gactggccagaacagagcaaagtgggaaaacttgtaactatgaccagattgtgcatacat
acagatgacttgacgttgcttaggtcttgagttttattgttagtgatggtcttgtctatg
tgctttttttttggtgatttttctgtagttggggtttttcttggtgtgcttgatagcatt
ttgagtgatccctggtttagtcatagtggctttatccctaagtaaattggaactgtactt
tgttatatgatgtaaaaaaagactttttaaaaaatacaggagtcgatagcagcagttgat
gacgagatggcgctcagaagcggcgttgacgtaatttaggacgtggagtcataagcgaaa
cagcactgtttgaataaagagcgagtcggtatttataatttgtttttcttttgtcatgat
tatttgatattgtaagttgttccagcccaggcatttcatgttggcatttctactagggag
cgtaaggtggtttgttgtctggtttgtgtaggaaggttgagttcttttggaggtgaacac
gtttgagtaattgagtacaacgtgtgacactgagcaaacaaaagcagtgatgagtttggg
tcaccataccaaatctgttttcccactgaaaacattttaagttttagaaattagttaacc
ttcagcatttgtgtttacagttccagaagtgcgtcgaagtggattacataactgttcttt
tgtttatccctggtgttcacatctgtcccaggctgacaactgctcttggctggcccactt
tggtatgggctttaatttcaccaccccaaacacaatactgtcatctgctttatagtaatg
ctcaagatgcctgaaaatctcattttgcagccagacaagtctttgaatcctttttggcac
taactgcaaagtagtattttttttcctctacacactgatttggccgctagtgctccaatt
agaagcacgaactgtaacctttaagtaaactgcagctgatggttaacaagtggatcctca
tgttcagtagttcatacagtatgtgagaagtaacattctcattgtcgttttctttctctt
acacagAATTGGCAGAGGGGGTCGATTTGGGAGGAAAGGTGTGGCTATAAACTTTGTTAC
TGAAGAAGACAAGAGGATTCTTCGTGACATTGAGACTTTCTACAATACTACAGTGGAGGA
AATGCCCATGAATGTGGCCGACCTTATTTAAttcctgggatgagagtttcgaatgcagtg
ctcgctgttgctgaataggcaatcacaacgtgcattgtgctgctttgggaatttttgaat
cttgtctcaatgctcataacggatcagaaatacagattttgatagcaaagcgacattagt
cgtgagctcttgtgaggaaagtcattggctttatcctctttagagttagactgttggggt
gggtataaaaagatggggtctgtaaaatctttctttcttagaaatttatttcctagttct
gtagaaatggttgtattagatgttctctatcatttaataatatacttgtggactaaaaga
tataagtgctgtataaaatcagccaattatgttaaactagcatatctgcctttattgtgt
ttgtctttagcctggatagaaaggcctttaaaattgattttttttaaggaagcatttgaa
tgcattttgttttggtattgtatttattcaataaagtatttaattagtgctaagtgtgaa
ctggaccctgttgctaaacccccccagcaagcaatcatattctaggtagggttaaccccc
agtaaaattgccatatgcacatgtcttaatgaagtttgaatgttaaataaattgtatatt
cactttataaggtggtttggtcatttttattttcatgttctgtattacaaagcatctttg
agccagttttcaggctagcaattctgagttaattgctgcattagagttgcacagaggctt
atcaattgcaggtattcatcagcaccatctgttaaacatttgtcaacttcctagaagaaa
aatatattaaggttaggacatttctagccacaattgcttcttatactgcccaatgtctac
tcacagcaagtttttctgtaatgatggacttctgtttatcagaaaggttatcgttctcta
caactgcatcatgaagctggctgacaagctgagttgctgcgtgaccctcatttatcaggt
cctgtaaaaga
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1029, 1772..1820, 1905..2037, 2325..2464, 3197..3365, 3453..3563, 3802..3944, 4234..4371, 4622..4711, 4936..5015, 6246..6390
1001..1029, 1772..1820, 1905..2037, 2325..2464, 3197..3365, 3453..3563, 3802..3944, 4234..4371, 4622..4711, 4936..5015, 6246..6390
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved