Cavia_porcellus Locus NPAL1
snOPY snoRNA Orthological Gene Database
Cavia_porcellus NPAL1
Cavia_porcellus
NPAL1
GeneScaffold_5171
SNORA2
18691..18827
31819
CAGACAGAAAACTATTTTCCTCAGTGCTGACATGCCAGAGGACGGGGCACCCCATCCTC
CCCATCAGTGGGAATTGTATCCTTTTTTTTTTTTTTTTTTTTTAGCACAAATGCCTGCTG
CCAAGTCTCCCAACCTGGCTAGTTTGCTTACCACAAGCTTCCCCTGAGATTCTTCATTAG
TAAACTGTGACATAACATATCATGCTGCGAAGCGTAATGAACGAGTACTTACCTAGTGTC
TACATAATATGCATGGCATAGAGTGAATACCAAACGTTAGTGACTACGGTTTTGTGGGAA
TAGGTCTTGAGAATGTGGGCACTGCAGTTCCCATAAAAAAGCACATTTCAAATGAGCATT
TGACTCAGAAAAATAGGGTAAGAGCTGTGAGGGAGTGACTTTGCCTGCTGGAGACGCAAG
AGAGCAGATGCTGGGGTTGACAAGGAGCCTCGGGGGACTTGAGAACAGCACAGAAAGGCA
AGCAAAGTCTGCTCCCCGAATAAACTTCACCGTGTACAAACACAAGACTTCTAAAACTAG
CAGGTCGGTCAAGCGTCCAGCGATGAAGACCTTTTCACCAAGGAGCAGCCAGAAGGGGGC
CTCAGCAGCATTGTCAGTCCATTAACTTCCCCTGAGTTGCCTCAGTGACCTCCGGGTTCC
GCCAGACGCCGTTCCCCTGTGAGGTCTGTCCGTGGGTCTGCACTGCGCGACTCCAGCAGC
TGCACGAAGTCCAGCCTCGGACGCTCGGTTTGAGCCGCACTGGCGGTCAGAGCCTGTGGC
AGAAGCTCCAGCTCGCCGCGCCAAGGCCCCCAGCCCCAAGGTTGCGGGGGCGTGGTTCGC
GGTGGCCCCGCCCACTCACCCCATTGGCCGAGGTTGCCTGGGGGCGGGGCCAGCGTACGA
GCTCGGGACCCAGCTGCCCAGCGAGGCACCGATCCATGGAGGCGCGAGATCCAGGTGGGT
GAGGAGCCAGCGCTGCGCCAGGGAAGTCTCATCCCCCGGCCATGGGGGGACAGGTGAGGC
TGCCTCCCGGAGAGCCATGCCGAGAAGGTGAGTCTGGCGCGACCCTTGAGACCTGTCATC
GCGGTGCCTGCGATGAAGCCAGGTGGGCGGCCCAGCGCAGGGGCTCAGGGGGCTAATCGG
TCACTCAGCCACTCACCCGCTGTCCTGCAGCCNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNGAGTACTTGGCTCTCTACTCACTAGGAAAGATCTGGTT
CACGAGTATAGTGTTTCAATTTTCTTTTTAAATCAAAGTATCTATTCAGTCTTATTTTGA
TTAATTGAAATAATGGGCAGTTCACCCAGTCACATCAGAGCTTGTATGTAGATGTTTCCC
CTATGACTTCTTCATATCCAAATTCGCTCTAAGTTATTTCACATTGTGTTTCTCTGTTGA
CTCTGAATTAGTTTCCCTTATGTTGCTCCAAGGGGATCTAAGTGATTTTTCCTTCCAATC
CTCTCCCTTCCTTCCTGTTTTTTCTCTTACTAAAACTATCCATTTGGTAAGAAACCCCCC
CCCATCACCTGTCTTGTTGATCTTTCTCTCACCATTAGAGATACTTATACTTTTGTTTTT
AAACTTAGCAGAGAGGCTTTTCCACTTCATTCTATGCAATTATTTGTTCATTTTTTTCTG
TCTCCCTCTACCAGACTGTAAGAAAACAGGAATTTTGTTGTCTTTGTTGTATCTTTAGCT
TCTAAAAACTGCATGACAGGTAGCAGGCACTCAACATTTTGATTAGATGAATAAGAAGAT
AACTACTTTTAGGGATGGGCGAGACATAAGATGAGGCGATGTAATGTCAGAGAGGAGCAC
ATTCCTCAGCATGGAAAGTTTTGAAATTTAAGGTTAGCTACGAACTGAGCTTTCGTTATA
ACTGGGATGAAAAACCATGATGAGCAATAAGCAAGATTAAGTAGGAAAGTGGCATAATCT
CATTCACACGGGAAGATGTTAAGAGAATAAACTGTGGTGGGCATACAGAGATTTCATTCA
GTTTTGCTTCTGCCCATAAGAATAGGAGGAAGTATGGGCTAGGGATTTAGCTCAGCGGTG
TAAGCGCCTGCCTGGCAAGTGCAAGGTGGTGAGTTCGATCCCCGGTACCAAAAAAGAAAA
AAAAAATGTTAAGAATAGGTGGAAGCAGCATATATTCTTGCTGATGTGGCTGTAGGTCAG
CTAAAGGTTGGCTGATGCAGACTAAGTTCCCTTAGGTTTCTCTGCTTGGGGCCACCCACC
CACCTGGGTTGTACCCTCCTGTGGCATGGTCTTCCCCAGGTATTTTCATCCTGGATATTT
TTTTTCTGGACTCAGGTTGAAGGGACAGCTGCTCCTCAGAGAACTAAAGAGTCATAAGAA
AATAATGCCAGGTACATAAGCAATTTGAAGCTATCCTCATCTTAGCACTGCTGAGGTCCC
ATTGACCTCCACATCACTTCCAGCCCAACATCAAGGGGTGCGTTCACAGCTTTCTGTCTC
CGCAACAAAACACTTGAGATAAATTACAAAGCTGAGTGGTTTAGCTCACAATTTTGGAGA
TTCCGCTCCAGGATTGCTTTGAAGAAGCACATAACAGCGCGTGTCATGTCTCAGCTTGTC
ATGGANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNTAACTGGCTTTCATTGTATTTTAAGTTTATATTTTTTTAAATCA
AAATACTGGCTTGGAGATTAACTTTGTTGGCCTTGGTTTTGGCAGTTATGTAATTCTGGC
