Cavia_porcellus Locus KIAA1731
snOPY snoRNA Orthological Gene Database
Cavia_porcellus KIAA1731
Cavia_porcellus
KIAA1731
GeneScaffold_5538
snoU2_19, snoU2-30
67107..67186, 67383..67452
61806
GTCAATTTCCAGCTTCAATGGCTCGCAACAGTACTTTAATTGATTTTCCTTCCTTCTAT
CCTTAGCCCTTCTAATATCTTCTCTACAGTGCACCCAAACTTCCCATTTTCATCATCATT
TTCTAATTCTTTGATTCTTAGTATGTTTAACTCCCTAGACTGTGCAATCTAGGAGAGTGA
TATTCCATTTATTCTTGTCTCTTCTGTACCTGGTACTGTATATCTAGCAATAACAGATGC
TCAATAAATACTGTATTTATGAACGTATGCTTACTTCCTCTTTGATTACAGTTACTTAAA
GGAAGTTAAGTCTGTGGCATGCTCTAGATCCCTAATACCTGTAGAGGCACAGAGGCCATG
ACAAGGTTCATGGTCCTACCAGCTGAACTGAAAGCCATTAGGCATTTACTGCACATTATA
GAATCAATAAATAGTGCTGTCACTACATAAAAAGGATATAAAGGTCTCAAGGCATCTTTC
ATGATGGGGTTTTAAAACCAAAGTAACCCTCACGGTTTGTCTTTCTGTTGTGAAAAACCA
AAAGTGTAAATAAGGACCAACGTAAGTAACAGTTATTGGGAAATAGGAAGAAAACGTTCA
AATTAGAAGGGGAAAACGTAGGGGGTGGGGGAAACGGAAAATGAGACGAGAAAAAAAAAA
GATCACAAGGAAAAAAATGGAAACAAAGCTTTTGTAAATAAGTTGGAGTAGGGGGTTGAA
GGAGGAGAGGGAATTCGAGGAAAAAGAAGGAACAAGATATATCACGTACAGGTAAAAAAT
CTCGATGAATATGATCATTACGTGCATCTAAAATGTACCAATAAAATAAAAAAAATTAAA
CCCCATGGGTCCTAGCAAATACCTTCCCATTGGTGAGCATCAAAAAAATGATGCTTGCAC
TACACGAAGTAAAACCTCAAGGCCCTGGCAAGTATGTAAAACAATGATCTGCGGAGCTCC
GCGGGTGCTTGTGCGCGTGCGCCGTGCTCTCCCGCGGCTAGGCCTTTCCTGCAGCAGCGA
GGGAGGTGGGACCAAGCAGATTCCCGCGGTTTGGCCCCGCCATTGGCGGGCGGTTTGAAT
GACGGAAGTGACGAATAGCGGCGCAGGCCTCCGCGCAGCCGCAGAAACGGTTGTTCGGAC
ACGTCTGTGTAAGGTCTGTTGGGTTTCTCTCTTAGGTACAAGTCCGGACGCTGGGGTCCT
GGTCCCAGGGTAAGTGACGGTGCACAGGCTGCCTTATCCGGAGGAACTGGTAGTGTGCTC
TGAAGAAAGGGCGTCCTGGAATGCAGCCTGGTGCGCGCCCGTCTGTTTTTGGCCGGCCGA
AGCCTCCGGCTGCGGTCCGCCGGCTGCTGTGGCGAGCGCCGCCTGGGAGGTGCATCGGGA
CTGGACCCGCCTGCCTCGAGGGGCGGCTAGCGTGCGCTCCCGGGCCGGTCACGCGGGCGT
GTGCTGCGTCCTCCTGGTCCCTGAGCCTCCGCTTGGGGACTGCGTGATGGTCGCAGCTGC
AAACGGGTCTCTTAAGTTACCAGAGAATGTGGCCAGGAATCCTGTGGCTTAAGAGCCTTT
CCTGGAGTTGTTCTTGCAAAGAGCCAGCCCTCTTTGGGGTCCGATTAATTTCTCTGGTAT
GAAGTTTTTTCACAAACAGTTTGTAAGTGTTAGTCTGATGAGTCTTTCATAAAGTGTGTT
TGGCAGTTTCATTATGCTTAAGTTACATAATCAAAGCAGTCGGTTGGGTTAGGTGTTACT
CCTCTTGTATAGGTTAAGAAAACGAGACTAAAACGACCCTAGCGACTTGGCCAGTGTCTT
TCTGCCAAGTGACAGTGTCAAGTCTTGAATGCACATTGAGTCTAATGTTAATAGCATTTG
CTGTACGAGAAAGCAGTTGGTCAGACAATAGTTGTCAGTAGCTACTAAGTGGACAAAAGT
ATGATGAGAAAATGGTGTTCGTGTTGCTTTTCCTATCCTTCCAACAGATACTTATGAAGG
AGAAAATAGAAGCTACCATAGAGAAAATGATAAGATACCAAATGAACCAATGGTAGGCCG
ACTGACATCTTTTACCTGTTGATATGATGCACCAAGAGGAGTACATCATCACTTCAGTAG
AGCTCTTGCCAGAAATACTAACTTTAGTCTAGTACAAGAAAAGATAAGATAAATTCAAAT
TGAGCTAAGTTCAAAGTAGATAAATTCACTTGTGCCAAACAAAAGAATTGGCCAGCATTT
TTTATTTAAGAAATGAAAGACAGGAAATGTCCTGTTGTGGAAGAGATACATGGTTATGAG
ATTGTAACTCACTTTTTCCTGCATTCATATAACCTGTTTATACGAGGAAAGGATATATGA
GAATTTTGTGCTTAAAATTAAGTTTTAAAATTATTGTCACATCTTAACAGCCAAAACCAA
CAAATATTTGTATGTATTGCCAGAATCCTCTGGCAAATGAAATGGATATGCCAAAAATTC
TGAGAAAACTTTTTTCTTTTACATTGAGATATAGTTTAGAATAAAATACACAAATCTAAG
TGTAATATTTGAGGAATTTTAACATGTGTGCACCTGTTTAATCATCATACAGTTCCAAAT
ACAGCATATAGTATTTCTAGCACCCCCGCAGGCTTCATTGTACATGTGTCCTACCTAGAC
AATAACCTGAGTGGTAAGCCTTCTCATGGATTCATCGTCAGTCTATTGTTTTTGAGCTTC
ATATAAATGAACTTTTATTGTGTTCTTCTTTGGACCCAGCTTTTATTCCATTCTGTGATA
TGAGACTCATCATTAATTGGTTTTAATACTTCATGAGTGAATTTTCAAAGACCTTCAGAT
GAATTTGTAGAGGTACATTGTGAAGATTAAATGTAATATTGTTCATTTTTCATCTTTGTT
CTGTTCCCTGTTTCTCAGTCTTCACTTTATAAAAAACAATACCTTAAATAACATTTTGCC
GCATCTGTGTGTTTTAACATATCAGGAAGTTAGAAGCCATTTGAAATAAATAAACTAGAT
TCTTTTACTTTTGCCAGTACATATTGTCACTTTGGGCAAGAAAGAAAAACAAAGTTAAAA
GAAACCCAAGAGGATTATGTTTATGCTTAAAATTTCAATAGTTGGCACTTTACCATTATC
AAAATCTTGTATCAAATCAGAATATATAGAAAAAATTCACTAAAGGCAAGCAGTTACTCT
TTTGACATCAGAGTTCTGATCTAGCTAGTAGGAGTGACTGTGTGTGCCTGTTGTAGTAGT
GCTTTATGAGGTGAAAGACTGAGAAATTCTGACGTATCTCATAAAATTTGATTGTATATT
GATGTGAAGTATTTAACTTTTGGATATGATGATAATGGGAACAGATGCTGTCAGAGTCAT
GTGAAAAGAATTTTCAAAATCTAAAGCTCTAGATTCTTACATTCTTTCCATTCTTGCCTA
CCATACTCCCTCAAACAGGAATGTGTTAAAATCTAGTGTAAAAGTAGCAATAGAAGAATA
AATGTGGAAATTCCCAACACGTGGTGTACCCAAACAGTTATTTTAGGAAAACTTTAAAAT
GGTCATACATTTGTGTACAGCCATACTACCCTGAACACGCCAAATGGTCATATATTTAAA
AGTCAAACACCTGAGGTTAATGGTTTACCATATTGTATGGTAATTGTATAGCCTGTGGGA
ATGGTATGATTCCATGAATTATGATGATGCTTGATGATCAAGTTATGTTCAGCAGACTGG
ATACTAAATCAAATGATAAGGAAAGGAGCCTTTGAAGTTACAGAAGTTTTGCTGGTGATG
AACAGGTTATGCCATAGTACTAAACTAGTTGTACAAGCATTCTATGCCAATACATGTTTT
TATGGTTTTTTTTTTAAACATTTAAGAATAGAAACTGGAAATGCCCATCAGGAGTAAATT
AGGTCCATGATACTACAAGTAAACATTCTGCTGTAAAACAGGGAAAAAGTTCTCTAAGAA
ATTTTGCTCTGCTCTTTATTTCCTCTTTTTCACCTCGCAGAACCACTGATCAAATTGGTA
GGTTTATAGCACCTATTTATAAATCATTTTTGACCGTATTTGCATGCATATAGCCTTTAA
ATGTCACTAATGTGAATTTTTAAAATTATAGTCTTTGCTACTCTATTTCAATGATTCATA
TCTTTATGGACATTTCTCTTTTTTTTAAGTTTCAGATTCTTTTTATGTAAATTACACAGA
AATGAAAAGAAAGGTAGTGAATACTGGCAAGCTGAGATTGAGTCCAAATGAAGAAGCCTT
TATTTTGAGAGAAGATTATGAAAGAAGACGAAAACTAAGGTTGCTACAGGTGTGACTTAT
TTGAAATAGTTTCCATTGTCTTCTGGAAATCATTTAATACAAAATCATTTAATATAAAAA
TCATTTAATATAAATCATTTAATATAAAAATACATTAAAATGTTCTAAGTGAAACATTTC
ATTTAAAAACCTGATTATATAAGAGCCCTGGTTTTTACGTATTTTACATGTTCCAAAACA
TACTAGTTTTAGAACATTTGAAAAAGCAGACAAAGATGGTAATTAGGTTGGAAGAGAATG
AAGGCTAAGCATTATTTGATTTTAGGTTTTTAAATATTTTTAAATGGTATGTAATACATG
AGTATTAGTATAAGAAGTTTAGAATGACTTCAAGAAAGACTTACCAGAAACATTATTAGC
TTCTGAGACAACTTTACTAGGAAGTTGTAGATTATTGTTTTCTAACAGCCCAGAATAAGA
GTTAAATCTTTGTGCAACATGTTTTAGGTGCTATTCTGTCTAGAATTAAAGACAGTATAT
GACAGAAATGGGATTTGCATCTGGCCCTATCTGTACTCCTCTCTGCTATGCATTTGTTGA
GCCATGTTTACCATTTTGGCATTTTATTCATTATTAGGGTGATACAGTGCCAGTAGAAAT
GTAGGAGAGTAGAAAAAATTAGAAGTAGTCTTGCAGTTTGGGGATTTTTTGTTTTGTTGG
TAGTGCTGAGGATTTAACCTGGGACCTTGTATGAAGTAGACAACCACCACTGAGCAATAT
CCTCTGCCTGAGCGTCTTATTTTCCTGTATCACTTGGAGTTTTGCTTTATGTAGTCCTTA
TCTAGTACAAGGTAAATATTTAGAAGACCTGATAGATGTGAAGAAAATGCATTTTAGTTT
CTGTTTCCAAATAGCTTTTTTAAAGTTTAAGCTTTTATATAATCCATTAAATATTCTTCA
GGTTCGAGAACAAGAAAAGGATATCGCTTTACAGATAAGAGAAGACATAAAGCAGAGGAG
AAATCAGCAGTTTGCTCGTTTGGCAGAGGAGCTAAGGGCAGAATGGGAAGAATCGCAAAC
TCAGAAGATACAAAACTTAGAAAAACTGTATTTGGCAAGTTTAAAAAGTATGGGAGATGG
ACATCGACAGGCCAAAGAAAACGTGAGTCTTATTAGACTATTTGATTGTAACAGTAATGT
TGTTAAAAGTATATTTGTTGAATTCTTACATAATATATTTTTGTGTATAGAATTTGTTTT
GAACTGGCTGCACTTTTTTTCTTTAAATCAGTTTAAAATAAATTGAGAATAATAGTATGT
TCTTGTAACTGGTATCAAGTAAAATGTTTCTCCCTATGATACTTAAATGAGCATTATCTT
ACAGTTCTTATTTGCCTATATAAATCAAGTAACTTTTAAAAAAATTGTCTCAAACATTTT
GGACAGATTCAATGGAGTGAATTTAAATTTCCTACTTCAGTATCAGTCCTAGTACCTCTC
AATGTGTATGATTTTTTTTTTTTTTCTTTGTTGACTTCCAGAAAGACAAAATGGAACTTA
AGATTTAAAACTGTTCCCTGACTTAATTTATTTATTGTGATTTACAGTTAGAAAATAGTA
ATTTGCAGCCCCAGTCTCAAACAATACACAGACTGATTCCAAAGAAAATAAATCTTTGAT
AACAAGTTATGAAAAGAAATGTCTAAACTGTTCTTTTTATCCTGGTTTTTGTTTATGTTT
TTAGTAATAACTTTAGGTTCACACATCAGACTTTTGTAGCTTTATGTGTATCACCATTAA
CTCTGCTTTAGTGCAGTTTTACCCAAACTTCACTCACTGACCTCAATGATAAGAAAACCT
TCATGGTTTCTGCTGTAATTGAAAAAACTACCTGAACCACTATGTATGTGACATTTTAGT
TAAATAGATTCAATTGCTACTTAAGTTAACCATGTCCCGTAGATGCCGTTCTGTTTGTTT
TTCTAATAATATTAAGTGACTACATTAAGTCTTTGTATTTTGGGCCTGCTGATGTATAAT
TTAAGGTACTATTACCACACTTTGGGAAATGCTGCTGTAGTATGTAGGAAGAGCTGACAA
AATTGAAAAGTCACTCCTGTTCTGACATCAAATAAGATGCATTTCTAGAAATCTCGTTCA
ACTTGACATTTTAAGTAATATACATTTTTAGGAACCTGATTTGGATGCTCTGGCACGGCA
GACAGCAGAAAGGAAAAGAAAAGCAGAAATGAGGCATAAAGAAGCTTTGAAAGTACAGAA
AAATCAAAAAGAAATACTAATGAAAGAAAAAAACTGGTAATCATTTTTACCACATTCCTA
ACGGAAACTAACATGGCTGGAAATAAAGAATGCATAGCATACTGTATAAGCAGATACTGT
ATAGAAGTTACATAGTGTATCCATTGCATTTCTTTAAACTGGGTTTAAAAATAATACAGA
GGAGAGTATTGCTTATAAGAAATAATATCAAATGAGTTTTCTAATTGGAGTTAGAACATT
CTGAGGTTAGCAGCAATTACTGTTTCTGGAGCAGTGTATAGATCAGAATGCATGTCAGGT
GAAGCATACCTTTCTGTCATGCAAGAAAAAAATATTAGGACTGGTGATTTAGCTCAGTGG
CATTTAAACACCTGTCTGACAAGCTGAGGTCGTGAGTTCGATCCCTGGTACTGTCCCAAC
CCGCGGGTAAGTCAATGGAGACCCTAGAGGGAGGGGGATTACAGATTTGGAAGAGACGAG
ATGTTTAGAATGGATTCAAGACAGTGCTCTGATCAAGTCTCGTTTATTCAAAGAAGAAGT
AGCGATTATATAGGGTATTGGGGAAAGAGGGAGTTGGGTTCTGACACGCCGCCAGCAGGT
AAACATAACAACAGTGGGAAGTTCTAGCAAGACTGGAGGTTGTAGGGTAATTCGAATCTC
CCGTGTGGGCTCATAAGGTGGGCTGATTAGCATAATCACTGCACAGGCCGAGCCACAGGG
ACATGTGACAGGCTGGGTGAGGAGAGAGGGAAACGTAACTGCCAAATAGAAATTAACATT
AAGATGGTTTTTGCCTGCTGATATAAGGTGGCAGCCAATTACAGGGCTTCCCACATGGTA
CCACCAAAAAAAAAGAATATTAATGTAATTCAGGACATTAAAAAGTTGTAAATGTTGGAA
ATCACTAGTATATTTTGCGTGGTATGAAAGTTAAGGTGCCTCTTACTCTGGTCATCAGTG
ATCATTTTGTACAGTGTCCTATCTCTATCAGCATTTCAGCACTGAACTACTCTAAAGAGC
ATTAGATGTTTGCTGGGTTGGTCTCCACTGTGGAGCTATATGTTTTTAGGTATGATGCTT
TCTATTGGTAAACATTGTCTCAGATCATGTTATATATAGGGTTTTTTGTTTTTTTTTGGT
GCTGGGTTTGAACCTATGGTGTTCACACTGAGCTACACCCCCAGATCCTAGCTCCACCCT
TTTAAAATTTCTGTTTTTTATTTTGGTGCAATGTCCCAGTAAGTTGTCTGGGCTGGCTCA
AACTTGTGATTCTCCTGCTTCAGCCTCTTACAGTGCTGATGTTACAGGCATGCACCTGCA
TGCTTAACTTAGACTGTTTTTATTAAACTGCATAGGACATTTGTGGGATCAAACTGGAAG
ACTTCTAGAGATTCTATGGGCAAAAAGTTTTAACACTAAGAAATTATCTGAGAGATTACC
TGATGATATTTCTTGTTTTTAAGGCATATAAAAGCTCGGAAGGAAGCATTGCTTGTAGAA
AAAGAAAGGTCTGCCAAAATTTCAAGTCTGCCTCTTCCTCCTCCAGCTCCTTTTGAGGTA
AGTTACTTTGAACTTTGAGAGAAACTGTGTCATGAGAATGCTTTATTATTGTAATTCAGT
GGAGGCTAAAATAATTAGTTTGTTTGAACTTAATTTTTAATTATATATGCAATACACAAT
TAAATCTAGGATATTTTGAATAATCCTAGACAGCATTTCACCCATGAGTCATTTAATATA
TTTTTCTGATATATAAGGGTTAAAAAAAATAGTAATTGCTGACCATCGTTGTGCATGCCT
TTAATCCCAGTTCTCTGGAAGGCTGAGGTAGGGGATTTGCCAATTCTATTCTAGTGTAAT
TGAGTGAAAACCTGTCTTTTTTATTAATTTTTTGTTGTTTGTTTTTTGGGGGAAGGAGGA
GTCTATCCTTAAAAAAAAAAGCTAGTGATGCTGCTAAGTGCAAAGGCCCTGGACTCAATT
CCCAGGACTGAAAATAATGAGAGTCACACTGATATTTTCCCCAATATTATCTGAGACCTG
GTATGTGTTCTATTTCTCCATGGCCTCAAAATGTTTGTTTGTTTGTGTGAAAAACTATAA
TGGTTTCAAATTTTAAAAGCTATTAATCTGCTTTTTTATTTTCTAATATTCTTCATTTGG
AAAAAACTCCATTAATTATCCTTTAGACATTTCCACATTCTGAATTGGGATTATTGTAAA
TACTCACCATTTCATAAGAAATTAAAATTCAGATTAACTTAAGACCCTATTCAGCATGGT
TAGGTAATGAAAGAGGTTTGTTTCTGGGATTAAAAGGTTTACATTTGTGACTGATCTCAT
TTTTAAGCAAATGCTATATAAAATGGAATTTGATTTTAATTTTTAAAAGCATTGCTTCTC
TAAAATAGTATTGCTTCTCTTGTAATTAGCTTGTGATTATTGAAATGGCTTTTAGGTAAC
TATCAAAATTAGTTATTTTTATTTTAGAAGTTTAGAAGAACAAATATAGGATGTCTCAGT
TATGTATGAAAGGTTGTTTTATGAATGTACAATCAGCATGAGTACCAGATACTCTTTTAG
GTCTTTCATTTTGTCAGCTTTTCTGCTTTAATGTTGCACCATCTGCTAAGTAATATTTGA
TACAACAAGATTCAGACAGAAGAGTCATATTTCAGCCACTCCCTCGGTACCATCTGAGAT
AATAAAAGGCAGGCAGTATTTTATCCATATGCCTTGTGATTACCTTTGTCATAAATCCTA
ATGTTCATAATAAGCTCAGATCAAAAATTTATAATAAACAAAATACGTCTGTGCAAGTGT
TTTTATAGGTATGAATTGCATGTAAATATGCAGTCGTCCCCCCCCCCCTTCCAGCTTCTT
ATGAAAAAGTTAAATGGTGGCATGGGAGCTGCCTGTAATCCCTACACTTAGCTTGAGGTG
AGAAGATGGAGAGTTTGAGGTCAGTCTGGGCTAAATAGCAAGACTCTCTCAAAAACTCAA
ACAAAAAACTGAATGTGGTGGCTCATATGTTTAATCTAAAGTCTAGGAAGCAGAAGTAGG
GGAACCACAATCTGTAGTTCAGTGTGTGACTTAGTAACGTAGTGACCATGTCTCAGTGAA
AACTAAAAAGGGCTGTGGATATACTTCATTGTAAAGAACCTAGGTTCAACACCAGTAATG
GGAAAAAAGAATGGATATAATAGTGTGCTTTTCCTATAAATACAATGAAGTAATTAAAAT
TTGATTTGACATATACTGTAAGTACTTCCTTTACTCAGCAGATTTAAAAATGAAATATTT
CAGAATTAGGGATTTAGCTCAGTGGTAGAACATTTGCCTTGCGTGTGTGAATCCCCAGGG
TTCGATCCCATGTTTGATCTTAGAGCAAAAACAACGTCTTTTTAAATGACTTTAAAAGTT
GAAGTAAACTTAACCGAAGTAAGATGGATTACATTAAAGGTACTAGAAGATATTTTGAAG
TATTACTGAATTTGGTATTTTCACTAAAATGTCAATAACAATTCTAGAGAAGAGATTTAT
TTCAGTGTGAGCAGAATTTTAGGTTACCTCAAGTGATTCTCTTAGTCTGTTTTCTGTTTC
TAGTAATATAGTACCATACTGAATTATTATAAAGAAAAGAGGTATATTTTGGTTTACATT
TCAGTTCCAAAACTGAAGGGCTACATTTGGTGATAACCTGCTTGCTGGTAGGAGTTCCAA
GCCAATTATAAGCATCACATGGTGAGAAACAGAGTATGTGAGAGACCAAGCCATACTGGC
TTTTATTGTGTTGATTCTGAAGATAACTCATTGAGATAGTAATCCATCAGTCACTTAAAA
GAATGAATTCATTGATGAGTTGATGTCCCTAATCACCTCCCAAAGGTCCCATTTGACCCA
CTTCTTCATATCTCAAATTGGAGATTAAATTTGAATGTATGTTTTGAAGGGGACAAACCA
TAGCAAATTAAAATGATTAAAATGCAAAAATATTTTTGCATTGGATCCACCTTTAGGTGA
AAATTAATGCCTTTACCCTAAACTGTATATTTTTTAATATTTCATTTTCCAGAACATTGA
AGTAAAAAGAATTTCTTCAGTGAAAACCAGCAGTTCTACCTACCATCATATTTCCACTTT
TGTGAATGCACAGATGGAAACAAAGCAGGTGACTCATTGTTCATACCCTCTCCTTATTAT
TGCTGTGTTCACTGAATTGAGTTATGTTTTGGTTCCATGTTTGGTGGTGTCAGATTTCAA
AATGTGAATGCTTCCACTAAACATCCTAGATAATAGTGATCACAACCTTTTAAGTATGTT
TTGCATTTTCATGTCAATTAATGACATTGTTATATGAATCGAAGTAGATTGCTATTTAAA
TAGCTGCCTTTTTAAAAAAATTTATTTTAAAGAGAATAAAGCCAAACAAAACAAAATAAG
GCAAATCAGAACAAAAAAATACCAGTGATACAAGACTTCAAAGTAAGACGAGGAAATCAA
CAATGGCTAACATGTCTCTCATTTTCTTCAAAATAGCTATCTATACCATCACACATAATA
AAATCAAAACACAACAGCATAAAACCAATGAAAACAAAAGAATGAAAGCATTACAGGACT
TCAAAACAAGGTAACAGGAAATTGGCTACCATAATGTCTCTTGTTTTCTTCAAAATAGCT
ATTCATACCTTCACACATAATAAAATCAAACAAAACAAAACAATAAAACCAATCAAAACA
AAAAAATCAAAACATTTAGGACTTCAAAACAAGATAATAGGAAATCAACAATAGTTACCA
TATTGCAGCTCATTATCTTCAAAATAGCTGGGCATAACATCAAGCACCATAAAATCTTAA
CAAAACGGGCAGGGATTTAACTCAGTGGCATAAGTGCCTGCCTGGTTAAGTGTAAAGGTC
ATGAGTTCGATCCCTGGTACCAAAAAAAAAAAAAACAAAAAACAAAAACAAAATAAGGCA
GCATAAAATTAAATCTAATAAAATTATGGAAATGATACAAGAATTCAAAACAAGACAATA
GAAAGTTAACGGTGCTTACCATGTTCCCTTTTTCGGTGTTTCTTCTATCACTTTCATAAT
ATCTATTGTGCTTTTTGGATCCCACTAACTCCTTTAGTTTTTTATGCTAGGGTGATAACT
CGGTGTTTATCTGTATGAGACCAAACCATTTCACCCAACTGGAGCATGACCTCCAGTAGT
ATCCATTTAACTAAGAGAGCCTCAGGATTCTCCCTATTTTAAGCTGAGCAGTTTTCCATT
GTATGAAAATACCATATCTTTTTTATATATTCTGTGGTTGATGGTCGAGTTACCTTGCTT
TTTTCTGGTTTACTGCCACATGGAACAATTGATTTCTCTATTTTGATTTTCAGTCTGAAT
TTCCTTTTGAGTTATATGTGTTCCTTTTATACAATGCTGGTTCTTGCTTCTTTATCCATG
CTCCTTGTGTTTCTTTTTATTAGTGCATTGAGGCCATCTACATTTTGGTTACAACTAGCA
TGCATTGGTTCATCTCTGCTATGCTGTCCTCCTGGCCTCCATTTTCCCACTTGTCCAATG
GCCTGTCCTGTTTGGCAGTCTCCCTCTGCTGCTGTTTATTGAACCATGGTCATCTTTATT
TCTCACTAGACTATCCTTTAGCACTCGCTGTAGGGTGGGTTTGGTGGTCATGAATTCCTT
CAGTTGTTCTTTATCATGGTAGTATCTTATTTTTCCATCAGTTTTGAAAGATAGTTTTGC
ATATCAATCTGGGTTGGAAGTTGTTTTCTTTCAGAATTTGAAGCACTTCACTCAACTTTT
CTTGACTTGATGGTTTGTGTTGAGATGTCTGCTGTGATTCTGATGGGGTTTTTCTTTATA
GGTGATCTGTTTCTTTTCTGTAACATTTTATAATATTCTGTTCTTGTGCTGAGTTTCTGG
GATCTTGATTATTATATGTCTGGGTGTAATTTATGTTTGGTTTTGGGTAGTTTGAGTCCT
ATATGCCTTGCTTGTCTGTATGCCAGATCCTTTTTCCCTGTTTGGGGAGTTTTCTGCTAT
TACTTCTGTAAATAGTCTTTTTATGTCATTTGTGTTGACTGCTTTTTCACTGAAACCTAG
CACTCTTAAACTGTTTTTTCTTTGTATTGTCTTGCAGCTCTTGCATTGTTATTTCCTGGT
TCCTTGTTATTGTTAAGAGATCTTTCCTGTCATGATTGCTAGCTGTGATCCTGTCTTCAA
GGTCTGAAACAATCTTTTTCAAGTGGTTTTGCCAGCTTTTGACTGAATTTTTAATTTCTT
GGATATCTCTTTGAATCTGTTTCATGCATTGTAAATCCTTCCTATATTGTTCATTCAAGA
TTTGCATCATTTTTCTATGCCCCTCTTGTTTTAATCTATGTCTTCTTTAAATAAGCTCAG
CAATTTTTCTAGTATGTTTGATTTTTTTTATCTGAGACATTATTTCTGATTTGATTGCTT
TTATAGTCTTATGAAGTTGTTTCTTTAATTGCTGTCCTCCTAGAGATTTCAGGTATGTAA
CTTCCATTTTCTTCCATGTCTGTACCTCCCAGGCTTGTTCTGTGTGGACTGGAGGTCTGA
GATTGCCTTTTGCTCTTTCGTCTTGACATTTTCCTAGGTTCCTCCCAACAAGCTGTTGTT
AGGGTCCCTGGCACTTCTCACATTGGCTGCCCCTCCACAGAGTAGGGGAGTCAGCCAGGC
ATTCTGAGTTTTCCTGAATCCGAGTTCCCAGAGAGATAGCAGCAAATGGGGTGGCCTTCT
CCAGCCCCCTGTAGCTACACTGAGACTTCCTCGTTGGCCAGCAGTGCATGGTGGCAGGGC
TGCTTCTTTTCTCACCCTGCCAGTCTACACTGGGACTCCCCAGTGTTGGCAGACACACGG
ATGTGTTTGTCTGATTCTCCTGCTAGGCAGTGACTGCCTGAAGAAAGCAAGGGTCTTCAG
TGGTGGCCGGTGGGTGCATGGGTGTATGTGGCTGTTTCTCCTTGCGCATGTTGTTTGCTT
ACGGGAGGCAAGCTTTCCAGTGGCCGTGAAGGCAGGAGCACAGAGGTGGGTCTGGCTGCA
TCTCTCTGCCCATGCTGGCTGCCCACAGGAAGCAAGCTTTATGAGGAATAGCTGCCTTTT
AAAATAATTTTTCTTGGGTGTGGTGGTGCACACCTGTAATCCCAGAACACAGGTGACTGA
GATAGGAGAATTGACATAAGTTCCAGGCCATCCTGGCCTGAAGTGAGTTCAAGACCAGCC
TAAATTACATAGGAACAATTTGTCTCAGAAAAAACCAAAATATAGTAGATTTTAAAACTT
TACCATACAGTAATATGTGCTCTTGTGAAAATTGGAGAACTGTGCACATAAGCATAAACT
AGGACACCCATGATTCTATCCCCAAAGAGTAATATGATTAATAACTTAGTGAACTTCCTA
ATACCCTTATATATAAACTTCTCCAGACTTTTCAACATGTTTTTTAAAACCCCCTTAATA
TTTCCTCAGAAAATTATTTGACCTTTCTTACATTTAGCTTTTTTGGTTTTCTTAGTTTTA
CTCTTTGCTTCTCTCAATAGTATGCACATAATAAACCTGTATGTTTATCTTCACATGTCT
AGTTGTGTATTAAAAGTTGATTCAAGGGGCTGGGGTTTTAGCTCAGCGGCATAAGCGCCT
GCCTTGCAAGCAGGCAGTCATGAGTTCGATCCCTGGTACCGATAAAAAGGAAAAAGACAA
AAAAAAAAAAAAAAAAAAAAGTTGATTCTGAGGGCCTGAGGATGTGGCTCAGTGGTAGAG
TTCTTGCCTTGCATGCACAAGGCCCTGGGTGCCAATCCCCAGCCCCCCCAAATTGATTCT
GGGAAAATTTTTGGTTCCAACTGTAACTTTTGATACACGACATTAACTTGGTCTTAAAAA
GTACAAACAACATGACGATAGCTGTCCTACCATACATTTGTCTGTTACAGTTTGCAAATT
ATTGATAGTCTTAAGAATGACAAATGATATACCTTTTTGAAATTTGCTATTTCTTTGTAA
TAGTAGCTTTTGCTATTTTCATGTTTTACATTTGGCTACTAGGAAGATATGATTATCAAT
ATAGCATTTATGTGGAGTATAGAATGCAGATATTACATTGTGGTTGATTACATAATGGCA
TATGTTAAAAATCAGTATTCAATCAATATAAAAAATGAGTGTTATCATCATTATGGAATG
AGCGTTTAAGATTCAATACTAAACCTGAGATTTACTTAAAATTGTGGAGTATTATGACCT
GAATATTAAGGTAGAATAATTATAACTTTAAGTTGTTACTCACTTATTCTTCTGGTTAAT
TTACTGCATTTTTGCAATATTAAATAGATGCTACCTTTCAACTAAGATTGATGAAGAGAG
GTCTTTTTTTTTAACCTGTCAGAAAAAGGTAGTGATGATGAACATTTTAGAGCTTTCAGT
TATAACAAACAGCCAGCTGAAGAGTGTGTGTTCACCACCACTGGTATAAGGTATAGGCTG
GCTTTGAATTAGTGATCCTTCTGCTGGGATTACAAGGCTCATAGCACCACAGCTAGCAGC
TAGAGCTTTTTGTACTGGGAACTCCCGACTTTGCATTTGTTAAGCAGGCACTTATGCCAC
TGAGCTAAATCTCCGGCTGCACTGATTTAAAGAAGGTGCTTCTGTACCTTTTCAGGAGCA
GATTCATGATTTTATAGTTTTTATTCTGATACTGTTTTGCTCTACTTTATCACTTAAGTA
AAAATCTGCCCATAAACCTTAGATTTATAAGGTGACAAAAAGCAGTGTGCTTGGCTTTCA
AGCACATACTGTAATCCTGGCAGTTTGGGAGGCTAAGGTAAGAGGGCTGCCAATTTGAGG
CCAACTTGAACAGTTTTTTCAGAATCTGTTTCAAAATCTAGAACAAAATTAAATAGGATC
AGATTATAGTTTAGTGGTAGAGTGCCCTTGGGTTCAACCCTCAGTACTATAAGACAAAAC