TCTTCATTTAAAATCTTGGGGCTGAGGATTTATCTCAGTGGCATAAGCGCCTGCCTTGCA
AGCACATGGTCATGAGTTTGATCCCTGGTACCGATAAAAATAAATAAATAAAATAAAATC
TTGGCATCAATTTATTTAAAAAGTCTTCTGATTGCCAGGCGTGGTAGCTCATACCTATAA
TCCCACCACTCGAGGGACTGAGGCAGGATGATTGCTATGAGTTCAAGCAAGCCTAGATTC
CATAGTGAGGTCAAGGTCAGTCTGAGCTATATAGCAAGTCCCTATCTGAGAAAAACAAAA
AATAAAACTGAAAAGTCTTCTGGCTATCAGGGCCTGTAGGTTTAAAACGAATCTATTAGC
AGCATATTATGAGCTAATGAGATTGTAAACAACTCTGGGAACACTTTTACATTAATATCA
TACCACAGTATTATGTAAGGTTGAAGGCATCATTACCATCAGTGAGTCAGATGCCTTCAT
TTTAGAGATGAAGAAATTAAAACAATGAAGAGTGATTATTCATCTTGGCTCTGATCATGC
GTAGTATAGAGTTTAAGGTGGGCAAAGTACATAATCTTTTAGAACATTTAACTTTGTTTT
TACATTTTGAGATAATGTGTGTGTTAATCTTCTGATATTAAGTTTATATGCTTCAATATA
GCAGTACTGCTCATAAGCCAAAACATCACGAATTACCTAAATGTGCACCAACTATAATAG
AAAAATTAATTGTGAGTAATATGCCAGAATACTAGGGAACAAAACAACACTTCCATATGC
ATTAACACAGGTGAACCTTAAAAACAAGCAGTTTACCAAAGAATACAGTGTTTGGAGGCA
AGATTATTATTTAAAGGTTTAATCAAACAGGAAATAATTTCTTTTTAAAGCAAAAGAATA
TTAAAGAGAAAATCAGAATAGTTTTTATCTCTGAGGAGCAATGCTTTTTTTATTTCTTAA
ATTGAATGATATATGGATGTATACGATATTGAATTATTTTTCTTTAAAATCGACACTTAT
TTCCTTTATTTCCTAACTTTATTATTTAATATTTAGAAAAAATAATAACATGAAAAAGTT
ATACATAATTCTGGCAAGAGTACATGTCAGTACAGTCACTTAGAGGGATATTGGTAATGT
TTATAAAATCATGAACAATAAAATAAAGTTAGCATTAAACACCCTGCATAATTACTCTGC
TTGCTTGGATCTTGAGAAACCATCTCTGATTGGAGACAGCCTGGATTCCTCTGAAACACT
CTGAACTCTGCCCACATGGCCACTGCCGTCTCTCCCCATACCCTCCACACCCACTGAGCT
CCGCTCCTCCTCCCTGCTCAGCCATCGGGGCTACACACTGGCTCCCTAACGTGCTCCCAA
AACGTACAACAGCCTAAGTTCTAAGGTCAATAGCCAGGCAAGAGTTTTACTGTTTTTCCT
GCCATAAAACTCGCAGCACTCACGTCTGCCACTTACAAGAACTTGGCAAGTGTGACAGAG
ATGGTCTGCTCCACCTTGTGGCCCTCTGCTCCACTCTTACTGCAGTGTTGGGAACATTTC
GCTATGTCAATGGCTTAGAAGGCATATTGTTTCCCAGGAATGAGATCCACCCACCCTGAT
TTCAGAGATGAAGTTTTGGAATGGTTATGTTAACTACATGGTGAAAGACATGAATGCAGG
AGTAGGATTCACTAACAAGTCAAGTCGGAGGTTTTCTCAAGAGTGACTGTAATCAAAATG
TTTACTAACAAAAATATAAATATTCATTTTCCCTTCCTGGGGCTTAGGTGAGGTGCACAG
TGAGCATAACAAGATTACTAAGGCCTAACGCGTGAAAGTTTGCAGGAGTTCTTAGTAAAA
CAACCGGCCTAAATATTCCCCAATAGTATATATATCCCTGAAGTAAAGTAATTCTCCTTG
GAATAGTCCTGAGTTTCCACTCGGAATTTGTTCTGTATCTCAAAAACAAAGTTGGCTCAT
TTTCCTATTAGAGTTGGGTAATAGTCATGAAATACCAGAATTCAAATTATCTTACCATTT
TCCTGACCTGAATTTAGTGGTTGTTCCCTAACTTTGTGTGGAGTAAAATTCAGATGACTT
CATAATGTTTGTAAGGGCTGCATTACATAAACCCACTCACGGGAGTTTTGTTCCTAAGGA
GTTATTTGGGTCAGATCATCTTTCATTGCTGTTCATATGCATTCCTTCAGATTCCTCGAA
TGTAAAGCCATTTTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNGGAAGTCCTGTAATGTATACAATGCCTAATTTTATTGCTCTTGTTCTCTACTGTTTTG
TCCAACTTTATAATATCTAATGAGGATAGACAATTCTTTTTAAGGAAACAACGAGACAAC
ACTGATAACCATTGTTGATAACCTTGTACTCTGTTCTACACCATGTGCTATGTCTATCCT
TGGTTTTGACTGACAGCTTTGTTTTGCCATATTTGACTGTATTCTCTCCCCCCCCCCAAA
AAAGTAATAAGCACTAAGGAGTAATAAAATCCAAAATGTGTAAATTTTGTTGTAAAAAAG
AGAGGGAAAAAAAAGAAAAAAAAAGAAAAAGAGCTCTAACGGATATAACAGCAAGTGTGT
TTAGGGGTGTTGAATAGCTGACTATATCAATGTTTTTGGATCATTGAACACAGCTGTTTG
CAGTCTCCCTGTTTGAATGTCCACCTTGTATTCTTTGATACTGTGATTTGAGCAACTATT
TTCAAGATGATAATATGTAATCTACTAACAGGTGATTTCTTACTGTTATGTTTTTTTTTT
GTTTTGTTTTGTTTTTTTGTAGTTCTGTATTACGTGTACCCTTACACCGCTTTGTTTTGT
TTTGTGTTTTTCTCTTTTTTCCTCTTAAATAAAAAAAAAATCAATTTAAGCAATTAAGAA
CAAACCAAATAGAAAACACCGGTAGGGCTGTGGCCTGCCTGTGAGGGACAGCCCTGAACA
CACTGCGAGTGTTTCAGTACCATCCTTTTAAGTCTGTTTCTTGCAAAAGCAGGTAAGTAT
TAATACATGTCCCTGGCATTCTTTTTTCTTTCTTTTTCTTTTTTTTTTTTTTTTTTTAAT
ACTACACGTTTGCTGTGCATAATGAGTCCATTCATAGAGAGGTGTTGATACATGTATTCA
ACACATCTTATCCTTTGTACTCCTGACATTTTTCTTCCCTTCCTCCAGGCGACGTGCTGT
CTCTGGTCTGTCCAAACTCCTCCCAAGCTTGGTGTGAGATCACTAATGTGTCACAGCTGC
TGGCTTCTGTCCTCTACACGAACCCGAATTCCAGTAGAACCAACTTGAGCACTTCAACAA
ATGTAGAGAGCAAGTACAGTCTTTTTGTGGGCTTGCTACTGGCCATAAGTTCCAGTGTTT
GTATTGGCTCCAGCTTCATACTGAAAAAGAAGGGCCTCTTGCAGCTGGCCAGCAAAGGTG
CCACTCGAGCAGGTAAGAAACACACAACGAATGAATTCAAGTTTCCAGCGACAGAACAAT
CCTCTTGTGAGTCCACAATGCTACCATTGTAATCACCAACTGTTTCTACTTACTTTAGCC
CCTGACTCCTTACTTAAGGTGGCTGCGTCCCCCACAGTCTCTGACCTCCTACATAAAGCA
TACCTGTAGCGCATACCTGTAATCCCAGCATTCGGGAGGCTGACGCAGGAGGATCGTTGC
GAGTTCAAGACCATCCTGGGCTACCTAGTGAGCTCAAGGCCAGCCTGAACTGCATAGCGA
GACTCTGTCTTTAAAAGACANNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCCTTTTGTTTTATTCT
CTTTAAAATAAAAAAGGAAAGAAAACATTCAATATCGCTATATTAATTAAAATAGCTTAC
TGATGGCGTTATACTAATATATTAAGAGATTATTAAAAGTAAGTGGACCCACATACACAT
GTTTAACATGTGATTTTTTTTAAAGTGGCTTTTCAGACCAGTGCAGAAAAATGAATTATT
TAATTAAAACTGTGGAAACACTTTGAAAAAAGTAGGTAAGAAATACAAAATTTCTACTTT
ATACTATTCAAAAAAATAAATTCCACAAAGTTTAGGGTTAACTTTAAAATGAAATAATCT
TTGTAATAAACCTAAAGGAAGGCTTTTCTCATAAAGATAAAGGAAGGATTGATTCCCTAT
AAATAAAGATATGACTAGATTGATCAAAAGAAAGTAAACAGACAAAGATAAGATAGCTTC
TCTGTGGAAATACACATAGTAAATAGCCGTAAGTAAACATTATTCCCCTAGCCCCTCCCC
CCAAAATACTAGCTGTACTGTAATAAAGTCCAATAATTCCTATTCGATCATTTGCAGATT
TTGTAAGCAGATACTCCTAAGTAAAAGTAGTTAACTACTTCACAAGACAAAAGCTTTATA
GCTTATATATCTTGTTTAGTTTAGTTATAACAAAACCATCTAGATCAAAGTTAGGGAGTT
AAGTATATTAAAACTGAGAAAATTTCATTTTGTAAAGCAAACATTACAATGCCTTCAATA
GTACTGTCACTATCATGTCAGAAGTAAGTAATTTGTTGAATACCTTAGGAAAGCTTTTTG
TCCTTTTCAATAAGTACTCCAGGAAAAAATTCCTTATGCCAAGGTAAAAAGTGCTAAGTA
ACTAATGTTTATTATTGTAAATATTATTATTGTAAATATTGTATTGACTAATCCAAGCTC
TCTTCTTTCCTTTGAAATCTTCATTAGTTATCAATGCAATTTATGACTTACAGGATTTTT
TTACCATGACTAAACAAAATATTCAGTTTATAATATTCAGTGTCTGTAAGTCTGACGTAA
GTACAGTGAACTTGATTATTAAATACAATTTCACATGAGGAAAAAACTTTCTGCAGAAAT
CAAAGGTGATGTCAGTTTTAAATGACTAAAAAACTCTAAAGACCTCATTTATTCATTTGA
GCCTTGTTTTTTTCAATATAATCTAGCGTCTTTCCTGGTACTCAATTTTCTATCCCTCTT
CCCCTAATTCAAAATTTAATTTTTTTATTGCTTCTCAGTCTTTTGGCTAAGATCAAATGT
AGCAAAATTTAACTTTTAGTCTTGTTTTTCCTAGGAAAAGGTGGTCATTCTTACCTCAAG
GAATGGCTTTGGTGGGCAGGATTACTATCAAGTAAGTACTTAATAATGAGAATAGAGTTT
ACTTAAAAATAGCAAACATTTTCATGGAGGTTTCAACATTAATTTTTCTTTGAGATAAGA
ATGGAATTTAAATCTAAAATTTTACACATATAAAATATCATACGACATATGATATTACAC
TACATTCGTCCCTTTATAATCCTTACATGCTCAATAAAGAAAAAAATTGGTATTGATATA
CTTGCATTTCATCGTGAGCACCTCATATTTTCTTTCCCATAACTGAGAAAAGTACTTTCC
TCCGATATTTCCCAAACTCCTCCTTTGAATCTGTGACTGTCCTAACTACATATATTTTCT
GGAAAAAGTACCTTTTCCTTGCCAGGACCAAACATAAATAAATCCAAAGATTCTCTGGCT
GTTAACATTAGAATACACAGGGAGGAGATGAAGGCTGTCTGCGCTCTCCCTCCTCCCAGA
CTTGGTTCAGAGGAAAGGAGACTTCAGAGGTTAAGCACTCTCTACGTGCTGTGTAATATC
TAGAGAGGCTGTTATCTCCTCTTCTGAACTTTCTCAAATCCCAAATCGGAAACTTCCAAA
GACAGGGCATCATAAACTGTAGCTTCACACCACTTACAAATCATTTCCCTCTGCAGTCAG