AAAAGAAAAACAACCTCTGAATTTTTATCTGCATCTCAGCTTATGTTGCATGCACAGTAA
TTTGGCATCTTCCCTGGAGTAGAATTATAATGCAGTTGTGTACAAGTATCTCTTAAAGAT
ATTTGCATTCTTGGTACGCACATTTGGGTGTTTTTCTTTGACAGCTTTTTGCAAATGCTT
TTGTTTGTTTAGCTTTTTTAACATGTAAGGGTTGGTACTGCAAATTGTTTTTACCATTCT
GAAAAAATAGTTCCCTAGGGGCTGGGGATTTAGTTCAGCGGCATAAGCACTTGCCTTGCA
ATCAGGCAGTTGTGAGTTCGATCCCTGGTACTGATAAAAAGGAAAAAGACCAAAAAAAAA
CCCAAACAAACAAACAAATAGTTCCCAAATATTTTCTGTGTTATTAAGTTTATCTTCTGC
AAAAGAACGATGAGAGTAGCCTGCTGTAATCCTACCTTGATCATTAATTCTCTACGTTAT
GTTTTGCTGCACTGACTTTTAGTATACACTACTAAACAGAGCATGATAAAAGCTTGAAAA
TCCTATATCACCGGTGTCCTTCATGTCTTTTTTTCCCCTTTATTGAGGATAGCTATGTAG
TGGTTTTTAAAAATGGGTACTTGATTCTAGAAATACTTCTCTAACCTGATCAGTAATACT
ATACTGTTTATTGCAAGACCTAGAAATGTGTACAGAATAATGAAATGGAATTAAAATGTC
ATCGGTCTACATTATCCTACTTGAAAAGATTTCTGTCCAAGCAACTGAACAAAATGCAGA
TATTTATTTAAAAATATCTCAACATTGTGCATTGCAGATTATAACTCATGAAAAAGTTTT
TCAGAAACATGTTTTCTAAAACTTTCTTGGACTAGGATTCATAGTTTTTGCAAATTTTAC
ATCTTTCATTTCCAGATACTGAAAATGGAATGTAACAATTATTTCAATATAGTTTTTCTT
TTATAATTAATTTGTTTATTTGTGGTATGAGAATGGAACTCAGGACCTTCACACTGGGCT
GTGTCCCCAGCTCTTCTTTAAAAAAAACCAATATGTTTCTTGTGAAAAAGTTTCCCAGGT
TGGGCTCTTAATTTGTGATCTTCCTGCTTTGGCCTTCTGAAATAGTGGGATTATACGTAT
GTGCCACCACACCTGGCAAGTTTAAATTTTTAATTGTATTTATACAAATTCTATAGGTGA
TTGTCTTCCTAAAGTATTCTTATAAAATCTTTTAAAATTTGACAACTAAGGATAAAATTT
ATTGGGTTTGCCGATGCTTTTCTTTTTCATTTTTCTCTCTTGGAATCAAACCCAGGACTT
TATACAGGCTAGCTAAGTACTCTACACCCAACCCCTAAGCCCCTGAATTATTTTCTAACC
TGTTATCTTCTTCAGATATTTGATATGCTGTATCATCTCTGGTTTGAATGTATTTGTTAT
TCATATTGTGTACTGTTTTGAAGTTTTTCCTTCCCTTCAGATTTTGGTTTACTCCTGGCA
CAGTGGTGCACTCCTATAATTCCAGCATTTGTAAGGCAAAAGTAGGAGAATTAGAGTTCG
AGGTCTTCCTGGACTATATAGTAAAACCATGTCTTAGGAAAGAAATTTTTTTGTTCATCA
AAATTGAGTGTGGTGGTCGATACTCATAATCACTGCATTCTCCAGGCTGAGGCAGGAGGA
TCATCACTAGTTCAAGGTCAGTTTGGGGTATGGAGTGAGTTTAAGGCCAGCTCGCACTAT
AAAGCAAGATCTTGTCTCAACCAAAAAAAAAAAAAAAAAACTATATTCTGCTTTTAATTT
ATCCTGAAAAGTTACAAAGAATTCCTTAGAAACTTCTCGAAAGCTTTATGGTGTAAATGG
AAGAAACGTTTTTAAAGATTAAAGTTATATATGTTAATATACCAAATAATTCTGTGAAAA
TTATAATTTTTTTAATGTAACCTTTTTTGTTTTATCTTGTTTTATTTAGTTTACATAAAA
TTTTATTGGCTTACATATATTTTTAATAAACTTGTTTGGCCTGTGTATTCTTTATTAATA
ATGATTGATCTCTTTACCTATTTATTTTGTTACTTGGGTTTTTAATCTTACATATAAAGT
CAGTAGTTTTTATTGTCACTGTGATTTCAATTGGATGTTAGAATTTCAACATGTAAAGTA
TATAATAACTTTTCACTCTTGGTTACCTTTAAGATGATTATCTATAATTGAGAGTGAATG
TTTAAATAATAAGAGTAAATCCAGGTTGTATTACTTACTATTCTTACCAGTGAGATATAA
TGACTCAGTGAGACACAATAGCATCATCATGAGTTATGCATAAAATCCAGAAAGCCAAAA
TGTATACTATACTAAACTAGATATTTGGGCTTTAACTCAGGCTGAAATCAAGCAACAGAT
GTTGGCTAAAAGTCAAAGCACTTGTATAGATTACTTAATACAGCCATAGATGTTTGTGTT
TTCTGTGAGGGTGTTTACCATTATGTTTGCATGAGTAAAATCTGATCCAGTTTGAAATGA
ACAATTTATAATACTTTGCTAATGATTTGATCCTTTTTATAGATACATGCTGTCAGTAAT
TGTGGGCATTTAAAAATTTAACTCCTTTCTATATAATTACGTCTATAGAAGCAGAAAACA
TGGTTTTAAAGTTGTTTTGCTCTTTAGGTTTTTTTTCACACTTTAAAAATATTATTCTAA
AATGTTACTGATTGACTGCTAGCCAGATGCTCATTTGGCTGCTGAAGAAGAAGCTAAACG
ATTGGAAGAACTGCAAAAACAGGCAGCACAAGAGAGATTGGAACAGTTTGAAAAGGCACA
TGTACGGGGTTTCCAAGCCATGAAAAAGATCCATTTGGCACAAGTAAGAATTAAATTCTA
CCTATACCTACTTAGGCTTACGGATAACTTTGCAGAACTGATTAATGAATGGGCTCAAAG
TAGAGGGTGTGAAAAATGTTCTGTATATTATCTGTTCCTATGATTTTACTTATGCCAACT
TCCTTTGCCTCTCCTCTTTCAGATTGGATTATAGTGTTCTCATCGTGTATCACTAGTCTT
AAACTTTACTAGTAATTATTTTCAAAAGCTTAGTCCAAACATTGTATAGATTAATCACTT
CTCATTTAATTGCTATACTTGCAATTTGTGCTCACTTCTTATGTATTTACGGAGCCAAGC
ATTTACTGGCTTTATAGTGTATCGATGAAAGGTAAAGTCACAATCTTTGCTGTCATGTAG
CTTTGAAAAAGTGACTGTTATAGACGTGCAAAATACGTAGTTTTAGCCTTACTTCTGTCA
TGTTTTGTTCAGTTAGAGTTTTTCTTTCTTTTTTTTTTTTTTTTTTATCGGTACTGGGGA
TCGAACTCACAACTGCCTGCTTGCAAGGCAGGTTCTTATGCCGCTGAGCTAAATTCCCCA
GCCCCATCAGTTAGAGTTTTTTCTTAAACATAGCATAAAAATGATTTATCTTGTTACAAG
CCTTGTTTTTCTAAATTTGACTAATACATTTGGATATTTCAAACACTCATTTTAGGAATA
GGTTTCTAAATATATCTGGAAATTAAATGCTTATATTATAAACTTCATTCATAAACCTCA
AATAAAGGTATGACCTCTTAATTTTTAACTTTTGCTAACTTGAAGTGAATTATAATTAAA
ATAAGTGGAATTCCGAATTTATTAGAAATTCTTACATAAGGTTTAAACCTATAGAAAATA
TACACATGAGAAGCTATCATAAACTGAACAGATTCTTCCATAAATGCAGTAATACTTAGT
GGATATGAAAGCATGGACTTCACATCCAGTTTGCCTGGATTTACCTTTGTTTGCTTTTAG
GAAAGTTACTTACTTCCAAGTTCTGTTTCATTTTCAGTTTTATCAGTGTTACTGAGTTTA
GTAAACTCCTTAGAAATGTATGTGGAATTTCATAAGCTCATAATAAATCTTAGTGGTGTG
GTCATTGTTATTTTAAATAGTATAAGTAGAGTAACATACCCAAACTTTCAGTGAGATCGT
ACACTTAATTCATATAATTCTGTAGTTAATTTGCTAAGATGAGTCTTAAATGAATTTGTT
CATAATTTAATTGTTTCAGAGCATGGCCCAAAAAAATTCATCTGCCAAAGGCAGACTATT
TAAGGCTTTGCAAAAGAATAAGTAATGTGTTTATCACTTGGCCAGGCTCTTTCTGACTTA
CTGTAAACTTAGTGTTTCTTATCTAAGAATCAAAAGCCACCTAATCTGTCTGCTAGTAGA
TCTCCTTTTCACTGTCTGAACCTTTATGTACAGACCTTGTTACCATTTGAGACTGTGTTT
TCTGCTGGGTCTGTTTTAACTAACATTTAGCCTCCATCTGCCTCTTCAACTTTGTCTTCT
TTTCTTTACTCACCATTGTTCTCCGTGTCCTGCTCTTTTTGAATTCTTTATGCCTTCATC
ACCACACTGTTGTGCTCCATTTATTTATTTATTTATTTTTGTACTGTTCCTTCACCCACT
TTTATCTATTTAAATCTTCATTCCAAGGACTGAATGGTCTCTTTCTCTTTAACCTCTACC
ATCAAAATTCAGTTACATAACCTCATTAAACCTGCTTACATTTTCATATTAGCTATGTTG
TAAGCTTAAAGGGGTATAAACATATCCCACCTTCCACTCCTGACTTTTTTTTTTCCTCTG
GTAGTGCTGGTGATTAAACATAGGTGTTCCCTACATGGGAACTGCATTAGCACTGTAGAT
CCACTTCAGTTCTGGGAATTGTAGAGTAAGGAGTAGGCAGGTGTAGTGGTGCACGCCTAT
AATCCCAGAGCTCAGGAGACTGAGTCTGGAGGAATGCCATGAGTTCAAAGAGAGCTTGAG
TTCAATTGTGAGTTCAGCACCAGCCTGAACTGCATAACGAGATCCTGTCTCAAAGAGAAA
AAAAAAAAGTGTAGAGTAACAAAAAATATCATCTGTTGAATCATAGGCATTGTGGTTCTT
AGTAGTGATCTAAAACGTGTATATGGAAAACTGGATCACAGTACATTTGGGAGCTATGGC
AACGTAAATTGAAAGTACCCCTTACACCCACATACACACCATAACTTGAAGTATCTGGCA
TTCAGCAAATGTTTGTTGAATGCATAAATTAATTAATGTAATTTGTCTTATTGCAGAACA
CATGATGGAGGAGAGGGAATCCTAGGCACTGTTGCTCATGGTATCCCCACATTAATGTTA
GTATCTGGTTTGACTCAGTTCTCATTAATCTCTTTATTCTTGAAGACTCAAGAGAAACTA
ATGAAAGAACTTAAACAGCTGCAACAAGAAGACCTGGCACGTAGAAAACAGACTGTAGCA
CAAATGCCACCACAAGTAGTTGAACTTCCATACAAACGCAATGAAATGAAAGAAGAATGG
CAGAGAGAGCTGGAATTCGCATTTGAAGATATGTACAATGCAGACAGGAGTAAGATATTT
TCAGTAGTGCTTTTAAATGTTTTGGTGGGAAAATGTAAAAACAGTTTTTGTTTTGAAATG
AGTTTTCAATTTGAAAGAGGCCCTTATAATTTAGATTTGGGAACTATGATGGCCTTTAGC
ATTTTTGTGATTATATTGTTTTTAATCACTGGAATGGAAATGTGTCTCTTATTTCTTTAT
TAAGAGGTGAAAGGAGACCTGGTCTTGCATCTTGAACCAGAACCTTTGCCCAGTGTGACT
GATCAGATCCAAGATGAAGAATTAGACCTTTCAGTGGACCAAGAAAACATAGGTGAAGCA
GAGGACCTTCCATTGACAGAAGCTGACATACGTTCTAGTGAAACAGATGGTAAAATCCCC
TTTTAACTGAATATTACAGTATTTCACAGACAAAAATATTATTCATTAACAGGAAAATTA
GGTCTAATTTAAGTGTAAAACAATAACTGATATAAGAGTGGTGGCAGGAGGAAACAATGT
TTTCGTATTTCCATCCTTATAGATTCATTTCATAAACAGAAGAGGGAAGTTCCATAGTGT
GGAGATTTTTAGGTTAAGTTAAATGTTCAATTCTGAATTCACGTGAAGGGTTAACATTTG
TTTTTAGACTTCATCAGGAGTCCAGTTTTGTTCCCTTACTAGTACGTATTTCATTTATCA
CAGTGAATAGTACAGACTTTGATGTCCTGCCTTCACCTCTGTCTCTAACATCCTGAATTT
TTTCTCTTTGGTGTCCCACAGACATTTAAAACTCAGTATCCAGCAATAAAATTTTCATTA
TCTCTTGTAAAACCTACTTTTCCTTCTTTATCTTGGTGATGGTACCATACTCAGCCCAAA
TCTGTAGGATTCAATTTACCCTTAATATTTCTCTCTCTTTTATTGTCCACTCCTCTTCAT
TGAATTGACCTGTTTTCCTTAAAGTATCTCTGAATTTTGCCTTTTTTTTTTTTTTTTTCC
TGGTTCCAGGAATCAAAGAGCTTTGCCTTTTTAAATAAAACACTCAGCCTGTCTTAAAAT
CTGAATCTTTTAATGTAGAAGCAATCAATTCTTCAGGGTTCCACCTTTATGTAGGTCTCC
TATTTGATTCCTTTGTCGAGGCGCAAGGCCTTATTTTACCTTCTCCTATGCCCACATTGC
TATTTAAACAAGTATATGGTAGAGTGTTTTGACTTTCACTTAAATTTGATAAAAAATGGT
CTTAGTACTGCTTGTCTTTTTCCCAAGGTTCCCACCTAAACTTCATTTTTGGCTCTTTCA
AAATGTTTTCTTTTCTTGCCATATCAGCAATGTGTTAAAAAGATGTTTTTACCATTTCTT
CAAGCTTTTTTAGTCATTTTAGTGAAGGAGAGAGAATATTATTCAGATATCTGATTTGTC
AGAATTAGAAGTGTGGCCTTGCCTAAAGAGGAGATATTTTTCAGCCTTTGCTGATCCCTT
TTAGACTTACTGGATTGGTATTGCCAAGTCTTGATTTTTTTTTTTCCATAAAAACCTAGG
AAACTGGGCATTATGGCACATTCCTGTAACCCTAAGAATGCCAAAGGCTGAGGCAGAAAG
TTTACTTGGTGTCAGGAAGTCAGGGCAAACCTGAACAGCATAGTGAGACCCCATCTCTTT
TAAAAAAGAAGGGGAAAAAAAGACAACTAAGAATTCCATTGTTTATTTAGTCATTATTTT
AAAATATTACTGCTTAATGCTTCTTAAAAATGAGTGGGTTAGCCAGGTGTAGCATTGCAT
ACCTGTAACCCCAGCAGTCTAGGAGGCTAAGGTAGGAAAATGACAAGTTTAAGTCTAGTC
CGGACAACTTAGCAAGGCCTTGTGTCAAAACATTTTTAGAAAGGGGCTGGGGATGTAGTT
CAGTGCACAGGTCCTGGGCTCAGTCCCGAGAACCACATACACACACACACATAAAAAGTT
TATGATTCTGTGTATATGTAAGTTAAAAACAAATCAAGTAGACAAAATGAGCTGTGGTTT
TAAAGAGTAGTGGTTATCTTTAGAGTATATTGATTGAAAAGGGCTATGAAAAGCCTAGTT
GTGGAAATGTCCCACATAATGATCTAGATGCAGTTGCAAAGATGTACCTGTAAAATTCAT
TAAGTCATAGCTTTAGATTTTGTGTACTTTATTATCTGTAAGTTATAACTAACCCAGTAT
TTGTAAAAACGCAGTCACAAAAACAAACATTTTGGTAGTTTTCAATATCTCCTGTAGATA
CTGTTAGGTTTTATTTCTTGATTAAGCCAAAGACCTTCATGCTTGCATTTTGTTTCTATA
GAGAATTAGTTTTAAATTTTAGCATTTGACATCAACCAGTATGGAAGAATATTTTAATCA
ATATTTCATTTTTGCTTTTTTGATAGTTGAAAAGATTCTTACGAAGATAGGTGGGAGAAA