AAGTCTTAGAGTTTCCAGAAACCGCCGTATTTCAGTATATGTAAGAATTTATTTAAGAAG
GAGCTGGAGTGCCTTTTTCTTAATAAATAGTGGACTCTAAAAGGATGATGGATATAAATA
ATTTAAATTTGTATAGGCTTTTCTGTGTTTGTTTGTTTGCTTGCTTGGGGTTTTTTGTCC
TTTTGAGACAAGGTTTCACTCTGCAGCTCAGGCTGCCTTGAACTCACACAATCCTCTTGC
CTCAGCCTCCCAATCGCTGGGAAGACAGGGTGCACCCGCACACCCAATTTTGCCTTTTCA
ACTCTAAAGATACTTTCATACTTAATTTGAATAAAATGACAAGAACCATCCTGGGAAGAT
TCGAGACAGATCCTGAATGATCCTCTTTCTCCTCTCTTGCTTACATCTCTTTACTCTCTA
CTCTCACTTTAGAATGAAAATATTGTAAGAACATCAGGAGAGAGGGCTCCATCTTGCCTC
AGCTTTCTGTAGAAATACAAATAAATAAAAATGAGATTATCCTATTAAGTNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNGAAGCAGAGAAAGGTCAA
AGCGGGGCAAGGTGACGAGATAAACCCTTCCGGGTCACGTCCACAGCGACCTCCCTATTT
TTCTTTCCGTCGTCTTGCAGCCATGGAATTGTTATTTTTTGGTTCCTTGTTACTTTGAAG
AGACCTTTCCTTTCGAGATTGCTGGCTGCCATCCTGTCTTCAAGGTCTGAAAGTCTGTCT
TTAGTTTCTTTCAAGCAGTTTTCCCAGCTTTCAGTGGAGTTTCCTGGCTATCTCTCTGAG
TCTGTTTAATGCATTTCAATTCTTCCCTGTGTTGTTCATTCAAGGTTTCACTCATTCTCC
TATGTCTTTTTCAAAAAAATCTATTTCTTCTTTAGATATATTCAGCAACCCTTTTATTAT
GTTTGTCAATTCTTTTTTTGCCTGAGGTTATTTCTGATTTCTTTTACAGCCTCGTGAAAT
AGTTTTACTTCAGTTGCCATCATTCCAGAAATTTCAGATGTGCAACTTCTGCTTTCTGCC
AGGTTCATGTCTCTTGGACTTGTTCTGTTTGGGCTGGAGGCCAGAGATCACATTTTACTT
CTTTATCTTGACATTTTCCTGGGTTCCTCCAGATGGGCAGGTTGCGAGGTCATAGGTGCT
TCCCATGTTGGCTATCTGGGATGGGTCAGGCTCCTGGGTTTCTCCTAATCTGGGTTCCCT
ATGAGGCAGTGGGATACAGGCTGGGCTCCAGACTCTTGTGGCTTCTTCAAGGCATGGCTG
GCTGGTTCTCCCTGATGGTTACCTGCAGGAGAGTCCTGATGGCTTTTTTTTTGTGAGACA
AGGTCTCACTCTGTAGTCCAGGCTGGGCTTGAACTTACCATGTCACGCAGGCTGACCTCG
AATTTGTGCTATTCCTGCTGCCTCAGTCTTCTCAGTGCTGGGATTACAGGTGTGCACCAC
CTTGCCTGGCTCCCCTACGGCTCCCCTAATGGCAAATCAGCTATAGCGCCCCACAATCCA
ATTCAATTTCAAAAACCCCTTATTTGAGCTCATGTTACAGGGGAGACCAGATATACAGCC
ATAAACAGGACATCCTGGAAAAGGCAAAACTTAGGAGAAGCTAAAGGGATCATTGATTGC
CAGAGGGAAAGAGAAGACATGAATAACCAGAGGGCAAAAGGATTTCTCCGTGCTCTGTAT
GAAACTACAATGCTGAGATTGGTTATGTGCACTTATTTATCAAGACTCCTAGAATACGCA
ACGCTAAGAATGATCCCTCACGTCCACCATGAACTCTGGGAGATAAAGGTATGTCAGTGC
AGGTTCATCCTTTCCCAACCACGTGCCCCTTGGTGTGGGGTTTCCACAGCATGCATTCAG
GGGTCAGAGATAACAGGGATATCTGTGTGTCTTCTGCTCAGGTTTGCTGTGGAACCTAGC
ATATAGATGTGCTGTAAGGGTATAAGTCATTATTTTTATTTTATTTAATTTATTTTGTCC
TTTTGAGACAAGGTTTCACTCTGCAGCTCAGGCTGCCTTGAACTCACACAATCCTCTTGC
CTCAGCCTCCCAATCGCTGGGAAGACAGGGTGCACCCGCACACCCAATTTTGCCTTTTCA
ACTCTAAAGATACTTTCATACTTAATTTGAATAAAATGACAAGAACCATCCTGGGAAGAT
TCGAGACAGATCCTGAATGATCCTCTTTCTCCTCTCTTGCTTACATCTCTTTACTCTCTA
CTCTCACTTTAGAATGAAAATATTGTAAGAACATCAGGAGAGAGGGCTCCATCTTGCCTC
AGCTTTCTGTAGAAATACAAATAAATAAAAATGAGATTATCCTATTAAGTATTCAAGAAA
GGCTTAATCCTTAAAATTCTAGGAGTCATTACAAGCACTCTCCTGTTGTCAGTTTTAGAT
TTATTTTGTGGTATTTTCTTAGTGCTAGTACCCCGTAGATTGGGGGAGGAAGGGTGCCAA
AGCGGCCAAAGAAAGGGAAAATGGGGTTCTTTTTCTTCTCTACAATAAGTGTTCGCTTGG
TGTAGTTTCCCAGCATGAAATACTGCATTCCCTGGGCAAGGGTCCAGTTGTGATCTGTGA
AACAATTTGGCTCCTTATACCAGCCCAGTTCTTAGAAAGATTCCCCTCAGTCTAGTAAAT
CTAGAGTTTCTCAAGCACAAAAATACAAAACAAATTACATTCAGAAAAGGGCACATCATT
ATGGTTTTCCAACAGCAACTTGGATCTTCTTGAGGGGCACAGATACTGTTACTTAGCTTT
GGCTTACCTACAGTTCAGCAATGCGTGACTTCATGGAGATTCCTAGCTGTCCCCACCTAG
ACACCAGATAGCTACTCTAATTTTACGAATTTCTTGCTGTTATTCATTTGCAAGACAGTA
GGTATTCCAGAGATAATAGTTTTGTGTTTCCTCCCAAGCTACCTCTGCTGGATTTTATCA
GAATGGCCAAGTATGTTTTCATTATAGAAGTAACTAAAAATCTTGCTTGAGTCATTTAAG
AAGCTGGGCATGATGGTGCATGCCTGGGAATCCCAGCACTTGGGAAACTGAGGCAGGAGG
ATTGTTGCAAGTTTGAGAACACCCCTGGATTACCAAGTGAGTTCAAGGCCAGCCTGAACT
GCGTAGTGAGACCTTGTCTCAAAAGGACAAAAAAAGAGACCATATATTCCTATTTTCTGT
ATGGTTTTTTATCACGAATCGGTCTTGGACATTGGCAAATGTTTTTTATGCATCTATTGA
GATAGTCGTTTGGTTTTTGTACTTGGCTCTGTTACTGTGGTGTACTGCATTTACTGATTT
GTATATGATGGTTATCATTGTCTTCCTGGGATGAACCATACTTGTCATGGTGTATAATCT
TCTTATGATTTGTTGCATTCATTTTGCTAGTACCGTATTAGGGACTTTTGCATCTATGTT
AATTAGAGAGATTGGCCTGTAGTTCTCTTTTTTGGTTGAGTTATTCTCTGATTTTGGTAT
TAAGGTAATGCTTGCTTCCAGTAATGAATTTGGAAGTACTGCTTCTCTTTCAATTTCATT
ATAAAGAGTTTGAGAAGTAGCAGCATTAGTTCTTTTTTAAATTTCATGTACAATTAAGCA
GTGAATCCATCAGGGCCTGGGTTTTTCTTTGTTGGGAGTGTTTTAATTACATTCTCAAAT
TTCATCTGATATTGGTTTATTTCAAATTTTTATAGTTTCTTGATTCAGCTTTTGAAGTTC
ATGTGTATCTAGGAATCTGTCCATTTCTTCTGTGTTGATAAGTAGCAGCATTAGGTCTTT
TTTATTAGCAGTGTTAGGTCTATCTTATTAGAATACAGGTTCTTGGCCAAGGATTTAGCT
CAGTGGTGTACGTGTCTGCTTGGCAAGTGCAAGGTCATGAGTTCAATCCCCAGTATCAAA
AGAAAAGAAAAGAAAAAGAAAACAGATTCTTCTGACCCTGAATCAAGGCCGGCAGCTTCC
TAATGATGTTGGTTTCAAGCAGGAGCCTAAAGAGATGTCTTTCTATGGTCTGTTTGCCAT
TTCAGAACTTGGGCAGTGAAATGGTCAATTCATTAGAAAGAAACAGCTTCAAGCAACCAC
TACCACCACCACCCCTGCAGCGCCCCACCCCCCACCCCAGCGGCTGTGAATGTGGCAGGC
TCTGACGGCCCAGGACAGTAGCATTTGCTGGGACCTGCGCCATACTGGGACCTGGAACAC
TGGGAAACCAAGCAACCCCTCCCCCTCTGCCTGTTTTGTTTTGTTGAACTTAAGTATACA
TGAAAGTATGGACAGCTATTTTGAAGAAAATGAGAGACTCTATGACTGCCATTGGTGACT
TCCCTAATATCTGGTTTTGAAGACCTAAATCGCCTTCCTCATTCTATTTGGATCAGTTTT
ATACTATGTTGTTTTGTATGAAATCTCTGTATGTGAAGACGTGGACAACTATTTGGAAGA
AAACAAGAGACAATATGATAGATAGTGAAGATATCAGGTCGTCTAGCTTTGAAATTTATA
TCTCTTACATTGCTTTCTTATGTCCTATTTTGTTCTATTTTGTTGTGTTTAATTTTACCC
CCTTTAAAAGAAAAAAAAAAAAAGAACAGATTCTTGACACAGGTATTGATCTTCTAGATT
TCTGCAGGATGTGCTGTGATTATTCCCTTTTCATTACTAATTGCATGACTTTGAATCTTT
CCTTTTTTTTTTTTTTTTTTTTAATCCGTACCGGGGATTGAACTCACTACTGCCTGCTTG
CAAGGCAGGTGCTTATGCCACTGAGCTAAATCCCCAGCCCCAGAATCCTTCCTTTTTTTG
ATAAAATTGGCTAAGGATTTGTCAATTTTATTTAATCTTTCAAAGAACCAAGTCTTCCAT
TTATTGATTCTTTGTATNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNTGGGTTAGTCCGCTGATGAGAATATGCTCCCATGACTC
AATCACCTCTCTAGGAGTCTGTTAATCCAATCAAGCTGACAGGTAAGATTATTTAGCATA
TCATTCCTTCTATCTAGATCTTTTAGTGTAATCAAGATAAAGTCCACTGCTTTGCAGGGG
TCATTTGGTTTTCTCTTCCAATAAGTAACTTAACCATATACATTAATACTTCTGCTTGCT
TTCTAGTGGGAGTAGGAGAGGCTGCAAATTTTGCAGCTTATGCATTTGCACCTGCCACCT
TGGTCACCCCTCTCGGCGCCTTGAGTGTTCTCATAAGGTAGGTGAGCAATAAAGAGTATG
GCTTCTATAGGTATTTCAGTATCGTGGTGCACTTAAGCTGTAACAAGCATATTGCTACCA
TGCTTTCCTGAAAATTAAACCTTGGTGGAAAAGCATCAGCCTTAAAAACTACAAATCAAA
AATGCCAGCCCCAAGCAGCCCTGCCTTACAGAGTAGTCACTGAGCAAAAGAATACGAATG
GCAGGTAGGCAAGGGGGTGATCAGGGCTAGCATTTTTGAATCTCTACTTTTCAAGGTTGA
TTATTTCCTGGCTAGGTCTTATTTTCAAGGAAAGAATTTTTTCCCCCTCCAAACAAAAAG
TCAATGCCAACCTGAACTCTGATAGTACAAATGACCCATAATAATTATAAGACTCTTGAA
AAGCTTTGGATAGATCACTAAACTTTAGTTCCTCATTTATAAAATGAGGATAAATTTTTT
TCTTGGACCAGAGATGTGGCTTAGTCGTGGTACATTTACCTAGACTATTAAAAATGGCAG
TAGAATTGGGAAGTCAAAATTATTTGTAAACACTATGACAGTGAATGTGGTTTCCTGCTA