TTTTCTCAGATAATACCAGGAATGATTTCAGAGAAGTTGATTTGCTTTTAGATTTTAAAG
TAAAGTTTTCTTCTGTGGCCTGCTAAGAAGTACAGAGCTGTATTTGGAACCATTCCCTAG
CAAACAGTATAGAACCTTACAGTTTGTATTCCCAGTATTAACCTTACCCAGAAGTTAATT
AGGAGGTATGCCATCTGCCATCATGTAGCAAGCAGTCCTCTTGGTAAGTTTTTAAGCTTG
TGATTTCTGTTACTGCATATTTTTGGAAAATAATTGAATTTTGGCATCTTTATATGTAAA
TTTAGGTTAAAAATATTATTCCTGATGATACATATATGAACAGAATCAAAAAGCATTGTA
TCTATTGCTAAATGGTAAGTATTGTCAAAAATAAAGTTGTTCTTTTTGTTTTAATCAAGT
GATTGGTATAGAGATACAACAAGTATAGAGATACAACAGTTTGCGTGGCATGAAATAAGT
ACGGAGTAAGAGAGTTTTTGTTTTTCTTTTTTCCTCTTAGATTCCTTGGCAATAAAGACC
CAAGAGCTCCCTTCAAAAGTTCTTTTTAAAAAATTACTAAATAAGATTCGAAATCAAAAA
TCTCTCTGGACGATTAAATCCATGTCTGAAGATGAAAGTGAAATGATTACAAACGTTAGT
GAAGCTGAGAGTAAAGTACCAACAGTTGAATCTGGAACAATTGCCAGTGAGGAAAGAACG
CTATCCACAGAACAAGAACATGGTAATTCTCCCCACTAGTCCTGTTGTATAGTGTATAAA
CCTTTGTAACTTTAAAACTATGCTCATTTTTTGAAAAATCAAAGAATAAAGATTTAAAAG
CATAGTCCTGTTACTTAAAGGCAACAGAAATTGAAAATCTTGATCTCCTTGTTGCCTACT
TTCATTGTGATATTATTAATCATTTATGTATATAAATTCCAGTGTAATTGAAATTACAAA
ATTAACCAGTGCCCTGTTACTGGAATTTTAGGCTGTTTCTTTTGTTCATTTGTTTCTTTG
TTCTAGGTATTTTTGGTGAAGTCTTTGCCCACGTCTTTATTTCCTTAGGAAAAACTTTGA
AGAATTTCTGAATAAAAGATTAGAACCTGTTCATGGCTCATACTAGCTGTAGTTTCTGTT
TCTTCTACATTCCCACCCATGATTAGGTTTCTTTGTTAATTTTAAAGAATATCTTTGGTT
ATAAGTAGGCAATTAAATATATTACTAGAATTTACAAAAATCATGCCAACAATATTTCCT
TCAATTATATTTGAGCAAATGAGAATTATAAAGATGTAACTCTTCTTTGATTTGTTTCTT
GATTTTGTATTTTAGACTCCATTAAAGATGTGTTTGTGGGCCGGGGATTTAGCTCAGGGG
CATAAGCGACTGCCTTGCAAATGCGTGGTCTTAAGTTCAATCCCTGATACCAAAAAAAAA
AAATGTGTTTGTGATTGTGTGAAAATGTTGTGCTAGCAGACTGTTGAGAGAAGTGGTTTA
TGGTCTGTATTTGATGTACAACAGGAAGCCTTGAAATAAAACACTTCATTTGGTCTTTTA
ATCCTTCTTCATGGTTTCCTTCTCTGGTTATCCATTTTTCTACAAACAGTAGCTGTTGTC
TCCAGAACTCATTCCTCAATTCATTTCTTTGCTTTAAAACTCCTTAATTTCTAATGTCAT
ACTTTATGTCACTATCTGTATACCGGTGTCTTCCAAAGTGTGTTTCTAGGCCTGTCTCCT
CCCATTTGAATTCAACTCATATACTTAACTATTTATTTGCCATCTTCCCTTGTATATCTA
CTAACATTTCTCCCCCAAACCCTTTTGCTTATTTGAGACAGGGTCTTACCATGAGCATCT
CAAATTTAAGATTCCCCTACTTTAGCCTCCTGAGTGTTTAGATTATAATCCCAGTTTATA
CCATTATGCCAAGATTTAATAACAACTTAAATTTATCCAAAACTGAGTTCCTGATATCCC
CTCATACCCATTTTCTTACAGTCTTTCACAATTTAAAAACTAGGGATATTTTAATTCCTT
TCATCAAACCAAAAAGTTTGTAGTCATTGCAATTAGATTGCAAATCCAATTGGTCCTATC
TTTCAAATGTACATATAGCCCAACCGTTTCTCACCACTTGCCACCCCATTTTAAGCCACA
TTTTTTTATAGTACAAATTCCTTTTTTGTGTGTATGGTATAGGATAGAACTCAGGGCACT
GTAGTGCTGAGCCACTTCCCAAGCCCTTTTTATTTTTATTTTGAGACAGATCTCACTAAG
TTCCCCAGGCTAGCCTGAATTTGGAATTGTCTTATTCTGATGAGGATGTGGCCACTGTGC
TGGTTCTACTATAAATTCTTATAGTGATCTTTGTCTTCAGCTTTCGTTTCTCCCTCCTAA
AGTCTGTTCACTGAGTGATCCTGTGAAAACACAATGCAGCTTATTCCATTCTTCTCGATG
ACGTCCTCTAATAACCTCCAGTCTCACTCAGGAAAGAATCAAAGTGATTACAGTGGCATC
ACAGCTTTGTATGGCCTACGCACACGCATATACCACTGCTATCCTTATCATCCTTCTGAC
TCCATTTTCTGCCACACTTTCTACCCCAACTGCTGTTCTGCAGATGCTGGCTTTATTTCT
CAAACAGACCAGGCATGTGGTTCATGTGGAGTTTGTGAGTTCAATCCCCAGGATGACAAA
ATTAAACAAGGAGAAGGGGAAGGTAACTGGATTTTAACTAAGATATTTAGGTAGATCAAG
ACTAAATGGTAATTGGAATGCAAATTTTTTTTTGTTATTTTGCTTCCTGTAAGCTTAATA
ATAATAGGATTATAATGACAATGGTGTTATCTGTTACAGTTATGGAAAGTGATTTACTGA
CAATTGAGTCTGGACCACTTACAAGTGAAGATAAGCCACTTTCATGCCACACAGACTCTG
GAAAGGAACAAGGTGCTTCTTTTTATCACATCTTAAGACTCTACATCTTTTTCCTAGTAA
GCTTATATGTAATAAATGAGTGGAAGGGCATCATAGTGGGCTCAAATTCCTGAATTATTG
GAACTAATTTTTGTTTTGGGGATTCTCATAGAAATAAATGAGACTCCACCTGTCACAGCT
GTAGCTCAGAGTTCATTTTTACTTCACCCTCAAGAGGAAGCAGTCAGAGTTAGAATGTTA
GCAAAGCAGAAACAGGTAATATGAAATTGTATTTTTAAAGCTCTCTTTTTTCTCCTAAGT
AGTGAAATTTTGTTTGACTTGTGTAATCTGATTCACCACCTGACTTTTTGATATCATGTT
TCCTACTTTGTCTTATATAAACATTCCCCTGATAAAATACAACTTATTCTTTGTACTTCT
CATTTGGCCCTTACTGTACCTGCTTTGTATAAGCTTTTCAAAGGCAGACGCTATCTTTAG
AAAATTTAGTTTGGGCAGGGGATGTAGCTTGGTGGTAGAGCACTCACTGACCATGTGAAG
GCTATGGATTCAATCCTTAGTACCTGCCAAAAAACAAGACAGGCACAATCATTGTAGCAT
CTGCTACAGTGCCTAATATATTTGGACATTGAAATGGGCTTTGTAAGCCCCAAAGACCTT
TGGAAAATAGTTTTTTAATGGGAAAAATTTTTAATTAAGCTTTCTTTACTGTAATTTTGA
TGGTTTTTTTTTTTTGCACCGGGAATTGAACTCATGACCTAGCGCTTGCCAGGCAAGCGC
TTATGCCACTGAGCTAAATCCCCAGCTGCACTTTACTGTAATTTTATTGTTTAGTGCATG
TTTGTAGTACAGAATAATGATGTTTGGTGTGTATGAGTAACATCTTGATCCTGTTTTGTT
TTGTTTTAAAGACAGGGTCTTGAGCCGGGGATTTAGCTCAGTGGCATAAGCACCTGCCTG
GCAGTGCGAGGTCATAAGTTTGATTCCTGGTACTGGGAAAAAAAAAAAAAAAAGACAGTC
TTCCTCTGTACTTCAGGCTGACCCTGATCTCACTATGTAGCCCAGGCTGGCCTTGAATTC
ACGGTAGTCCTCCTGCCTCAGCCTCTCAAGGGCTGGGATTGTAGGCATGTACCACCATGC
CCTACTTCTTGATTATTTTACCTTCCCTTTCCTCCCTCCCATGATTCCCATCCCTGTCTC
CAAGAGTCTACTTTCTAGTTTAGGTTTCCCATATAGGAATAAATATCTAACTTTCTGAGT
CTTGACTTCTTTGGTTTAGCATCAGGGTTTTAAGTTTTATCCATGCAAATTATGTAGTTT
TATTCTTTATATGGCTAAATTATATTCCATTGTGTGCATACACCACATTTTCTTTACCCA
TTTTATCCTTTGATAGGGATCTAGGCTATTTCCAGGTCTTACCTATTGTGAATTGCACTT
TTATAAATATGGGTTTAGATGTATCATGATGTATCATATGATGACTTAAACTCTCGAGAA
TATACTTCAGGAGACATAAATGGATCAAATGGAATTTCTATTTTTAGTTTTTTGAGGAAT
CTCCATACTGATTTTCATAATAGTTACAATACCTTACATTACCACTGACAAGGTAGGAAG
GTTCTGCTTTCCCCACATCTTTGCCAGCATTCTTTTGTGTGTTTGTGTTCCTAATGATAG
CCAGCTAATCAGGGTTACATGGAATCTCAGAGTTGTTTAGATTTGCATTTCTGTAATGGC
TAAAAATGTTGAACAATTTTAATATATTCACTTGCTCTTTTTACTTCCTTTTTTGGGCAA
TGTCTTTTCAATTCATTTATGCCTATAATTCCAGTTACTTGAGAGACTAGGCAGGCAGCT
TGTGGGTTTGAGCCCAGCCTGAGCAATGGAGTGAGATGCTGTCTCAAAAGAGAAGGAAAG
GGAGGGGCTAGGGATTTAGTTTAGCAGCACAAGCACCTGCCTGGCATGTGCGAGGTTGTG
AGTTCGATTTCTGGTACAAAAAAAAAGGAGAGGAGGAAAGGAAAGGAAAAGGAACTTAAA
AGGCACTTAAAAAAAAATTCAGTGATATTATGATGAAGGAAAGTAAAGAAAATGACAGAC
ACTCAGTTATAGCCACTATTGTCTGGTGAAGGGTATCAAGTCAGAACTTTTTTTACTTTG
AAAAAAAGCTTTGCTGGCTTATCTCTAGTAGAAGTACTCCTCTTTATAAAACTATACATA
TATTGGGTTTTTTTATTCAGTAAGTTTTTATCTGTGTATCAAAGCCTGTACTAGGTACTA
TGTTTGGTAGGCAACAACACTAGATAATTACTGTATTGCTGGTCATAATGACACATGACT
ATAATCCTAGCACTGAGAAGGCTGAGCCAAGAGGATTCCTGGGGGTTCAAGGCCAGCTTG
AGCTACATGCTGAGTTCAAAGCCAGCCTAAACTATAGTGAGACCCTGCCTCAAAAAGAAA
AAAAATAGATAACTACTGTCTTAGTGAGTATCCCTAAGAAATCAAAGTGTTTTAGAAGGC
CTACATTTTTATTTCTTTAGTCATGCATACTGAGAACAATGGAAAATTAAAAATATAAAC
ATAGAATTTGGCTGCATACCATTTGCTACTTCTCTGGGAGTGGTTCTTCAGTGGTACTCA
GGATTTCCTTATGCTTTCAGAAGATAGAAATAGTAATGTGTTTGTTCCTTCCTCTCTTAC
TCTGTTGCCTTGCCTTGGTCTCCCTTTTCTCTCTTTTCCTCCTTTGCCATGTCTTTTATC
TTCCCCCTGGCATTGCCAGTAACACAGATGAACACCTTTATGGATAAGTCATGGATAGGC
TATATTCTTTGCTGTAAAACCTATTGCTTTTTCATGTTTTGTGTTTTGTGAGTTTGTTAT
TAACAGATTGATAGTATTTTTATTACCTAGATAATGGAACTAGAAGAGCAAAAGCAAAAG
CAGTTGGAATTACTTGAACAAATTGAACAACAGAAATTAAGATTAGAAACTGACTGCTTC
AGGGCTCAGCTGGAAGAAGAAAAAAGAAAAAAACCTCAACCAACTGGGGTAGGATGCATG
AAATGTCTACATAAATCATTGGAGCACAAGAAAATATTAGCACTCACAGAATTTAGAAAA
ATAAAATGTCTCTAATCTTTCTTTGCTTACTGAATAATGTATATATAATAACAAGTTTCT
GTCAGCCTAATGGCTTTTTGCTTTGAGTGTCCATAGAGTGCAGTATAAATGTGCTATCAG
TAAAATTATGACTGTAATGTATATGTGATATGTAGTGATGTATGTCTGTAATCCTAGCCC
TCTTGAAGGCTGAGGCATGAGAACTACATGTTTTCGAGCCTAGCCCTGATAGCTTTATGA
TTTAGTGAAACCTTATCTTAAAGTTTTTCAAGAAAGCACTGGGGATATAGCTTAGTGTGA
AGGCCCTGAGTTCTGTCCCCAGTAAAAATAAGTAAGTAAATAAAGCTATATAGTAATTTA
CAATTGTGGTCTATGACCATACCACCCTGAATGCACCCAATCTCATCTGATCTTGGAAGC
TAAGCAGAGTCATGCCTGATTAGTACTTGGATAGAAGAAATATCCAATTATGGAAGTTAA
GTTTACCTTATTATTTGTTCTGAATTTGCCTTTTAATTAACAGTTTTGTCTTTTATCAGG
TTGGCACTGCTCCAGTACCATTCCCTGTATTTTCTGATGAAGATAGTCGTAGGCAGATAA
TTCGTAACTACCAACAGCAGCTTTTACAACAAAACAGGTATTGGCTAGGGTATAATTTCC
ATATTACAGTGTAGATATGTCTTTTGTCTTTAATGAAGATCTAACTTGAATATGGATTTC
TAAGTTTAATGTGTAAAAACTTTGGTGCATTTGTTTCATTTGTTATTGTGTTTGTTCTTG
GTAGGTTACACAAGCAATCTGTTGATACAGCCAGAAGACGATTACTTGAATATCAGATTT
TGTTAAAAGGAAGGTTCCCATCAACATCAGCTACATCATTGATATCTGATTCCATTATAA
CCGTACCACCACAGAAATCTGAAAAATCCACTGCTATATCACAACCTTGGGATCAAAGTC
AGAGATTCAAGTCGAGTCTTAACAAACATCAACCCATTCAGATCTCGAAATTAGAGCAAG
ACTATATTCATGTACCAAGACAAAGTCAGTTTGCACAGATAAAAGAAACATCAAGCACTT
CAGATTTTTTAGCCAAGCAATCTTTGGAGTCACAAGATCACCTAAGGCAATTCTCTCAGA
TTGAAACACAAAAGGGAGACTACAAACTCATCCCTAAAGGTTTACATGTGTTTTCAAGTA
CTTTATCACATGATAGACAGCCACTGTTACAGGACACTGGAAAAATATCTGAAACATTGA
GGCCAACAGCATCTCAATCTGTAGATTCCCCCCAAATAGTGGTAGACAGTGAAAATATTT
TTTTGAAACTAACTGAACCTTCATTTCTACCACTGGTACCTGAGCATTCTTTTACTATTC
TCCCTAGTAAAGTAGAATCTAGAAGAGTTCAAGAACCCTTTTCAACCGTGAATAAAAGTG
CAGTTTCTGTAAGCCATTCTGTAATCCCCAGCCAAATATGTGATCAACCTGTTCCATCCT
CAGCCACTGTCACAACCCAGCAAAATAATTTGAAGTTTCTTCAGGAGCAGTTAGAACTAC
AGAAGGAAGTTCTTCAGGCAAGACAGGAGGCTCAGGAACAATTGCTTTTGCACAAACAGA
AAGATTTGGAAGAGCAGACTGGTCTTTCTGTATTCTTCCCTATGGCTGTGCCAGATTCAT
TTGCTTCACTGCCTTCTGCTATAACTGAATCTGGGAGAATCCAGGAACCTTTTCCAAACA
AGAATGCTCCTTCACTTTTCTCAGGCCATCCTGTCCTTCCACATCTTCAAGACAGTCTTT