GCATAAAGTAATTATGCACTACATTTGTGACTCAGTGAACTGTAGCAGAGTTTTATTTTT
GTTTTTATATCTCTCACCTGAATAAATTGCCAGAGTCCTTTTAATTCCTTCTGTGATCAC
AGTGATCGATGACTGTAGCTATCAGAGAACTTTAAAATGCAGTGTTTGGACTAAATGTCA
ATTCTCATTAAAATTCTTAAATTGTCTGCTGGATACTTCTGTTTGGATCCCCAGAAGTTT
CTTGTAGTACAGGAAGACTATTAAAAATAGCATGTGGATCATAGTATGTGGGATTGGTTT
TTCTGAATTAATGTATGGTGTGATCCCAAATACCTGTGCTCAGTGAGGTCATGAACTCAT
TTTGTGGCGGGGCTACCATTTTGTCTTTCTCATCTCCATTCACTGTCAGCCTCTACGAGA
AAGCTGATGATTGAGCCTACTCACTCTTATTTATCCTTGCTATAAGAATTTTTCCTGAGA
ATTAAGGAATACAATAAAGCACACAGAACTCCTGTCTTTAAAGTGAATGAATAGTATAGT
GATAGTGTGAGTATTCACTAAAGCTACAATCCCACAAGCCGCCACGTGAGGACAATTCTA
GGAAAGCACCTGGTGATTGCTCCTCATCTTGAGGGTGAGTAAGCACCATTGTTTGCAGTA
CTGGGGGTGCCAGAATATCCAAGGAAGGAGGCTGGTATCCAGGAGCCCCACTGCTATTTT
GTTTTGGGTTTTGATGTGGGATCTTGCTATATAATTTAGGCTGGCCTTGAACTCACTGTG
TAGCCCAAACTACATAGTGATCCTTCTGCCTCAGCCTACAAATGCTAGGATTATAGGCAT
GGTCCCATTGCGTTGGGACTCTGACAAGGCTGAATATCATGGCAAGGTGCACATGCTAGA
GTAAAGCTGCNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCTGGTCCTATGCATTTCAGATAAGGGATA
CTGTATCGTGCCAGTAAAATGTGAAAACTCTTTTGTTTGCTTGACTTTATAGGAGAAATG
GGACAACTGCAAAAGAACAGAGCTTCTTAGAAGGTCTTGGAGGATGACAGGACTGTTAAA
TGTCTATGATAGCTCTTCAGATATAAAAGCATTGAGGCACAGGTGATTGGCCACCATTCT
GAGTGTACAGCTCACCCAGACTTTTTGTGTCACATAGCATATTCAGGTCTGCTCATTGGG
ATACTGCCGTATGACTTCTGAGCTGCTGTGGAATCAAAAGGTAACTGAACCACAATGATT
GTATTTTTTTTCTCTCCCTGCAGTGCAATATTGTCTTCCTATTTTTTAAATGAGCACTTG
AACATTCATGGAAAAATAGGCTGCATATTAAGTATATTGGGGTCAACCGTGATGGTTATC
CATGCCCCACAAGAAGAGGAAGTCACTTCTTTGCAGGAAATGGAAATGAAATTGAGAGAC
CCAGGTTTGTGAGTCAGCCTAAACAGTAAACATTCAACTTCTGCTTCTCTTTCTGTCCTA
ATCAAGTGATAATTGTAATAATGTAGTAATAGTGCTTGTGCAAACCTAACTGCAGATTGT
GTGACACAGTAAGATTTGTTTACTACAATTCTGGAAAAGTGAAAGCATTTATTTTTGTGT
CTATGTAATGAACGGGAGAGATAGGCTTGGTAGAGGCATAAGATTTATGATCAAATTTTT
GGTATTTTCACTCTAAATTTTAAAATGGCAGTACCGTCTGACCTAATTATACTGGCAAGA
TTCAGATGATGTGTTTGTGAAAGTTTTTTTTATAAAATGAAAACTGCAATAGAATTGGTT
TTAATTTAATCTTCCATTTCTAAAGCACCTATCCGTTTAAATTCATGACTAACAAAATTC
CAGAAAGGCGTGATCTTTGCGGAAAATTAACATTTTCTGAAGTATAATTCCTTTCTCTTT
TTAACAGGATTTATCTCCTTTGCTGTGATCGTAACTGTGATCACCTTGGTGCTGATTTTA
ATTGTAGCTCCCAAGAAAGGACAGACCAACATCCTGGTGTACATTCAATCNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNTCCCTGAGTCCCAATGCGTAGGCCGGTCCA
TTCTGTAAAGGTCCTTATAATTACTGGGTTTTTATTGGATGCCCACACGTCTGTCAGGGG
TCGTCAACTTTTCTGTGAAACTTGCCTGAAACCTGTTTGCGAAGAAGTACTGCCAAAATT
AATGCAGCCTGTTTTGTGCTTAGGTGCCTGAAGGAAGATCCTGCCACCATGTCCCTGCTG
CAGAGAAGCCTGGATCCTGAGAAGACCCTGGGCCTAGTGGATGTGCTCTACACAGCTGTA
TTGGACCTAAATCGTTGGAGGGCAGGAAGGTTGGTACGCACCAGTCACTTGAATTGTCTG
TGCAAGAGCTGTGTGTAAAAGAAAAAAAATCATTTAGGTCCATACCCAGAGGGGGTGCAG
CCTCATAGGTTCTGTGTGTGCTCATGTCACTGATTGTGTGTGAGTAAATAAGCAACCAAG
AGAGCTTTTCAGCAACTTTTTATCTTGGGGTTAATTTAAACTCACAGAACATTTGCAAGA
ATAGAACAAAGAATTGCTCTTTGCCATTTACTCAGATTCCCTAATTTGTTCACACTTTGC
CCTCATTTTTTTATCATGAGGGTAAGTCCATCAGGGGAACTTTCAGTTCAGTTCACAATC
TCTTTAGGAACTGGGAGCAGAAAAACGTTTAGAAAATTTACTTATGTCTTTCATGAAATT
TACTTGTGTCTGAAAGTTGTTGTAAGATCTGTTGTAAGATTATCTCTTTGTGAACTGTTA
GTTTTTGAACTGATAAAGATCTTGAACTTCTACCAGTGGGCCAGGGAGGTAGATCATCGG
CACTGTGCCTGCCTGGCAAGTGTGAGGCCCTGAGTTTGATTCTTAGTGCCAAAAAAAAAG
TCTAGCTGTGCCTCCTTTCCATTTATTTCTTAACTCCTGAGTACACACACAAAGGCTGAT
AACAGTATCATGACTTCTGTGTGGTTACACCAGCCATCATCTGCCTGAGCTTGTACGCTT
TGCCCTTTTTTATCCTTCTTGTTCCCTTTCAGCACAGGAAAAGAGTGCTCAGAAATCTTT
AGAAATAACAGCCATCCATTCAACAATATTGGTGTATAGTGACCAGAGTCCTCCCTATGC
CACCATCTACTGTGTAGATTTGTCCACTGACCTTCTGGATTTGCCTGGCTCTTAGTCCCT
GTCCTGAAGACACAGAGCCAGGCCCAGCCAGTTGCATCCCCCAGTCTATCCATGCTTTGC
TTTCCCTTGCTACCAAACGTTAGCATTTTCTCAGCCCTGTGTTAGAGGGTATAGATTAGG
AACACTCAAATCTCACTTGAGTGCTCATTTATATATATGGGAAATAAGTGAACCTGATAT
TAACCACAGGGTCTTTCTTGTTTTTAAAGTTTTTGGGTTTGTGTGTTCCCGAATATTGAA
CCCAGAGCCTCATGGATGCTAGGCATCGAAGTCTTTCTTACATACAAAGAGGTCCAGGGC
CAAGGATTTAGGTCAGTGCTGTAAGCAACTGCCTGGCAAGTGTGAGGTCATGAATTTGAT
CCTTGGTACCAAAAAAACCCCAAAGAGGTCCATTTCATTTTCCAATATGTAAATTTGGTT
TCTGTTGTTTTGTTTTGTTTTGTGGGGGGGGTTTGTCCCCAAATAGGGAACAAGCTTTAC
CTTGCATCCAGATCCAGCTTCAAAGAGAGATCTGTGACTTTGGGAACCAGGCTGACCTGC
CTTCTGGAAATGGAAACAAACCTTCAGGTGGCCTCCAGAAGACATTCTCCAAACTGACAT
CCCGCTTCACCAAGAAAGCATCATGTACCAGCTCTAGCAGCAGCACAAATTATTCCATCC
CAAATACCCCTTCCAAAAATGTCTTCATAGCTGGGTGTTCAGAAGAGAAGGCCAAAATGC
CCACTCATATTGATACACGGTTACAAAGCATTTTGAACACTGGTAATTTCCCTAGGACTA
CAGATCCCTCACAATCAGCTCAAAATTCCAACAATCCAATGGCCAATGGTTTTCTCGTGG
AGAGGCGTGAAAACTTCCTGCATGGGGATGACAGCAAAGATGAGAAGGGCATGAACTTAC
CAACTGATCAGGAAATGCAGGAGGTGATAGATTTTCTCTCAGGCTTTAACATGAGCCAGT
CGCATCAAGGTTCTCCACTGGTGACAAGGCGTAATTCTGCTGTCACAGCCATGATGACTG
AGCAGAAGGCAGGAGCCGTGCAGCCATCACTGCCAGTGCCCCCTTCACCGCGGCAGACAC
AACCTAGGACACACACAACTCTGACACCCCATCCAGGTCCTGCACCTCAGCAACAGTCCC
CAAAGCAACCGCAGCCCCAAGTCCAATACTACCAAAATCTGCTGCAACCCATTGGGCCAC
AGCAGCCCCCACCTCAGCCTCAAGCACCTGGAAAATGGGTACACAGCTCAGCCCAACAGC
CAGCACAGCCTGTGGGAGCAGGTCTGTCTCCTCTTGTTCAGTGGCCTGGCATATCTGATC
TCAGTTCTGACTTGTACAGCTTGGGTCTAGTGAGCAGCTATATGGATAATGTGATGTCGG
AGGTTTTGGGACAGAAGCCACAGGGACCTAGAAATAACACCTGGCCAAACCGTGACCAAA
GTGATGGAGTCTTTGGAATGTTGGGAGAGATTCTGCCTTTTGATCCTGCAGGTACGTGAG
ACCTTCCCATTTCTTACACCATTTGAACATAAAATGTAGGACTTCTCTGGCTGGGTATGG
TGGCACATGCCTGGAACCTCAGCGTTCAGAAGGCTGAGGCAGGATTGCTGTGAGTTCAAG
TCCAACCTGGAATATATAGCAAAAAATAATAATAGTGACTGTTAAGCCCTGTCTGTGATA
CTCTTACTTACAAAGGTAAAAGAATTGAATTCTCTTTTAAAGACCACTTTTCACTGTGTG
AGAAGCAAGTACAGGCCAGATCTAGCAAGAAAGAAAGCAATAGTGAGAAAGAGATGGAAA
AGGTAATTGCAACTACATTTCACTTTATGCAGGACAGGATTGAGGCTAAAAGAAGTGGAG
CAAATTGCTCATACTCCTGTAGCTTAAATGGGTATCAGTCTAGGCCCTCCTGCTTCTGAG
AGTCAAGGCAGATGGCCCTTTGTAGGTAACATTATCTCTGGTTATACAGCTTGTTCTGGT
GGTGCTCATTTGTCTAAATGCTGGTACTTATTTAAGATGGTAGAACACCCCTCTGCCTTC
ATAGACTATGAAGCTTCTTCTAGCCTAGATAGTAAAAAACAAAACCATCAGATTGACTCT
AAGGAATTAGAGAAAGATATAAGGGGCTGGAGATGTGGCTTAGTGGCACAGTGCCTGCCT
GGCAAGCACAAAGTCCTGAGTTCAATTCCCAGTACCAAAAAAAAAAAAAAAGAGAGAGAG
ATAAAACCAAATTAATAAAAAGGAAAAATACAGGGCTAGATATTTAGCTCAGTGCTAGCA
AGCACAAGGTCATGAATTCAATCCCCAGTACAGAAAAAATGAAAAAATATAGCCAGGCAT
GGTGGTGCCTGCCTATAATCCTGGTATTCCAAGAGAATAAGGCAGGAGGACCAAGTTCAA
GCCCATTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCTAGCAATTTTT
AAGCAAAACAAAATAAGCCCCTCACCCAGTAAAATATGAATAAAAGAAATTTTCTTTTTG
GATTTTTTGAAACACGGTCTCAAAAAGTTCACTATATAGTTCAGTGTGGCCTCAAACTCA