TGAGTTTTTCACAGCCTATCTTAGCACAACAAAATAATTTAAAATTTCTCCAACAACCAT
TAAATATTCAAAGAGATAACCTTCAGGCTAGGCGGGAAGCTCAGGAAGTGTTATTTGTAC
ATAAACAGAGTGAACTGGATGGAAGAGTATGTTCTGAACAGGCTGAGCCCTCTTCTCTGC
CATGTCAGGTGGCTAAGCATACATTGGCTTCACTACCTTTTCCTGACAGAAAATCTGAAC
CAATCCAGAGGCAGCATTTATCTAGGGAAAAGGTGCTTCTTTCAAGTAAGTCTGAAATCC
CAAATTCTCAGAATGGGTCATCAGATTTCCTTCAGCAGTTTCTACCTCATGATAATTTGA
AGTTACTCCAAGGACAAGTGACTCCAGAGACAAATACTCTTCCAGCTAGATGTGATACAC
AAGTGGAATTACTTTCACATGGTCAAAGGGATTTGAGGGACAATTTGCCTGGACAGATGA
GTTCATCCTTACAAATGGTTATTCAACATTCAGATGCCTCACAAACCTTTGCTACTGTTG
AACCCAAAAGAGTTCAGAAACTTAGTTCATTTGAGGAAAATATTATTCCCTGTAGTCATT
TTGTAATTCCACCATTTCAAGATAAGTCTCTTAATTTCCCACAGCATAGCCTCCTTCAGC
AAGAAAATTTGAAAATACTTCAGGAGCAGTCACACATACAGAGGGTAATACTTGGTGCTA
GACGAGAAAACCAGGAATTTGTATGTAAACAAAGTGAATTGGAAAAAAAGATTCCTTCTG
AACAGACTGGTACCTCTTCATCTTTACCCCAGATAGTTGAATCTGAAAGATTCAAGGAGT
TTGTGTCAGTTCCAAGTGATGTAAATGGTTTCTTTAGGTATTCTAAGATTCCAAGATTGC
AGGAAGGGCTTTCACACCATATGCTACCTCCTCAAGATAATTTGGAAGAACACCAAAAAT
GGTTAGACACAGAAAAAGAGGTCTTTCATCTTAATCAGAAAACCCAAGAAAATGCATCGT
CTGAACAAACTGGCTTGGCTTCCTTTGTACCCCAATTAAGACAACTATCATTTACGTCAT
TACTTTCTGTTGGCTCTAGTACAACCCAGGATCCTCTTTCAACAGAGAGTGATAGTAAAA
TTCCTTCAAGCCATTTTCAGATCCCACAACTGCAGGATAGACTTTTGAAGATGTCACAAC
TTATCCAGCCCCAACAAGATAATTTGAAGGCACTTCAAGAAAAGCTAGCTATACAGCGGG
AGGCCATAAGTCAATCTAGACAGGAAGCTCAGGAAAAAATACTTTTACTTAAACAGAATG
GGTGGAAGGGAAGAGTATCTCCTGAGCAGGTTGGTACTTTCTTACCCTTAGTAGCACAAC
ATTCTTTTGCTTCCTTACCTCCTGAATCTGAGCAAACTCAAGAACTTCCTCCAGCAGGTA
AGACAATTTCAGGTCATTCGGAAATACAGAGATTTCCCAATAGGCTGTTGAGTTTATCAC
ATCCTGTTTTACTTCAAGAAGATAATTTGACTGCACTTCAAAAACACATACCTACACAAA
CAAATTCCTCCCCTTCTATTGAGAAAGCCCAGAAAGAATTAATGTTGCCCGGACCATACA
AATCTGAGGAAGAGATACTTTCTGAGAATTTTATCCAACCTCACCATGCTGATTTGAAGT
CACTTCAACAGCAATTAGATGCACAAAAGAAAGCCATTCGATCTGGACAGGAAGTCCAAG
AAGAACTGCTTTTGCAAAGATTAAGTCAGTTGGAACAAAGGGTGTCATCTGAGCAGATTA
GCTCCTCTTCACTTTCATCCCAGGTGGTATTGCCTGCTGCCCATTCTGAAACAATTGGGA
AGTCTTTCCTAACCAAAAGCAATGATACTGAGACCCCAGGGTCACAGGCTGGGTCTTTGA
GTTTTTCACAGCCTTTGCTATCCCAGAAAGATAGCTTGACAGCACATTCTCTTGAGAAGT
GTCAGGCAGAACTGCTTTTAAGCAGGCACAGTAAGTTGGGCAAAAGTGAACCTGTTGAGC
ATTCCATCTCCTCTTCATTTCTGTCCCAGGAAGCAGAGCATTCATTCATTCCATTACCAT
TTGCAGAAGCTAAATCTAAAAGTATTTGTGAGTTGTATTCATCTGAAAGTGAACATGCTC
CTAGCTCAAGTGATTCTATGATCTCATGGTTTCAAGATAGACTTTTAAGCTACTCACACC
CTGTTTTAAATCAGCCAGATAACACAGCTTTTCAAAAGCAGTTGGATCAACAAAGGGAAA
TTCTGGATTATAGCCAAAAAGCCCAAAAAGAATTGCTCATACAGAGAAGAACAGCCCTGC
AGCAGCACATCCAGAAACATCACGAAACATTGAAGGATTTCATTAAAGACAGCCAGGTAA
AATTTAACCTAGGATACATACGGGTTAAACGATGGAAGTAACACTAATGTGTGTTAGTTA
CTGAGAATTAGTAGTTTGACTTTAAATGTAATTTTCTTTCACTAACAATTTGTTGTACTG
GTCATAATGACACCAACTTCATCACAGCTACTTGGAAGGGTGAGGTAGAAGATACCACAA
GGTCAGCTTGAGCAACTTAATGAAACCCTGTGTCAACAAAGCTGGCCTGGTGTGGTGGCA
TAGGCCTGTAATCCCAGCACATGGAAAGCAAGAGAATCATCAGAAGATTGAGGCCAATCT
AGGTTACATAGTTTAAGGCCAGTCTAAAGTACATAGAAAGACCCTGTCCCAAAAAACAAA
CAAGGCTGGGAACCATACAACTCATGGTATAGTATCCATGGGTGCAATCCCCACCAGTGT
TATGGTTTTTTTTTAATTGCCTTACCTGACATGTTGACTATAACATTGATATGTTTGAAG
CTCAACTAATTTTAAGTTTACCAAAAAAAAAAAAAAAATCTTTATTTGAAGTTTTCTTAC
AATAAACTTTATTATACAGTAAAATTGTAAAACCTAGTCGGCCTGGTGTGGTGGTAGACC
TCTATAATCCCAGTATTTGGGAGGCTGAAGTGGGAAATCATGAGTTGGAGACCAGCCTGG
ACTACATAGTAAAACTGTCTCAAATACAAAAAATAACTGCTTCAGCAGAATTTTTCTAAT
ATAGTAGCATATCTTGTGCTCTTTATTGACATATATACATGAATCAGGATAGTACTCTTT
TCCCTTAAGTGACATATTATTGTCTCCTGTTGTAAAGCTGGCATGATTTCTGATAAAGAG
CTGGACTTCAGTTTGCATCTGAATTGTTGCAAATACTGATACTCACATTCTCAGTTTCTT
CACACGTGAAACAAAAGTGTCCTAAATATGAATGGATTCATTTTATTATAAAAGGTCGCT
AAAATGTATTAGTGTAAACAATTCTGCAAATCCTTGGTGTTCAAAAAAAGTTTGAATTGA
GTCCAAAGTCAAGTCCTACAGATTTTTCTAGTCATTTGAAGTAAAAGTAACAGAAAAGAA
AACAGTGATTTCTTATTGAGAGGCAGAGTGAAGGCTGAGTTTTTAGGTATAGGTTGTACT
TTTTCGTGGAGATATCCTTTCAATATTGGAAGCATATGATTTTTTAATTATAATGTGGGT
GATGAAACTTTATTTGATTACAGTTGTAATTTAAGAAGGGAAATATATACAATCCCCAAT
TTGTGTCATCCTCACCCTTAGCTGTCTACCTTTTAAACAAACATGCTTACAGTTCAGAAT
AATTTTTTTAAAATGCAGAAGGTGGAACAACTGAGAGAGTGGCTTCCTCTTGTGGAAGAC
CTAGCAGGAGGCCATCGGGAAAGCTCTAGTCACGCAGATAGGAGCAATGCTGATGATAAT
CAGCTGCTGGCAGAAGATGTCAGGTCCACCAAACAAAGTGGTAAGATGATTGCATTTTAT
TGCAATTATTCAGCTGATTCTTTTCTTACTTTCATCTCCTGTAGCTTGCTGGTCAAAGAG
TGTTCAGTTTCATTGTAATTTTCATTCAATTTCACTGTTGTCCTTGACTGGATAGGTGAG
CCTGTGCTCAAAGAACCAGATAAAAGAGCCTCTAAGCCACCTGTGACAAAAGTTAAATGT
GGATTGGATTTAAATCAACATGAACTTAGTGCTATACAAGAAGTAGAATCACCAAAAAGT
GGCAGAACTTCTGTGCCAGGTAAACAATTTGATAAAAGGTACATTAGTAGTTTACCCATT
TTCTGCATATTTTCAGGATGCTGAAATTTGTTAGACTTAGTCTTTGAGTACTTGTGAAAG
GAAAATATTGGCTTGTATAACACTATTTAAAATTGGGGCTGCTGGGTTGGGGGCGCATGC
CTGTAATCCCAGTACTGAGGCAACAGGATCACTGCAAGATTAAGGTTAGCCTGAGCTACA
TAGTGAGTTCAAGGCCACCGTGGACTACATAGCAAGACCCTATCTCAAGAAAACAAAACA
AAACAAAAGTGTTATTATTTTCTTGCTACAGGTACATCAGGCCTTTAATGGTTTAGCTTT
TTACTTGTAAATTGCCGCTTAATTTTAGCCAGATCTAGAAACTTAAGGAGAAATCTTATT
TTTCTCCCAAATACATTTTATTTCAAAGATAAAAAGAAAAAAAAAGTAGGGGAAAAAATA
CAACAAAACGTGTCAATCAAGAGGCAACAGTGATATGTAAATTGTACATTGTCATCCCCA
AATCATCCATCAGAGCATAAGACATCTGCATTCAACTGTCGGAACAATATTAGCACAATC
TCTTCAGTGAACTTGAGAAATCAGTAGTATAACTATCTTAACTATTTTTATATACATACA
CATACACGTTTTTTCTTTCAGCATCTCACACTAATGAAACAATATTACGTCAACACGTGT
CTTTATTTCATTAATGAGTGTGTTTTCAAGTTGCATCCATTTACCTATAAAAGTCTTTAG
TTTATCCTTCTTTGTGACTCAGTAGTACTCCATTGTATAAAAATATCACATCTTTTTTTA
TCTACTTCTCAGTCAGTGGGGATTTAGGTTGTTTCCAAGATTTGGCTATTATAAATTGTG
TTGCTATAAACATGGGTGCACATATGTCACTGTGGTATGATGATGGTTCTAATTCTTTTG
GAAAGCTACCCAAAAAGGGAGTAACTGGATTGAATGGAATCTTTAGTCCTATTTTTTTGA
GGAATCTTCACACTGATTCCACAGTGGTTACACCAGTCTGCATTCCCACCAACACTGGAG
GATTCCTTTTTTCCCCATAGCCCCTCCAACATTTGTTATTGCTTGATTTCTTGATAATAG
CCATTCTTTCTTGAGTGAGGTGGACTCTCAGTGTTATTAATTTGCATCTCTCAAATGACC
AGTGATATTGAACATTTATTTGTTGTTTATATTCATCTAAGAAGTGTTTATTCATCTCAG
ATGCCCATTTTTAGATTGAGTCTTTAAATCTGGCTGGACTGATTATTTTTGAGTACTTAT
GTTCTCGATACTAATTCTTTGTCTGAGGAACAGCTTGCAGACATTTTCTTCCAAGTTGTG
AGTGGTCTCTGCACTCTGTTGGTGGTCTCTATTGCTATGTAAAAGCTTCTTAAGATGAGA
TCCCATTTGTTGAATTTTTGTGATAGTTCCTGTGCAATGAGAGTTTTGTTCTTTAAGTCT
TTGCTTACACCAGTGTCTTCAAGAGTTTTACCTACTGTATTTTCCAGCAGATTTAATGTT
TCTGTTTTAAGGTTAAGATCTTTGATCCATTCTGATTTTAGCTTAGTGCATGGTGAAAGA
CATGGGTCCAGTTTGAATCTTTGACATGTGTAGAGGCAGGTTTTCCAGCATCATTTATTA
GAGGCTATCTTTCTTCCAGTGACTGTTTGACATTTTGGTCAAAAATAAGATGGCTTAGTG
TGTCTGGAGTTGTTTCTGCATCTTACCTGTTCCATTGATCTTAGGCTCTTTTTTTTTTTT
TTTTTTTTTTTGGTGCCAGTACCACACTGCACACTGTCTTTTATCATAGTGGTTTTATAA
TATAATTTTAAGGCAGGGATTGTGATGCCCTCTGTCTTGTCTTTGTTGCCCAGGAATGCC
TTTCCTGTTCTTGGTCTCATCTGATCCCAGATGAATTTTAGGATTATTGGTTTCTCTAAT
TATGTGAGATATGCTGTTAGAATTTTGATTAGAATTACATTGAATCTGTAAAACAGTTTT
GGAAATATGGCCATTTTCATTATATTGGTTCTTCCTACCCAAAAGCATGAAATATCTCTC
CATTTTCTAATATCCTCTTTGATTTACTTTTTAAGAATACTATAGTTTTCAATGTAGAGA
TCTTTTCCATCTTTTGTTAGATTGATTCCTAGATATTACCTTTTTTTTAATGCTATTGTA
AAAGATATTGTTACCCTGATTTCTCTCTCAGTGAGTTTGTGATTCTGTACAGGAATGCTA
TTGATTTTTTTTTTTTTTTTGTCTTTTTCCTTTTTTATTGGTATCGGGGATCGAACTCAC
GACTCCCTGCTTGCAAGGCAGGCGCTTATGCCACTGAGCTAAATCCCCAGCCCCTAGGAA
TGCTATTGATTTTTTTGAGTCTTGACTTTGCAACCAGCTACATTACTGAATTTGCTTATT
AAATCTAGTCTTTTAGTAGAGTTTTGGGGTCCTCAAGTGAAGTATCACGTTATCTGCAAA
TAACGATAGGTTAACTTCTTCCTCTCGTAGCCTTATTCCTCTTATTTCTCTTGTTTAACT
GCTACAGCTAAGGTTTCCAAGACTGTGTTGAATAAAAGTGGAGGCAATGAACATCTTGCC
TTGCTCCTAATTTTAAAGTGAAAGTTTTCAGTTTTTGTCCATTTAGTATAATGTTCATTG
TTGGTTTGTCATAGATGGCTTTTATCAGATTGAGATAAAGACCATCTATTCCAATTTTTT
GTAGGGCTTTTATTATGAATGGGTACTGGGCTTTGTCAAAAGCTTTTTCTGCATCTATTG
AGATAATCATATGATTTTTCTCCTTGACTCTGTTAATATGGTATATTATATTTAGGGATT
TATGTATGTTGAACCATCCCTGCATCCTTGAGATGAATCCCTCTTGATCGTAGTGTATAG
TGTTCTTGATGATATGCTATAGCCTGTTTGCCAGTGTTTTATTGAGGATTTTTGCATTAG
TGTTCATAAGGGACATTGGCCTATAATTTTCGTTCTTAATTGGATCCTTTTCTGGTTTTG
TTGTCAAGGTAATGCTTACTTCCATGAATGAATTTGAAAGTATTGCTTCCCTTTCCATTT
CATTAAAGAGTTTGAGAAGTAGTGGTGTTAGGTCTAAATTTCTTGTAGAATTCAGCAATG
AATCTGGTAGGGCCTTGGCTTTTCTTTGTTGATAGGTTTTTAATTACATCTTTGATTTCA
TTGATATTGGGCTATTTAGTATTTTTATATCTTGATTCAGTAATTCATATGTATCTAGGA
ATCTGTCCATTTCTTCTGTATATTCCATCTTGCTAGAATACAAGATTTCAATGTATATAT
AGATAATTTTTTAGATTTTTGCAGGCTCTGTTGTGATTTTGCCTTTTTCATTCCTAATTG
CCTGGAATCTTTTCTTTCCTTTTTTTGATAAGGTTGGCTAAGGGCTTGTCAATTTCATTT
AAGAACCAACTCTTTAATTCATTGATTCTTTGTGTTTATTGTTTGTTTGATTTTGTCTCT
AGGGTGTTAATTTCTACCCTGATCTTTAATTTCCTCCCTTGTATGAGATTTTGGGTTAGC
CTGTTCTTCCTTTTCTAGAAGCTCAAGGTTCAACATTAAGTTATTTATATGTGCTTACAC
TATTTTCCTAATATGGGTATTTATTGTATAAATATCTCTCTTAAGACTGCTTTCATTATG
TCCCACAAGTGCTGGTATATTGTATTGTCATTATCATTCAACTGTAAAAACTGTCTAATT
TCATCTGTGACCCATTGGTTGCTCAGCAGAGTGCTATTTAATTTCCATGTGTTTATGAAG
TTCTTGTGGTTTCCTTTGCTATTGATTTCCAGTTTCATTGCACTTTGGTCTGATAGTATG
CATGGGATAATTTCAGTTCCTTTACATTTACTTAAGCATGTTCTATGAGCTAGTATATGG
TCTGTTTTGGAGACTGTCCCATATGCAGCTGAGAAGAATGTGTATTGTGATGTTGTGGGG
TGGAACACTATAGATATCTACCAGGACTATTTGTTCAAAATAATTTAATGATTTAATTAT
AATATTTCATTATTTTTCTAAATTCTAATATTTTATGATTTTTTTGTGCAATTGATCTGT
CTTTTTGTGATATGGGGTATTGAGGTCTCCCAATATTATTGTTTTGATTTATTTGATTTT
TTTTTTTTTTGACGGTAGTAAAATACAACAGAACAAGACAGAACAAAGCCAATTGAGACA
GTGTAGTGAAATTGGTACAGAACTTCACAGCGGGTTATGGGGATAACAGCAATAGGTTTC
ACAGTATATCTCGTTATCATCACAATAGTTGTTCTTTGAATCATGTATAGCAAAATAAAA
TGAAATACAGAACATTATAGAACTTATCAAACACAATATTGAGTAGAACAGTACCATTAA
TCAGAATAAAGCAAAACAGTAGTAAAAATATTTGCCTTCAAAAAGATGGTAGAAGGAAAT
CCCCCTTATTTGCTATATTGCATATGGTCAACCTCCCAAGAGATGCTCAGATCTCTGGTT
CCCATTTGCTAAAGGGGGCAGGGGAAGTGGGATGTTTGACTCCACACAGGTAGGCTCACT
ATTGCTTAACAGGGAGGCAGGCTGATTGCTTGGTATCCCAGCGTCCTAAGTTCCAACATG
GTGCAGATCTCAGGAGGCACTGGTGAGCCTGCCACACCACAGCTGCTTACCAGGGAAGTA
AGCTGCTTGCTTGGTTTCCCAGTGTCCTAAGTTCTCACATGCGCAGATCTCAGGAGACGC
TGGTGGTTCTCCTGGGGCGGCTGCAGCCTGCCACACCATAGCCGCTTACCAAAGAGGCAA
GCTGCTTGCTTGGTTTCCCAGCATCCAAAGTTCCAACATGGCACTGATCTCAGGAGATGC
TGGTGGTTCTCCCCCTGGGGCTGCTGCAGAAGGGCTTATTTGATTTTTGATGTCTGTTAG
TAATTGTTTTATATAATTTGATGCACTGATATTTGTTGTATATATATTTATGATTGTTAC
ATCTTTGTATTGGATTGTTCCCTTTTAGAATAATGTAGTAACTTTATTTCTCTAATCAGT
CTTGGCTTGAAATTCACTTTGTCTACAATAAGAATGGCTACCCCTACTTTTTTCTGGGTT
TCTGTTGCAAGGATTATTGTTTTCCACCCTTTGACTTCAAGGGAAATTCATTTATAATGA
AATGTGTTTCTTTTTTTTTTTTTTTTTTTTTTTTTGTCTTATTTTGTCTTTTTGAGACAG
GGTCTCACTACACGTTTCAGGCTGGGCTTTGGTTCACTTTGTAACCAGGTGGGTCTCCAA
CTTGCAAATGATTCTCCTACCTCAGCCTCCCAAGTGCTGGAATTACCGGTGTGTGCCATC
ACACCTGACTTAAATGTGTTTCTTATATTCAGCATATTGTTAGATCTTTATCCATTCTTC
CAGTGTGTGTCTTTGTCTGGTGAATTGAGACTATTAACATTGATGGTTATTCCTGATATG
TATTGACTTATCCTTGTCATGTTATTTTCCTGTTATTGGTTCTCCCTTTTTTGCCCCCTC
CTCCTAATTGTTTGCCTTCGCTGGTGGATTGCTTCTGTTTGTGTTCATGGAGCTATAGTC
CTTGTTATCTTACCTTATTTCTAGAATGTCCTTCAGAACATTTTGGAGTGCTGGTTTGGT
GGTCATAATTTCCTCATGTTCTTTGTCATGGAAGTATCTTATTTCTCCATCAATTTTGAA
AAATAGTTTTGTGAAGTGTATCAATCTAGGTTGAAAGTTGTTTTCCTTTAAAACTTGGAA
TACTTTTTTCCAAGTTCTCCTTGATTTGAGAGTTTGTGCTGAGAAGTCAGCTATGATTCT
TAGGAGCTTTCCTTTATAAGTGATTTGTTTCTTTTGCCTAACAGCTTTTAAGACTATTCT
TGTGTTGAATTTCTGGAACCTTGACTATGATATGCCTGTCTGTAAATTTTTTTTGATCAT
TGCTAATTGGAGTCTTATATGCCTGGTTTATCTGAATGTCAAATTGTTTTTTTCTACCAG
GAAAGTTTCTGTCAAGTTCTATGTCTGTGGATTTTTTTTAGTGTCATTTGTGGTATCTCC
TGCTTGTTCATTGACTCCAATTAATCTTAAGTTTTCCTTCTTTGTCTCATCTAGCCGCTG
CCGGATTGATTTCTCATGGTTCTTTACTATTTTTGAGAAATTTTTCTTTTCCTAGTCACT
AACTGCAAGCCGTCTTCAATATCTGAAATTCTGTCCTCCCATTGGCCTAATCTGCTTTGA
ATACTTTCAATGGAGTTTTTTTTTTTTTTTTTTTTTGTCTTTTTCATTTTTACCGGTACC
AGGGATCGAACTCACCACCACCTGCTTACAAGGCAGGTGCTTATGCTGCTGAGCTAAATC
CCTTAATCTTCTGGATATCTACTTGAAGAATTCCATTTTTTTTCCTGTGCTGAGTTTCCA
TAATGTGCTTAAGCTCATCTTGTTTGTTTGTTTTTTGCTTTTTTTGTCTGTGTCTGCTCT
AGCATTGCTAAGCATGGTGTGTGTATTTTGGTAATCTCTGTAGTTATCTGAGAGATTACT
TCTGATTTCATTTTTTCCAGAGCCTTATTCAATTTTTTTTGTTTCTTTGTTTCCACTTCA
GAGAGACCTGGTGGGGGCTTTTGGATTGTCTGACCTCATTGTCCCCTGGGTTTGCCTTTG
GTGTACAGGATGTCTGAGGTTTCATTTTGCTTAAGTGTCTTCTCATTTTCTCTCTTTTGA
GCTTCATTCCTGGGGTGATGCTTGTAAGTTGCCTAGGGTGTGTTGCTTTATTGATGATAT
TTAGAAACCTTAGGGGGAGATATCTTCCAGGTGCAGCTGACTTTTGGGTTTTGAATCTGT
TGGAAGACCTTACCTCTTCAGTTCGTTGGAGATGAAAAGTTGTTGCTTGATTGACTTAGT
CCTTGGTTCTTTGGCACTGGCACTGTGCCACTGTGTTTTCCATGACCCTTAGTTAATCTC
AGTCATGAATTATCAGCACCAGGCAGTGCAGTCCTCCACTGCCATGTCTCTGTGCAGAGA
CCTTTGGTGTTGCCAGTTCTCACTGTCAAAGTGACCATTCATCCCCAGGTTCAAACAGCT
CCTCTTGTTCAGTTCTCCAGTCTCAGGGTGAAGGTGCTGCCAGCTACTGCCTTTTTTAAG
CTTTTTCTTTTACTCTCTGTGTTGACTTCAGATTCTTCCTGGATCCAGGGGACTCAACTC
CCTTCCTTCTTGCCTTCCTCACGATGTTATATTCCAGTGTCTGAACTGTGAATCTCAGAG
AGGCTTGTTCTCTGCTGCTTACCACTCCACTTTTAAGTAGAAATCTAATGAGTCAGTTTA
TTTTCTTTCTTTTCAGGTAAATCAGAGTTTTGTCAAGAGAGAGACCCCTTGAGAGTCTCG
GTAAGCCGAGAACAGAGTTTCCTTGGGAGCCCACAGCCCAGTGATCCATTTGATGATCTT
CAACCAGCTACTCAGGATCAAGTCTGTGGTGATGACTACGATGATGAAGCAGGTGAGACA
ATAGAATCATGTGCCTGAGGATGTGCGGACCCAAGTATATTCATTTTGTAAGATTATACT
ACTGGCAAATAAGCTCATTAAGTATTGCTAATCAAATCACACATATTCTGTTGCTGTATG
CTGTTATTAAAAAGTAACAGGGGCAAGACTGTGCATCACAGCACATTCCTGTAATCTGTG
CATCTGAAAGGCTGAGGCTGAAGGATTATAAGTTCAAGGCCAGCCTGGATAACTTAGTCC
CTGTATCCAAAAAAAAAAAGTGGCTGGGGATATAGCGTAGCATTCCCTTCATTCAGTCCT
AAATGCTACAAATAAAATAAAATTGTTAAAATTAAAATAAGGCAAGAACTGCAGGTATAG
CTCAGTGGTGAAGTGTGTACTTAGATGTCAATTAAAAAAATTAGTATGCTTTTAAAAAAA
AAAGCAAAGGTGATGTGGGAAAAAAAGTCTTGTTTGTCTTTTCATTGTTGGATTATTTGA
TCACTTTTTAATGCTTAAATCTTGTAATCTGAACAACTATTTTCAAGATAATAACACAAT
TTATTAGCTAGTATGAATTTCTTTTTTTAAAATTCTGTATCAAATTTATCCTTTTCCCCC
TTGTTTTTTTAAATTAAAAATCTTTGTTTAGGCAATAGTTTAGAAAATTATCTAGAATGA
TAATCATCAAAATGTTGATACAGCTTTACTTTTATTGAAGAATAGGTTTCACATTCTATA
TGTTCAAGTATTGTAACTCTTTTTAAAAACTAGGCACATTGACAAGATGGTGGCATGATA
GGTAGCTGGGTAGAGAGCCTCTCTGGGAAAAACGCTGGAATTTGAAAACATGGAGAGGGC
CAGACAAGGAGAGAAGGATTCTTGTGACCCAGGAGGAAACTGAGGAAAATGAAAAAGGGG
AAGAGGAAGGAAAAATACAGGTGGAGGGCTGGAGCCGGACAGCTTACTAAGACCGGTCCC
ACGGGCTGGGGATTCAGCTCAGTGGCATAAGCGCCTGCCTTGCAAGCAGGCAGACCTGAG
TTCGATCCCTGGTACTGATAAAAAATGAAAAAAAACAAAAAAAAAAGAAAAAAAAGACCG
GTCCCACACTGTGCTGGGCGCGCTGTGGAGTCACAGGATCCACGGTCCTGCTGAAGCTGC
AGCCGCCAATAACGGCAGTTGATAAGTCCCGGGACCCTTTGCAGTAGGATGAGGCACAGT
GTGGAGTAGAGCAAAGGTGGAGAACAGCATTAATTCACGATGAGTGCTGGAAATTGTGTC
TCGCAGTGGGTGTGACCAGCTGAAAGACATATGGGAGTAGGGCAGGATAGTCCTAAGTCC
GCTGCCACAAGACCCAAAGGACTGGTGGGACCTGTTTGAGCTGAGTCACGCCTCTGGTCA
GGACCCAATAGTCACGGACGAACTTGTCCTGAACCGGTTACTTCTGCAAAGCATAGACTA
ACATGCTGAAGGCAATTGCCGGTTGACTGGCACAGAGAAGAGTAGCCAGCCAACAGTCCT
TGCACGCACCTCCAATAACAGTAAACTGGCAGGAAACCCCCAGCCAGCATGCTTTAGAAA
AACCGTAAGCAATAGAGAGGACCTGAGACCTCCACCATACACTTGTCTGAAAAAAACCAG
AAACATGACAAAAGAAAAAAAATTAAAAACCTCCAACTGCTGACCCTGGGAAAATAAGTC
CAGGAGAGGTAAATATAGAAGAGATCCAGTATAGCAATCATGCAATATTGGACACAGCAT
AAATATCTTTGTGACCTGATAGATGAACTTAAAACTGAAATTCTAATCCAAGTGAGGCAA
GATATAAAAAGATTAATAAAAGAAATGCTAAGCCCATCTCAAGGAAACACAGATGGAAGA
ATGGAGAAACCCAGAAAAGGAAGAGAAACCTTTGGTGAAGAATATATACAAAATCTAGAA
TACACAAAACAGATTCAAAGGGATTACCAGGAAATTAAAAACTCCATTGAAAGCTGGCAA
AATGTCTTGACAGAAAATAAAGTTAGCCTTTCAAAACTTGAAGATAGATTTGCAATGTGT
GATCATGAAAGAAAAGACCTCTTAAAAATAAGGAATCAGGAAGTAACAATTCAAAGGCTA
GAAGATGACAAGAGTATGTGTAATTTAAGAATAAAAAACATGAGTGAAGAAGCAGGAGTA
ACCACAAATGAATTACAAAGGCTATTCACAGAAATAATTAAGGAAAACTTCCCAAGCATA
GGAAAAAGAAATGATACCCAGATAAATGAGGCATACAGAACTCCAACCAGCTACAACCAA
AACGTATCTACACCCAGACATATAATAACCAAGATCCCAGAAATCCACCACAAGAACAGA
ATATTAAAAGTGGCCAGAGAAAAGAAGCAGATCACCTATGAAGGAAAATCCATCAAATAA
TGACAGACTTCTCAACACAAACTATCAAATCAAGAAGAGCCTGGAGTGAAGTAGTCTAAA
CCCTGAAAGAAAATAACCTCCATCCCAGATTGATATACCCTGAAAAACTGTCTCTCAAAA
TGAATGGAGAAACAAGATGTTTCCAAGACAAGGAGGAACTGTGGGAGTTCATGGCCACCA
ATCCAACCCTACAAAAAATACTGAAGGACATTCTAGAGAGAGATAGAAAAAAATACCAGG
ATTCCAGCAACAGTGGCAGAGAGGCCTCAATGAACGGGGCAGACAGTGGACTGAAGGAGA
AAAGTCGACAAACAGCAGAAAAGTAGAATAGCAGAGATGAGGCAGAGAAGGTGGGCTATA
ATCTTTAATATAGATAGCCCTTGTTATACTAAAAAAAAGAAACACAGGCAGAGTAGATCA
GGAGACAGGATTCATTGAGATGCTCTGAATAGGAAATATACTCAACCTGAAAGAGGGTTA
ATAAACTGAAAGTCAAAGATGAGAAAACAATGCTCTATGTTCTCGGGAGCCAGAGAGAAA
TAGGGACAACTTATCTAGCAGCTGCAGATAGGTTGGAAAGTCATGACACTTTTGTGCAGG
GGAGAAATACTTACCTATAAGGAAGGAACACCTTGTGGAACACCTTGTGACTTTAGTAAG
TAAAAGAATACAGCTCAAGATCAGCTAAGGGATAAAAAGGTTCAACACCACTTAGATAGA
CAACGGATTGCCCCCCAATCTAAAAACTAAAGGCGTTAGTTGGACCCAAAACCTACAAAG
CAACCTAAGAAAGGGAAAGGGGATGAATTGCCTAAGAAAGAAAGGCAGAGAACATTGTTA
ATAGTGTATCAGGATTTAAAAACCACATTAGTCTTATCGCTTTGTGATTTTATTTTCTTC
CGGTCTGTCTACTCGTACTAGATTTGAGGGCACAGACAGCTATCCCCAAAATAGCAGAAT
CTACTATGGTAAATATCCTTAATTCCCTATTAACTTAAACTGAAGCCCTGTATTACTTAC
ATTGTCTTACTATGACTGATGTTATTTGAAGCTGATTAGTTAAGCCACTGTTTTGTCTTG
ACTGATTTTATTAGAGTTTGGTATGCTTGATAGTATCAAGTGTAAGAGTGGAGGTAACTA
CTCTGAAGATGATGACAAGATGTAGTAAGATACCCATTCCGGTTTGATTATTAACTGCTA
CAATGTCTAGAATGTCTCCAATGTTGTGTTTTCATTAAAATTGCTATGTAATGCTATGTT
CAATTATATTATGTCTGATGATGTAGACAGTTTGTTGAAAATAACAAGAGAAAGCATAGT
AACTACTGTAGAATACCTAGTATTGTGGTTTTATATGTCTTTTTCATGTCATGTTTTTCT
AGGAATTTGTTTTGTAGTCTTGTTTTGATCTCTTTTTCCCTATAATACAGAAAGGATAGG
TATACATGTAGAGATACACACATGCGGAGAATTTCTAAACAGTTTACGGGAACAGATTAT
ATATGTGTGATGTAATGAACGCATATTCTGAAGAAGAGACACTAAGATATCCAGTGCTAA
TTCTGTTGCATTATGATATAAAATCTAGCAATACTATTATTCACTTTTCAGAGTGATATT