CAGTGATCCTCCTGCCTCAGCCTCCTGAGTGCTGGGATTAAAGGTGTGTGCCACCACACC
TGGCAGAAATTTCTTGAATATAGAAAAGACTGTATCAAAAGCCAGTAGCAAATAATGTCT
TACATAATGAAACAAATCATTTCAGTATTAAAAAAAAAAAACAGTAAACAGCCGGGGTTA
GCCATTTTAATCTGTAGCATGTAACTCTTGACTTAGAATTTCTAGCAAATGCAGCAAGAT
GAAAGTAAAGTAAGTGTATAAACTCTAGGAAATTATAGATTAAGAAAAAGTATTTCTCTC
CAGGTGTGGTGGTACACCTGTAATTCTAGCACTCTGGGAAGCTGAGGCAGGAGGTTCACA
TTTTGAGCTCATCCTGGGCAACTTAGTGACTTAGGTGAGACTCTGTCTCAAAATGAAAAA
TTTTTAAAAAGAGCTGGGGATGTATTTCACATGAGAATGCCCTAAATTTAATCCCCATCC
CTGCACTCTCCCCAAAAGCACATCTCTTTGTTGGTAATAAAATTAAAAAAGCAACTCCTT
TCTCCTAAAAAAAGCTTCTAAATTATTAAGAGTATATGATAAAGTACATGCCATTTAGGT
ATATAGATACAGACCTTTATACTAGTTTTTGTTTTTTTCTTTTTGGTACTGGGAACCTTG
CGCCTGCCAAACAGGCGCTTATACCACTGAGCTGAATCCTCAGCCCCCTTTTTTTTTCTA
ATTCAGCAAAAGGAATTCAGAAGTGAGAAATATATTCCATCCATAGGAAGAATACCAGGA
AATATTATAAATAAGCATAGCAAATATTTGTCCAAGTAAATAAACACCAGAAAAGGAGAT
TCTTTGCTAAAATACCCTAGCACTAAATGAAAGATATGTCTGCTTCTATCTTTCAGAAAA
CCTCCCAGGGCTGCCCAGGCTGGCTTGTTCATCTTCTTGGGTAGATGGATGCAGGGCACA
TTGCACCCATAGTCCTGGGCCACAGACCAGGGAAAGTTCTACCCTTCTATGAAAGTGCAA
TCCCCCCTGGCTGCCACCAATGGGCTGGGCATGACTTATTTCCCCAGTTGGTGATAAATG
TTCTGAACACTTCTTGACAGTCGGTGTAACTAAATCAAGAACACAGATACAGCCAGGAAT
GGTGNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNN
NNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNNCCATGGT
GGTGACTTGTTCTGCCATCTTATTCCAAGAGTGGTATGGCATGAAAGCTGGAGATATCAT
CGGAACCTTGAGTGGCTTCTTCACCATCATCAATGGTATCTTCCTTCTACATGCTTTTAA
AAATACTGACATTACCTGGAGTGACCTGACATCCACTGCTAAGGAAAAAGTCCTTTCTCC
AAATGCCAATGAGAACAATTACATGTTACTAGAGAATGTCGATTTTTCAGCAGCAGGATA
TGAAGATGACATGACCTTGTTTAGCAGGACAGATGATCAAAGACTCTGTAAATCCTAAAT
TTTTCACCAGTATAAGACACTTTGAGAGGAAAAGAACACTTATTGTTGAAGTACTGTTGG
GAAAATAGGTGTTTTTAAAATTCTAATACTTTAAATGTGAGGCCAGATTTTTAAAAAGTT
ACTCACTTGGGCCATCAAATTTGATTATCAAGTTTTGATATTCTTCCAGAAGATTTCCGC
ATCTTTTCCATAACTGCATATTTTAAAATATTGCCTAAGCATGAAAGAAGTCAAAGAGTT
ATATTTGTCTCAGCATAAGCTCTTCTGACCACAATAGATTTGACTTTGCCCGGTGGGGCC
TCATTTCCTTGATGGCTTCTCCTAGATTTGTGCTAATTCTCAGACCAAGTTATCTGTGTT
CAGATCAATGAAGTCACCATTCTGTGATGAGCCATAGTCTCACATTATTAAAATTGAGAA
GTGAGAATACTGTTGGTTTATCCTCCGTTCAGCAACTTCCTTCTTTTTAAGCCATAAAAC
TACTAAAGGCCAGAGTATTAAAGAATAAAACAGGCCTGCTGTCAGAATCTGTACCTCAGT
GGGCTGGAATAAACACGCACACCCACCCATGAAGACGTCAATTATAGTTTATTCACAAAG
TAAAGACTTTGTTGGCAATTAAAGAGGGGGATGGAGAGGGGAGGAGAGTACTTCAGACCT
CAGATAAAGGAAATGAATTTTCCCAAAACCCCATGTACAACAAACAGGTTCTTTGCACAC
AGATCTGGACAGCATCAGACAAAATGAACTTGCTGGTGAAGTCCAGGTGAATTCAGCTTT
AAAGTTATTTATATTCATTTTGTCCTATTCTTTATTATCCCGTAGTTTAATTTTCTTGAT
GACAGATATTTTTGGGAAATAGCTGCTACGTTTTTAGGGCTAATATGGTCCACATTAACT
TTTTTTTTTTTCTGGTCCACATTAACTTTTCTCAAATATTTTATACCTATGGGATAGGTT
TCCCAAGGCTGTTTGGAAAC
  Untranslated Region
  Coding Sequence
  snoRNA
1001..1046, 10908..11171, 13414..13470, 20646..20736, 23603..23763, 24247..24341, 24344..24349, 30313..30819
1001..1046, 10908..11171, 13414..13470, 20646..20736, 23603..23763, 24247..24341, 24344..24349, 30313..30819
Copyright © 2008 RI Laboratory, Frontier Science Research Center, University of Miyazaki, All rights reserved