AGTCTCGTCTTTTATGTTTAATTTCAGCATACATAAACATATGGACAGCTACTTCGAAGA
CAATGAGAGACATTATGGCAGCCATTGTTGACTTCCCTAATGTCAGGTCTTGAAAACCTA
AAAAAAGCCTTCATCACCCTGTTCTGATTAGATTAGTGCTATAATGTTCAGTATGTATTC
ACTATGTGAAGACAGGACAAATGTTTGGAAGACTATAGACTATATGATAGTGAAGATCTC
CATTGGACTTGCTTTGAAATCCGTGTTTCTTAAAATTGTTTCCTTATGATCTGTTTTGTT
ATGTTTAATCTTGCCCTCTTTAAAATAAAAAAAAAACTAGGCACATATTATTTCTGTATA
GAAAAAGTTGAATGAATGAGGAAAGTGAAGTTTATAAAAAAAATAAGTGAATTTTGTTCC
TAAATTCTTTAAGTACTAATAGGAAGTATGAGGGTCCAGTTTTGTACAGTTGGCACTCTA
AAAATTAAACAGTACTAAGAAATATCTTAAGAATTATTTGATGTCTTAAATCATGATTAG
AGTGGCGTTCTGTGAGATTGTTGATGTTTGATGGGAGAATGCCTGTGCCTACCTGATAGT
CCAAGCACAGCTCCTGACTGCCAAGGAGCTGCTTTTCTCTTTCGCATAGCCATCCTAGAT
TTAGATTTCTCTTTTGAAATGACATTAGTTTTTTTACTTATTTCCTCCCTGTCACTGCCT
CAACACTTTGATTTCTTAACAGCTTTTAAATTGAATACTAACTACAAACTCGATACCCTT
TGCTTTTGTTAAAAGGCCCAGTATGGTGAATTGTGCATATCATAGGAAGATAACTGTTTA
AGGTGTTGCTTTCACTCTTTTTAGGGATGCATTCATGGATCTCTGCTGTCGATTTATTAT
ATCTCAACTAATGATATTTCTCTTCCATCTTTCATTGAATTTTTCAGCATCTCAAATAAT
TCTGACCTTGCTTCTTTCTCTTACTTTTATTTTTCATTTCTGACCACCACACAGATGCTG
CCTTGTTCACTCATCTTTCCTCTGGGATGGTCTTGAAGGTATATTAGGTAACACTGAATA
ATAGTGATAAATTGAACTGAGAAACCCCAGATTACTTCTTGTCTCCCAACTTGCTTTTGA
AACGAACTACTTAAGACATAAGCAAAAACTTCACAATACCATCCCCCATTTTCTTTAAAA
TTCAGCATGTAGAGAAGCAACCAACTGACATTAAATCATTTAGTTACAATCATACATTTT
CTAATGAACCAGAATAACATAGGTGAGATGGGAGGGTTGCAAGGTTAATGCCAGTCTGGG
CAACTGAGCTGAAATCCCGTGTGAAAATAAAATGAGAAAGGGACAGAGATGTACTAAATA
ATAGAGTACTTGCCCGGCATGCCCAAAGCACTGGCCTTTGCTGCTACTTTTGCTTTAATG
AAGCATGATACAAATGTTGTTTATGTCTCTATATACACACATACACTAACAGACATGTAG
GTATTTGTGTACACATGTATTTGTGAAATGCCATTTTTAAAGTATTTCTTACACAGACAT
TTAAGAAACATACTGTTGGGCCAGGGATATAGCTCAACGGCACAGTACCTGCCTTGGTAG
TGCAAGGTCATGAGTTCAGTTTCAAGTGCAAATAAATAAAATTCAGATTTATTTACTTTC
TTTTTTGGGGGGTGGGAACCGAGGATCAGACACGCCACTGAGCCAAATCCCTGGCAAATT
AAAATTCTCTTTAGAAAAAAAGAAACATACTATTAATATATACTGCTTTCTTTTAATAAA
ATGATAATCACGAGTCTGAAATTTTGTTTATAGTCACTGGAGCAATTTTATTATCCTGTT
TCAGAACCACAGATGACTGTATGCCTCAGCCAGCTTTCCTATAAACTCAGAATACCTGAA
TATTATTAATAGGACAGGCTGAGTGTGGCATCGCACACCTTTAATCTCAGAACTTGGGGT
GGCTGGACCTGGAAGATCAAAAGTCAAGCCTAGCCTGTGCAACTTGGCAAGGCTTTCAGA
AACTGGGCTTGGGACAGTGAATGGCTTAAGATCAGTCTCTAATATAATCTCCAGTATCTT
GGGGATGGAGGGTTAAGAAAAACTGTTGCAGCTGGGCATGGTGACACAAGCCTGTAATTC
CAGTACATAAGAGCCTGAGACAGGAAGATCACCACAAGACCAGCCTGAACCTCATGTAAA
TCCAAGACCAGCTTGAGCTACACTGTGAGACCTGGTCTCAAAAAAGCAAAGCAGAACAAA
ACTTGGTTGCACAAGACATAGTACCAAGAATCTACAGATGGAATAATATCAAATTAAAGA
GCTTCTGCAAACCAAAAAAAAAAAAACCAACATAGTGAAAAGACAACTTGCAGAATGGGA
AAAAAATTTTGCCAATTATTCATCAGAGTACTAATATCTAGAATACATAGAAAACAAAAT
TAGATGTCCCCCAAAATAAAGACCCAGTAAAAAATGGGTAAGCAAAATGACCACATGTTT
CACAGAAGAAATATAAATGACCAATAAATACATGAAATGTTCAACATCCCTGATCATTAG
AGAAATGCAAATTAAACAACACTGAGATTCCATTTTACCCTAGAAAGAATGGCAGTCATC
AAGAATCAAATCAAAGCTAACAAGGCTGTGAGAAGGGGTAGCTTCTGCTGGTGGGAATGT
GAACTAGTACAACAACTATATGAATCAGTTGTAGAGATTCTTCAAAAAACTAAAAGAAAT
TCTGTTAGAGCAGCTGTTCCCCTTCTAGGTATCTTCAAAGAGTAAAGATACTGTATTACA
GTGGTACATGCATATGCATATTTATGGCAGCACAATTCATAATAGCTAAATCTTAGAAGC
AGCCTATATGTCCATCAACAGATGAGTAAAGAAGATGTATTTATTCACAGTGGACTATTA
CTCTGCTATGAAGAAAGAAAACTTGAGTCATTTGTAGGAAAGTAGATTCATAGAAAAATG
GATGTACCATAATGTTGCGTGAAATAAATCAGACAAACAAGCTTAAATATCACATGATTT
GTTTAACATGAGAAACCCAAATTATAGACAATAAAATAGAAGATAAATAATAGGAAATAA
GGTGATAGATGTTTCCCAAAATGGGAAGGAGATCAAAAGGCAAAGTAGGAAGCATTGAGA
AAAGGGATTAAAAGAAGGAATCAAGATGTGTCATGTACATGTACCAATCTCACACAAGAA
TAAAATATTACACTCCACAAACATATACTGTGCTAATAAAAACATAGTGAAATAGGAAAT
GTAATTCATACATAATTTTATCTATGTTCTATGTCAAAATAATTAGAAATAATAAAGTAT
TAATCAAAATATCCTTAAAGAAAGCACTTAAAGGTATAAAGAAGCAAAAATTGGGCTGGA
TGTATGGCTTAGTGGTAGAGTCCTTAGCATAACAAGGCCCTGGGTTCAAGTCTCAACACC
AAAAGTTTAAAAATTGAGTCAGAGTTTGGTGGCTCAGGTGTACAGGCCCAGCAATGACAA
ACAATGACACAGGATTGCTTGTGCCCAGGAATTTGAATACCATCATAGCCAAGAGAGAGA
TCTCCTCTTGAAAAAAAAAGTAAGTGGCCGAGGGTTTAGCTTAGCAGCATAAGTGCCTGA
TTGGCAAGCGGGAGATCATGAGTTCAATCCTTGGTACTAAAAAAAAAAAAAAGAAAGAAA
ACTAATTTGCTTCTTGTCCTATTACTCATTAGCAGTCACTGTACTTTGCTTTTTTTTTGC
TTGTCTTTTTTGCTTATCTTTTTTTAATATGCATTTTATCCTCTTACAAATCATACTGTG
TTCATAATCAAATATTCTTCCTTTTCCACATAAAAGGACAAAACATTTCCCATAATGTTC
AAATATTTTAAAGGATCTTATTCATGTGATAACAGTGACAGCTACAGTTTAAAAAAAGAA
AAAAGTAGTGTGTGTTTCCTAGTTTTTAAATGAAAAAGAAAGTGATTTTTTTCTTTTGGT
CTAAGATAAAACAACTTTAAGAACCAAAAAAGAAAAGAGGGATTGTTCGCCTTGAAGTGT
TAATAATTTAATTTGTCCAAATCTAAAATATTTTTCCTTTTTGAATTCCAAATTCATTGT
TTAGTCAAGGTGAAGGAATCTGATGCTGAGAATCATGCCGTGTTAAGTTATGCTGCAGAG
GAGGCAGATCACATGTGTCGGGGACAGGCTGTGAGACCAGATGATAAGGTTTGTGATACC
TTCTCACTCACTTTTTTTATTTTTTATTTTTTTGAGATAGGGTCTTGCTGTGTGGTTCAG
GCTGGCGTTGGGTTCACTGTGTGCCTCAGGCTGGCCTTGAACTCATGGTGATTCTCCTGC
TTCAGCCTCCCAAGTCCTGGGATTATAGATGTGCATAGTATAGTATTCTAAAAGTGATGC
CAACCATCATACACTGTTTAGAGTTATGTAGTTTCATATTCTTTTTAGTTTACTGAAAAA
CTATGTTCTCTGAGATCTGCTCTTATCAAAGTGGATCAATGATGAAAATAGCCAAATCTG
AGCATCAGAAGACTTTGCGGTCTCCCTGATTCATGATCTCTATAGTTCTGGGAAGCAGAT
TTGTAAAATAATTTAAAATAGGGCTATGTTGTGTGTGTGTGTGTGTGCGTGTGTGTGTGT
GCGCGCGTGTGTGTCCCTGCGTGTGTTCACATGTGCATTTATAAAGGTAACTGAGTAACA
GGACATTCTGATAGGTGAATGAGATTTGAAGGTGTGTGTGTGTGTGTGTGTGTGTGTCTA
AACATTTCTGAGCAATGATGAAAAGTTTTTACTACTGACCTTTATAACTATGAAGGTTTC
TACACTTGACCTGAGCTCAGAATTGACAGCTGCTAAAGTTGATGATTTTGAATTTTCTGT
ATATTGTACTTCTTGACACATCACGATCTAATATTTTCCTTTAATTTTTAGGCTGGAACA
CAAGATGTTTCTCATGAGCCATTAGCTTCAATAACTGTTTCTACTGGCAGTTTTTTAAGT
TATGAAAACACAGATTTGAGCCTTACAGATCCAGGTAATAATATCAAAATGTAAAGAGAA
TGAAAGTACATCATTCACGGTGGTGAGAGAAAGCATTGTTTTTTCACAATGCACCAGAGA
AGGGGAGAGTTTAAATCTCAAAACTAAAGTATCAGTGTCTAATATAGTATTGTTCAGTGT
AATATTCTAAAAGTGACTGGAAGTCACACAGCAAATTCTAGATCCTAACAACTTGAGAAA
TATTGCTACTGTCCATTTTCCCATTCAGTGAAGTTCTTTCCTAGGAAATCTTTTGGTTGT
ACTGATCCATTAGCCATATATGTTGCCTTACTTCTCTCCTAAGTTATGTTTCTTTTTTTT
TTTTTTTTTTTTCTAAATTATGTTTCTAAAGAAGCATCCTGTTGAAATGGTGGCACATGC
CTATAATCCCAGCACTTGGGTGGCTGGGTTATATAATGAGCTCAGGACCAGCCTGAACTG
CATAGCGAGACCATGTCTCAAAAAAAAGAAAAGAAAAGTAAAACTGTCAAAAGGAATACA
GTGTTAATATCAATTAAAAGTTTTCATTTAACTCAAATTTCAGATCCATTTTCAGAATAC
ATGGGCCATTCAGAACAAGAACCTGTCACCAGTAAAGAAGAAACAGATATTTTAAGTTCT
ATAGTTCCTTCAAAACAAGTTATTTATCAGCAGCAGAACTCTTCAGATGTCTATAAATCT
CCGTTGCCTGCAGTAGAAGAATTTACACCTGGACACACACATTGTGAACAGGTCATAGAC
AAGGACATAAATAAAGCAACTTGGATACCTGAGAAAACACACTTTCAGGGTAAAAATATT
TTAAAGGGAGGGAATAAAAATACATACACACAGAGACAGAGAGAAAGAGCATATGCCAAA
AAAAGTACTCATGAGAAAAGAAAAACTAGGGCCAGAAACTTAGCTCAGTGGTACAAGTGC
ATGCCTGGCAAGCACAGGGGTCCTGAGTTTGATCCCTGGTACCAAAGGGGGCGGGGGTAA
TATATGACATATGTATTGATGGATGAGTTCTTTTGTACCTCTTATCCTTTTTAGTCTTTA
GTAAATGTTGTCTAAACTTCATGTTCTTATGGCCTGCCAGGCATACATAGACCACAGGAA
ATATTGATGATTAGTGAAAGAGGGATGTGAACCCAATTTGACTGATTGAAGAACATGTAG
AGGATATTAGTGACCAAATCTTTACTTTCTGCAAGTTAGGTCTTACAGCTGAGTCTGGGT
AAAATTCAGAAATCAGAAAAATCTTGGTTCAACTCAGAGTTGAGACTATTTCCTAGCTGT
GAAACGATAGGCAAGTTAACTTTTTCATCTTTCATAAAAAGAATGATGTTGGAGGGGCTG
GGGATTTAACTCAGCGGCATAAGCACCTGCCTTGCAAGCGGGCAGTCGTGAGTTCGATCC
CTGGTACCGATTAAAAAAAAAAAAAATGATGTTGGAGATGAAATGAGATATGCACATAAA
CTACAATGTCTTGCCCACGCTAACAGAAGAGTACAGTGAACCTTTCTGCTTTTTCCTTCT
TTTAATCATTGTTCTGAAGTGGACTAAGTGAGAACATCAAAGCTTATAGCAGTGAGGGCA
AACCTTTTAGAGCTTTCATTGTTAACAACCCACTTTGCACATGTGCCATAGGTTTGGCAT
CCAATTGCTTATAGCAAAGCAGTGGTTATATGTGCCTCTTAATCCTAATTAATGTGAGAA
AGCTTTAGTCCCTTACAGCACCTGGGGTTGGACTGGGTTGGGTTGGGTTTTTTACCTTGG
AAATAATCCTGATAGGAGTTAACTTGAAAGCATTTACTGATCATGAATAAAATAGAATTT
TGTTGCCTTACAGTTATCAAAAAAGTTTTTAATGACTGTTCTTTGTACTACTTTTTAGGT
TTTACTTTAAATCTTAAAAAAAAATTCTTTTTTTTCCCCTCACAATTCCAACAGTTGACT
TCCCTGAACTAGAACACATTTTTCCAAATTTGCATCATCAGCTCTTTAAACCATTAGAAC
CACATCCAGATTTTGACTTATCATCATCATCCTCTGGGATTTCTCAAGACAACAGAGATT
TTTACCAGGTATATTAAACTAGATGCTCCAGTGTAGTGAATATCAAAGAGCAGTTTGAAT
TTTTTCTTTTGTAGAACAATGGTTAACCTTAGCACACTATTAGAATCACAAGGAAAACTT
TAAAAATTCCAGTGCTCAGATTTTACTCAGACCAGTTAAATGAGTTATTGAGAGCACTCA
GATACTATGTTTATTTTGGAAGCTACCCAAATGACTGGACTGTGGAACCTAGATAAAAGC
AGCTACATTAGAGTTTTGTCCTATCCAACTATATCTTTAGCTGGTGGATATATTGACTGA
TAGGAAGAATTGGGTTTTTGAAAAAGCAAGTTATTAGCATGATAAAGTAGTAAAGTAATA
CAGCATTGATTGATTCAGCTAATAGTACATAATCAGTATTTCAACCATTCTCTGTTGTTT
TCTGTCAGGGCTCAGATTCTTCATCTGAAACACCGTGTGCTGGTATATCATCCAGAAGTG
CAGTTTCTTTTACAGCATTGAGGAGGACCAGCTTGCATTCTTTTAACATTAGCGTTAACC
AGCAACCAGACCCTAACGTGGCTCATGCTGCTGCTCAGAGTTTTGCTACAGAAACTATTG
AAGGTAGGTTTGGCTAAGAAAAAGTTAAATAAAACCTGATATACATATATATTTAACATT
TCCTTGGGAATTATGCATAGCACCTGTTGCTTTGTCTCCATGAGTGTCTTCAGTATTACT
CAGGATACTCTTTATGAATTAAATAACAGAACATGTGCTTAGTTTCTATTTTTGTTGTTT
ATTTGGTTTTGTTTTGTTTTGTTTTTGAGATAAAGCCCCTCTACATAGTTCAGGCTGGCC
TTAAACTCACTACATAACCCAGGCTGGCCTCTAGCTTGTGGCAGTTTTCCTCAGCCTCCT
GATATCCTAAATTACAGGCATGTGCCACCATGTCTAAGCTCTTTGGTTTACATTTTTGTA
ATACTGAACTTTAAAAGATCAAAATCAAGAGTTTCTTATTTCTGACCATTTAATTCTATC
CTTCTATTAGAACTTTTTGTACAAAGTTTTCATATATGTCATTTATTTGCATACATGGGT
GCATATTTTATTCTAAATATTTCTGTTAAAATCAAATGTTCAATTAAGGATATTAAAAAG
GGAAAACAGGTTCCTTCTATCTTTTACAATCAAATTACTATATAGAAATATTTGTATAGC
TTAGCAGTTTGAAAGGATGATGTGTAAATTATGATGTATTTCCACTTTTGGGTACAGAGT
TCATGAATATACTGCTTTATGAAATTATTAGTTATGTATTTACCCTGTTTCTCAATTTTT
AATGCTTCTTATTAAAACCTAGCGTTATAAAAACTGCTTAGAGCCTTCTTTTCCTCTCGT
TGACACTGGGTATTAAATCTAGGATCTTACGAATACGAATGCTCTGAGCTATCCCAGCCC
CAAAAACTTAAAATATGTTACTGAAAGACATCTAATGTTTTAAAATCTTAATACTATCCA
AAATGATACAAAAGTGGAAATAGGTTTATAGAAACAAATTAGAAAGTTAGGATTGGGTAA
TAGGCGTAAGGCATCAATTTTGCAAAAGAAATACATCTTAGAGATCCATACAACACTGCT
CCTAAATTAACAAAATCGTATTTTAAGAATGTTAGGAGTGTATCTTATGCTGTTACTATA
AATTTAAATTTTAAATTTTAAAAATCAATGATCAGTCCTTTCATAAGGGAAAAATCCTAA
GGATTAAGGAGAGAGTATAGAATGTGAGCTGTAGGGTTACTGGAAAATCATTATCATCTT
CCTATCCATGTTTATATATATCAGTTGTCACTTCTAATATTATAACCTGACTTCATGTGT
AATTACTGAAACTATGAGAGACTACCAATAATTGTTTTATGTAAGGATTGATTTTTTAAA
ATTTTTTAATGCAGGATCTGAACAATCTTTTCAACAACTTCTGCCAGAATTTTCCTCACA
GGAGGGGAGCCAGCATGCTGATCTGCCAAGTATTTTTAGCATTGAATCAAGAGATTCTTT
TCAAGGCATGAAAAATGAGGACCATCTGTTGGAAAAACAGACTGAAACACTACAAAATAA
GAAAAAAAATGTTCATTTCCCCGTGTCTATAGGAAACTTAAGTTCAACCTGTAGTTCATC
AGATGAGACCAATACATTTCATCAGTTACGTGTACAGCATAGCACTCCGTGTGGTTCTAC
CTCTAGTGAGTGCTGCATAAAGCACCATCTACCAACAGAAAGCAAAGATGAAAAGGTGAG
CTTTGAAGACCTATCAAAAAGAGACAATGTTACAATTTTACAAAGTCAAGGACTCTCTGA
AGATGATAAAAATGAAACCTATCGGATTTTAGCTATAAATCCACACATAGAAGAAACTGA
CTCTCAATTATGTGTAAGAACAATAGAAATGGGAACTTCAGATCAGACACCACAGTCATT
AAGTATCCAAAATGAAAAATATTTTGAGAATTTAATTGAAACTCCAGAAATCATAAAAAA
TCTATCCCAGCCAACAGTGGCTGAGCCCTTTCGAAGTTCTGCATCATTTTCACTACGGAA
CTCTATTCCTTTCTGGGTAAGTGAGATCTCTGTTTATTAAACAGTGTTTTAAGTTCCTTT
TTAGGAGGAACTTTTGAAACAAAATGTGAGAGAAATAACAAAGTTACTGAATATTCCTAA
AATAAAATGAGGAAATTCCAAAGTTTGAAAAAGAATTTTATAAATGATCTTCCTTGCCTA
TCCAGATGACCCTTTTCTAACACATAATCAGTGTGTGCTTTCAGTGTTGACCCTTGAACT
GAATCTATCGTTGGGATAACTGTTGTAACGTTTGTCTTGTTAGCAAGTTTATGACTTGCT
TGGCCAACTGGACATGGCTTTCAATTTCTTGCAAGCGCATCTCCTTTCACATATGACAAT
GGAGCTTTAAAATAAGGGCTCCATCTAGGCCATAGATGTATTCTTTGGCTGCTTGTCTTG
TATCTGTTTTTAAATTACTGTGTATGAAACTAAATACTTCCTTAAATTAAAATTAAATTA
AAATTAAAAACTGTTTTGAAAAATATATAACCTGTCAAGAGTGGTTGGTCTGCATGTGCC
TGAAACCAATTAGGCAGTGTTCTCTTTAGATAGGATATGTAAAACCCCCAGCCAACCTGT
CCAATCATGACCATTCAGATTTGTGATCCTTGCAATATTTTAAGGCTCCAAAGTCTTCTC
TTAGTGATGAGGAATGCCTAAAGGGAAATCTAATCTGTTGATCTCCTACAACTTAAGATA
TTTTTTACACTTACATCTATTTGCACATGTAATGTGTATATATTTTTGGTTTTTAATTTT
AAATGTTTTAAGCCTTTTTAAAACATGTTTTCTTTTGAATTGTACTGCATAGGAGACAGA
ATCTGGCCACGGTATAATGGAAGAACCAGAACTTACTTTAGTAAGCAACAGTGATATCAG
TATTGCTGAAACAGATTTTGCAAACCTAACCCTTGAAGAAAAGACAGAGAATGAAACAAA
AAGCTGCTTTCAGGTAAGTTTTATAGCACTCATTATTGTGAATACACCTCATACAGGAAC
CCAACTGAAGACTGAGACAAAAAGGATACTAATCCTCACTTCCCTCACCTTAAAATTACC
TGCAGATTCTTTAATTATATGTAAATGCAATAAACTATATAGTCACAGCAGAAATTGACT
GTGGCTAGGAAAAGCTTTCAAAGTCTGAATGTACTGGTTTGCTCCCTGTACAATGTACAT
TCTAAAGTGTGAAGCTATTAAGACTTAAGTAGAATTTATGCCGCCCCTTTCCCATGGAAA
CCAGCAAATTCTCAGTCAAAAATTCTAAAGAAAAAAATTTTCTCTAGCTACTAATCAATT
ACCTTACTTGTCGTTTAGTTAGAATGGTAGTAGACACCTTTAGACAGACTCCTGTTTCCC
AGCTAGATTTTTTTGTGTGTTTAAAACACTTTAAAGATCAGGACCTTTACACAGGTTTAC
ACAGGTATGTCTCCAGTTTTACTTGCATAGGGGAACCCTAAATTTGCAAGTCTCACCTTA
GTTGCTGGGATTATAGGTGTGGATTTAGTTTGGTAGAACGGGTTTTTATGTTACTAGTCT
TTTGATGGCAAAAAAGGCAATTTCTACCTATAAAGTAACCAAAATTTCTTAAGGTAGTCA
ATAAAGGGTATATATGCTGAGATAAAGTACACAAGTATGCCATCCTGTGTCTGTTTCCAG
GAACTGCTCATCAGATAAACCTAAGGTGCAAGAAATTTATCACTTAGCACTAGGATCACA
CTCAGAATGTTTGTTCATACATATGAACAGGTTTTGCTAAATGCTTTTGTTAGTGAACAG
AAGTATACGTGAACCGAGATATTACTATATTGGCAAACAAGCAATAATAGTTGGCTGTAT
TTGGGTATAGTGAAGCTGGCAACTGAAGAGCCTTTTTTAGAAAGTTGGTTACACCAAACT
ACTTACTCATCTTGGACTTTCTTCCCAATTAGGTGAGTGAATTTCTGCCTGTTGTGTCAG
AAACCTCTGTTTATCCACTTGTGTCAGAGCTTTCTAAGGATAGATCAACAGGATCAACAG
GTATCTTAATTACAAAAAATGGCATCTGCCTGCAGTTGGTGTAAGATTAAATGTGAAGAT
TTATTTAACATTTCCCCAAAATTTACAGCCATGCCAGAGAGCTTACAAGAAGCATTTGTT
AAGAGAAAAAAATCATTTATAGAGAGATCCTACCAAAGGCAGAAAGAAATACGGAATAAA
ACTCGAGTTTGTGAACATTCCCAACTCAAAACAGTTAAGGAAAAGCCATCTACAGGTAAA
GGTATGTTCAAAGTATCGATCTTCAATGGATCAAAGGATCAAATCTAAGGTTCCAGCCTC
TTTGCTTTACTATGAGTTATCCAGTTATCTGTGAGTATACAGGCTGCCTCTGGGAGCTTA
GCTAATTGTGCTGATATTTTTTTTTTTTGGTTTTGAATTTCCACCAACAGTGAATGCCCA
TGTTTCAATAATGATCTCATTTAAGTGAGGTAAAAAAAAAAAAGGGTATCTGGATAGGAG
ACAAGGGGATGGAGGGAGGTGTGGAGGAAGGGGAAGTAGGGCACAGAAACTAAGGAAGAT
TTGGATGTAGGGTCTGAAGGAGAGGTGTTACAAAAGGAAAAAAAAAACACTTGTTCTTTT
CTCAGGTTCCTTAATAAGTGGCCTCAAGGCTGTGAATAAAGTTAAGGTGTGTTTTCCTGA
AGACAGAAGGATGGCACAAGCCCTAATGCACAAAAGGGCTCTAAGGTACCTGGTTTGCTG
TGTCCTAGTGATTCTCCTATTCTGCTGCACTATTTACACCTAATCTGGTGAATATTTTAT
AGGTTATACAATCAGTTATCTGAAGTACGACAACAAAAGGAAGAGAAAGCAAAGCAAGAA
GCTTATGCTCAAAACAGAGCAAAGGCAAAAGAATTTCATAAGGTGAGGCTTCCTAGCCCA
ACCCTTCAGTGATTTTTAAATGTATTTAACATAAATGAAACTGATCATATAACTTTTATT
CCCTTTACAGAAAACACTAGAGAAACTTCGAGCAAAAAATATGTGCTGACTTTCCACGTG
TATAGTAAACATGCCATTGGACATTAAATAAATTTTTATTTAAGAAATTTCACGTGATTT
CTGCAATATTCCTTAAGTTCAGTCAATAACATTGTCATCTTCAAGATAGCCCTGAAAAGC
AAAAAGACATTAGTTATAACTCTTAAGTATTTTTCCAGTCACAGCTGAGCAGTAACTCAA
TACTTTATCATGTCTTTCTCCTCAGGAAAACATAGCACTACTGAGTGACTATGACGTACT
GTGGAGAACTTCATTCTGTGGTCACTGCGTTAAGAGCTCTTGGTTTCACATTCCCACAAG
CCCTCTTTGAAATGACCTGTATAGTTACATGCACGTACCTTTTTAAAGGAATTTGCTGCT
TAATCCACTCATTCCATCTGTCCTGCATAAGAAGCCATATAATCAGTGAGTTCTAGAGAT
CCTTGTGGTGGGTAAGACTAAGAATTTTACATGTAGCTTTTGTAAACATATTTGACAGTG
TCCACTTAGGCAATGTAATGTTCCCAACAGGTTGATTGCTAACAAGATAGCAGACATAAA
ACCTAGTGGGAAATTTTTTTATGGCCATGTCCACAGCAAATGAGAAACTTCATTCTAATA
GCCTTGGTAATGACCATCATAATAATCCAGTGGTTTATAGGTAAGATAAAAACAATTACT
TACCACAATTCTTTTATCTCCAGTTGAATTACGGACAGTGACAACTTCAGAACTCCTATT
TCAGGAAACATTTCACATTTACAAAGTACTATATAATCCAATACCCACACTGAGAATTTC
AACCTTCATCTAGTTCGTATCACTTTAGAGAATGTAAAATACACCTCAGAGAGACCTCAT
ATTCTAAAATAGTGTGGATGTTCATGTTCAGAGAGGCTATTTTCATTCAGCCCTTTCAGA
GCAGTTGAACATTTTGCCAGTCATCACAACATTATACACCCATGCCGATAAAACCTAGAT
ATTTTTCTTATAGATTTGGTTGCAAAAAAATTCTAAGTAGGTTTGGTCTTTGAAATGGAA
ACTTAAGTCTTACCTGGGATCTTATCATCCAATTTCTGCTGACGATCTGTATTTTAGGAG
TCTAAAATTTGAAGTATATATAGTATTGGTATTTTGTCACATAATCTAGATTCTATAAGC
ATTCAATTATAATACTGAAAGTTTTTCAGTAGTAGGAAAGATGTTACAGGTCTCATTGTC
ACCACTGTAAACATTTACTGTGATGGAAGCACGACCTGTGACAATTTCAGCCACATTGAC
CAGTTTTGGACACCAATCAACAGTGCCCATTCTAATCTAAAATGAGGCTGTCTTATAATT
TGTTGTTACGCTAACAATAGGGGAAGATATAAAACACCTTACATTTATGGTAGATGGATC
TGCCGCCTTGCTGACACTCTAAATTAAAAAAATATTATATTGACTATGAATAAAATGAGT
ATTAGAAAAACAATGTATCAGTAGAAATACCAGGTTTAACATGCACAAAGCCAAGAAAAC
CAACGATGCCGCACACTGAATTCCTGTCGCACTGTCTTTTGAACACATCAGCAGGAATAA
ACTGTTGAGTGCAGATACCATTCAGTGCAATCATTTGAGGAAAGATCCTCTACTGTACTT
CCAGTTAACATTTATTACATTTTCTAATGAGATCACTACTTATAAACATCTTATCTGTTC
AATTTCCACATGCAGTTAAAAGTCAAATCACAAAGGACTACCTCGGTGTAAAGTGCTTGT
GTAAAAATTCTCAAGGTTTCAATATACAATAAAAGAGTCAGGATCACTGTTGCTCAGCTG
TGTCCCCAGGTTACATATGCTACATATTTGGGTAAAAACTGTACAGCTGCCAAATAAACA
AAGGACAGTGCAAAGATAGCCACCCATTTTTCATTTTATAAATATATGTATCACATTTGT
GCAAAGACCTTTATTGTCAATTTTTCTAAGTCCTTGATAAACTACAAGTTTCACTTACTT
CTCTAACACATGCATGAATTCATATTCATTTCCTACAGAGAAATTACAAAATAAAAAAGA
TTTAGAA
  Untranslated Region
  Coding Sequence
  snoRNA
2001..2097, 2186..2285, 2363..2462, 2827..2979, 3068..3155, 4135..4275, 5092..5753, 7085..7259, 7680..7813, 8959..9204, 9754..9856, 10580..10683, 18856..19011, 26389..26532, 26668..26809, 28152..31563, 31711..31808, 32420..32557, 35213..35316, 35456..35548, 37666..37887, 40459..40623, 40819..41002, 43405..43545, 51100..51195, 53711..53804, 55232..55356, 56386..56586, 57499..57638, 60599..60675
2059..2097, 2186..2285, 2363..2462, 2827..2979, 3068..3155, 4135..4275, 5092..5753, 7085..7259, 7680..7813, 8959..9204, 9754..9856, 10580..10683, 18856..19011, 26389..26532, 26668..26809, 28152..31563, 31711..31808, 32420..32557, 35213..35316, 35456..35548, 37666..37887, 40459..40623, 40819..41002, 43405..43545, 51100..51195, 53711..53804, 55232..55356, 56386..56586, 57499..57606
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved